EL CANNABIDIOL COMO UN NUEVO INHIBIDOR DE ID

Comentarios

Transcripción

EL CANNABIDIOL COMO UN NUEVO INHIBIDOR DE ID
 EL CANNABIDIOL COMO UN NUEVO INHIBIDOR DE ID-­‐1, LA EXPRESIÓN GÉNICA EN CÉLULAS DE CÁNCER DE MAMA AGRESIVOS REVISIÓN MCCR La invasión y la metástasis de las células de cáncer de mama agresivas es el paso final y fatal
durante la progresión del cáncer y es el menos comprendido genéticamente. En la actualidad
existen intervenciones terapéuticas, pero aún están limitadas para los cánceres de mama que son
agresivos y metastáticos.
El Id-1 es un inhibidor de los factores básicos de transcripción, este ha demostrado ser un regulador
clave del potencial metastático del cáncer de mama y otros tipos de cáncer. Cuando se hicieron los
experimentos se notó que las células del cáncer de mama metastásico se volvieron
significativamente menos invasivas in vitro y menos metastásicas in vivo cuando se había reducido
el Id-1. En este caso se informa que el CBD podría regular el Id-1 en las células de cáncer de mama
agresivas. Las concentraciones eficaces de CBD en la inhibición de Id-1 se correlaciono con los
utilizados para inhibir el fenotipo proliferativo e invasivo de las células del cáncer de mama.
Debido a que el CBD inhibe el Id-1, esto podría ser una nueva estrategia de diseño racional de
medicamentos y tratamientos para crear análogos mucho más potentes y eficaces, pero también la
reducción de Id-1 con el CBD podría proporcionar una estrategia terapéutica para el tratamiento de
cánceres agresivos, ya que se demostró que la acción de Id-1 está relacionada con casi todos los
tipos de tumores investigados.
Al proponer el uso de CBD como inhibidor de Id-1 representa una nueva estrategia para tratar el
cáncer de mama, una amplia gama de cannabinoides fueron probados y el CBD era el inhibidor más
potente de la agresividad de las células cancerígenas.
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
RESUMEN ABSTRACTO La invasión y la metástasis de las células de cáncer de mama agresivas es el paso final y fatal
durante la progresión del cáncer, y es el menos comprendido genéticamente. Clínicamente, existen
intervenciones terapéuticas aún limitadas para cánceres agresivos y metastáticos de mama
disponibles. Claramente, se necesitan urgentemente terapias eficaces y no tóxicas. Id-1, un inhibidor
de los factores básicos de transcripción hélice-bucle-hélice, se ha demostrado recientemente ser un
regulador clave del potencial metastásico de mama y cánceres adicionales. Utilizando un modelo de
ratón, se determinó previamente que las células del cáncer de mama metastásico se volvieron
significativamente menos invasivas in vitro y menos metastásica in vivo cuando se había reducido
reguladamente Id-1 mediante transducción estable con anti sentido Id-1. No es posible en este
punto, sin embargo, para utilizar la tecnología anti sentido para reducir la expresión de Id-1 en
pacientes con cáncer de mama metastásico. En este caso, nos informan de que el cannabidiol (CBD),
un cannabinoide con un perfil de baja toxicidad, podría regular el Id-1 en las células de cáncer de
mama humano agresivas. Las concentraciones de CBD eficaces en la inhibición de Id-1 de expresión
se correlacionó con los utilizados para inhibir el fenotipo proliferativo e invasiva de las células de
cáncer de mama. CBD fue capaz de inhibir Id-1 de expresión en el ARNm y proteínas de una manera
dependiente de la concentración. Estos efectos parecen ocurrir como el resultado de una inhibición
del gen de Id-1 a nivel de promotor. Es importante destacar que el CDB no inhibió la invasión en las
células que expresan ectópica Id-1. En conclusión, el CDB representa el primer agente exógeno no
tóxico que puede disminuir significativamente Id-1 en las células del cáncer de mama metastásico
que conducen a la baja regulación de la agresividad del tumor. [Mol cáncer Ther 2007; 6 (11):2921-7]
INTRODUCCIÓN El desarrollo del cáncer de mama y su propagación a otras partes del cuerpo requiere de varios
cambios genotípicos y fenotípicos en las células que conducen a des-diferenciación, proliferación
incontrolada y la invasión. La invasión y la metástasis en los otros tejidos del cuerpo es el paso final
y fatal durante la progresión del cáncer y es el menos comprendido genéticamente. A pesar de
todos los tratamientos disponibles en la actualidad, el cáncer de mama es más a menudo incurables
metástasis clínicamente aparente, una vez se desarrolla.
Las proteínas Id hélice-bucle-hélice son reguladores negativos de los factores básicos de
transcripción hélice-loop-hélice. Fuerte evidencia ahora sugiere que la identificación de la familia de
las proteínas hélice-bucle-hélice controlan los procesos celulares relacionados con la progresión
tumoral. Hemos encontrado que la reducción de Id-1 utilizando la tecnología anti sentido condujo a
una reducción significativa en la proliferación de células de cáncer de mama y la invasividad in vitro
y la metástasis in vivo en ratones. Además, de Id-1 sobreexpresión en células de cáncer de mama
también se encontró que era uno de los genes más importantes dentro de un gen establecido una
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
firma que se correlaciona con la propensión de las células de cáncer de mama humanos primarios a
la metástasis al pulmón.
La reducción de Id-1 expresión podría proporcionar una estrategia terapéutica racional para el
tratamiento de cánceres de mama humanos agresivos. No es posible en este punto, sin embargo,
para utilizar la tecnología anti sentido para reducir la expresión de Id-1 en los seres humanos con
cáncer de mama metastásico. En nuestra búsqueda de un compuesto exógeno no tóxico que podría
inhibir la expresión Id-1, un agente candidato potencial, el cannabidiol (CBD), fue descubierto.
El sistema endocannabinoide se descubrió a través de la investigación se centra en el componente
psicoactivo del cannabis sativa, Δ 9-tetrahidrocannabinol (Δ 9-THC) y otros cannabinoides sintéticos.
Δ 9-THC y agonistas de cannabinoides adicionales han sido demostrado que la interacción con dos
receptores acoplados a proteínas G nombrado a CB 1 y CB 2. Estudios más recientes han
demostrado que CB 1 y CB agonistas del receptor 2 se muestran prometedores como inhibidores
tumorales. Los efectos psicotrópicos de Δ 9-THC y agonistas de cannabinoides adicionales, mediada
a través del receptor CB 1, limitan su utilidad clínica. Además de Δ 9-THC, CBD también está
presente en cantidades significativas en C. sativa. CDB no tiene afinidad apreciable para CB 1 o 2
receptores CB y no tiene actividades psicotrópicas. CDB se ha demostrado que inhibe la metástasis
del cáncer de mama in vivo en ratones. Sin embargo, la modulación de una vía de señalización
distinta que explicaría la acción inhibidora de CBD sobre la metástasis del cáncer de mama no ha
sido dilucidada.
Nuestros datos presentados aquí indican que el CDB representa el primer agente exógeno que se
puede regular a la baja Id-1 en las células de cáncer de mama hormona independiente agresiva.
Sugerimos que el CDB baja regulación de Id-1 y la inhibición de la proliferación celular
correspondiente cáncer de mama humano y la invasividad proporciona un mecanismo potencial
para la actividad antimetastásica del compuesto.
MATERIAL Y MÉTODOS LA CULTIVO DE CÉLULAS Y TRATAMIENTOS Se utilizaron las líneas celulares de cáncer de mama humanas MDA-MB231 y MDA-MB436 obtenidas
de la American Type Culture Collection. Para preparar las células MDA-MB231-Id-1, las células
fueron infectadas con un vector de expresión pLXSN-Id-1 sentido. En todos los experimentos, las
diferentes poblaciones de células se cultivaron primero en medio RPMI que contenía suero bovino
fetal al 10%. En el primer día de tratamiento, se reemplazó el medio con control de vehículo o
fármaco en RPMI y suero bovino fetal al 0,1% como se informó anteriormente. Los medios de
comunicación con los compuestos apropiados fueron reemplazados cada 24 h. Δ 9-THC, CBN, CBD,
CBG, y CP55, 940 se obtuvieron de los NIH a través del Instituto Nacional de Abuso de Drogas.
WIN55 ,212-2 fue adquirido de Sigma-RBI.
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
ENSAYO DE MTT Para cuantificar la proliferación celular, el ensayo de MTT se usó (Chemicon). Las células se
sembraron en placas de 96 pocillos. Al término de los tratamientos farmacológicos, las células se
incubaron a 37 ° C con MTT durante 4 h, y luego isopropanol con HCl 0,04 N se añadieron y se leyó
la absorbancia después de 1 h en un lector de placas con una longitud de onda de ensayo de 570
nm. La absorbancia del medio solo a 570 nm fue restada, y el porcentaje de control se calculó como
la absorbancia de las células / control tratados × 100.
ENSAYO DE INVASIÓN DE CÁMARA DE BOYDEN Los ensayos se realizaron en cámaras de Boyden modificada (BD Biosciences) como se describe
anteriormente. Las células en 1,5 × 10 4 por pocillo se añadieron a la cámara superior en 500 l de
medio libre de suero suplementado con insulina (5 mg / ml). La cámara inferior se llenó con 500 l de
medio acondicionado de fibroblastos. Después de un 20 h de incubación, las células se fijaron y se
tiñeron como se ha descrito anteriormente. Las células que permanecieron en el Matrigel o unidos a
la parte superior del filtro se retiraron con puntas de algodón. Invasoras células de cáncer de mama
en el lado inferior del filtro se contaron usando un microscopio de luz.
ANÁLISIS WESTERN CUANTITATIVA Las proteínas fueron separadas por SDS-PAGE, se transfirieron sobre membrana Immobilon, y se
sondaron con anti-Id-1 y el anticuerpo secundario apropiado como se describe anteriormente.
Valores de intensidad de banda se obtuvieron directamente de la mancha utilizando software
AlphaEaseFC o de película usando Imagen-J (NIH). Como control de normalización para la carga,
transferencias fueron despojados y reprobed con el ratón alfa-tubulina (Abcam).
PCR El ARN celular total fue aislado de las células de cáncer de mama tratados con control de vehículo o
con CDB. Las transcripciones de Id-1 y β-actina para fueron transcritas inversa-utilizando
Superíndice II Reverse Transcriptasa II (Life Technologies) y la PCR se hizo. Los 5 ‘y 3′ cebadores de
PCR
fueron
AGGTGGTGCGCTGTCTGTCT
y
TAATTCCTCTTGCCCCCTGG
de
Id-1,
y
GCGGGAAATCGTGCGTGACATT y GATGGAGTTGAAGGTAGTTTCGTG para β-actina. PCR se realizó en
tampón que contiene 1 mol / L de cada uno de los 5 ‘y 3′ cebadores de PCR y 0,5 unidades de Taq
polimerasa utilizando 25 ciclos para la amplificación de Id-1 y β-actina ADNc. Las condiciones del
ciclo fueron 45 s de desnaturalización a 94 ° C, 45 s de hibridación a 55 ° C, y 1 min de extensión a
72 ° C.
ID-­‐1 PROMOTOR REPORTERO ENSAYOS Un fragmento de Sac I-Bsp HI de 2,2 kb correspondiente a la región aguas arriba 5 ‘de humano de
Id-1 gen y la conducción de un gen de la luciferasa en un vector PGL-3 (Promega) ya ha sido descrito
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
(Id-1-sbsluc). Las células se sembraron en placas de seis pocillos en el medio suplementado con
suero bovino fetal al 10% y 5 g / ml de insulina. Después de 24 h, las células se cotransfectaron con 6
g de plásmidos informadores de luciferasa y 2 g de pCMVβ (Clontech) utilizando un reactivo
Superfect (Qiagen). pCMVβ contenía β-galactosidasa bacteriana y sirvió para controlar la variación
en la eficiencia de la transfección. Tres horas después de la transfección, las células fueron lavadas
dos veces con PBS y se cultivaron en ausencia o presencia de CDB durante 48 a 72 h. Los
sedimentos celulares se lisaron en 80 l de tampón de lisis reportero (Promega) durante 10 min a
temperatura ambiente. Las células lisadas se centrifugaron y los sobrenadantes se cosecharon. Los
ensayos de luciferasa y β-gal se realizaron utilizando el sistema de ensayo de luciferasa (Promega),
kit de ensayo de β-Gal (Clontech), y un luminómetro 2010 (PharMingen).
ANÁLISIS ESTADÍSTICO Los valores de CI 50 con sus correspondientes 95% límites de confianza se compararon mediante
análisis de datos registrados (GraphPad Prism). Cuando sólo los límites de confianza de los valores
de CI 50 se superponen, las diferencias significativas se determinaron mediante la prueba t de
estudiantes para datos independientes. Las diferencias significativas se determinaron (Prisma)
usando ANOVA o la prueba de la t de Student para datos independientes, si procede. BonferroniDunn análisis post hoc se realizaron cuando sea apropiado. P <0,05 valores de significación
estadística definida.
RESULTADOS Los cannabinoides reducen el crecimiento de células de cáncer de mama humano agresivos
Con el fin de probar sus actividades antiproliferativas, se eligieron tres grupos de compuestos
cannabinoides: (a) constituyentes de cannabis naturales que tienen afinidad para CB 1 y CB 2
receptores, Δ 9-THC y CBN; (b) los análogos de cannabinoides sintéticos que tienen alta afinidad
para CB 1 y CB 2 receptores, WIN55 ,212-2 y CP55, 940, y (c) los componentes del cannabis naturales
que no tienen afinidad apreciable para CB 1 y CB 2 receptores, CDB y CBG. Células de cáncer de
mama fueron tratadas durante 3 días y se calcularon los valores de CI 50. El orden de rango de
potencias de los efectos antiproliferativos de los cannabinoides en las células MDA-MB231 fue: CBD
= Δ 9-THC = CBN> WIN55 ,212-2> CBG = CP55, 940. El orden de rango de potencias de los efectos
antiproliferativos de los cannabinoides en las células MDA-MB436 fue: CBD = CP55, 940> CBG =
WIN55 ,212-2 = Δ 9-THC = CBN. En general, los datos mostraron que el CDB fue el inhibidor más
eficaz de células de cáncer de mama humano.
LOS CANNABINOIDES REDUCEN LA INVASIVIDAD DE LA CÉLULA DEL CÁNCER DE MAMA Invasión es un paso importante hacia la metástasis de las células del cáncer de mama. Por lo tanto,
el próximo determinado los efectos de varios cannabinoides sobre la capacidad de la línea celular
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
de cáncer de mama humano más agresivo, MDA-MB231, para migrar e invadir una membrana basal
reconstituida en una cámara de Boyden. Los tres compuestos probados, es decir, el CDB, Δ 9-THC, y
WIN55 ,212-2, redujeron significativamente la invasión de las células MDA-MB231.De nuevo, como
se observó con los experimentos de proliferación celular, el inhibidor más potente de la invasión fue
CDB.
CBD DOWN-­‐ID-­‐1 REGULA LA EXPRESIÓN Se predijo que el CDB, el inhibidor más potente de la proliferación de células de cáncer de mama y
la invasión probado, sería regular la expresión de genes clave que controlan la proliferación de
células de cáncer de mama y la invasividad. Una proteína candidata potencial que podría mediar los
efectos de la CDB en ambos fenotipos era la proteína hélice-loop-hélice Id-1. Se determinó que el
tratamiento de células MDA-MB231 con CDB llevó a una inhibición dependiente de la concentración
de Id-1 expresión de la proteína. El efecto inhibidor de CDB en Id-1 de expresión ocurrió a
concentraciones tan bajas como de 100 nmol / L. CDB fue significativamente más eficaz en la
reducción de Id-1 expresión de la proteína en comparación con otros compuestos cannabinoides.
Las concentraciones de CBD eficaces en la inhibición de Id-1 de expresión se correlacionó con los
utilizados para inhibir el fenotipo proliferativo e invasiva de las células MDA-MB231. Por otra parte,
la baja regulación de Id-1 de proteína en presencia de CBD parecía preceder, y no seguir, los efectos
inhibitorios de la CDB sobre la proliferación y la invasividad de las células MDA-MB231, lo que
sugiere que Id-1 baja regulación representa un causar lugar de una consecuencia de una
disminución de la agresividad de células de cáncer de mama.
LOS EFECTOS DE LA CDB SOBRE INVASIÓN E ID-­‐1 EXPRESIÓN DE PROTEÍNAS PUEDEN SER REPRODUCIDOS EN UNA LÍNEA ADICIONAL DE LA CÉLULA DEL CÁNCER DE PECHO Sobre la base de los datos presentados en, CDB también podría disminuir la proliferación celular en
otra línea celular de cáncer de mama que no sea MDA-MB231, las células MDA-MB436. La línea
celular MDA-MB436 metastásico es capaz de invadir a través del peritoneo y colonizar órganos
viscerales cuando se inyectan en ratones atímicos. Sin embargo, estas células son menos
metastásico que la línea celular MDA-MB231. El uso de las células MDA-MB436, confirmamos los
efectos de la CDB sobre una disminución de la invasión celular asociada con una baja regulación de
Id-1 expresión de la proteína. Estos datos sugieren que los efectos de CBD sobre fenotipos celulares
de cáncer de mama, potencialmente a través de una disminución en la expresión de Id-1, no se
limitan a una línea celular particular, pero podrían representar un fenómeno más general.
CBD INHIBE LA TRANSCRIPCIÓN DEL ID-­‐1 GENE Con el fin de determinar si CDB modulada Id-1 a nivel de la expresión génica, se investigó si Id-1
mRNA se redujo reguladas por el CDB. El uso de PCR con transcripción inversa, de Id-1 la expresión
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
de ARNm se redujo significativamente tras el tratamiento con CBD en células MDA-MB231. Para
determinar si este efecto era debido a la inhibición de la transcripción, se utilizó un constructo que
contenía el promotor de Id-1 fusionado a un reportero de luciferasa en un vector básico PGL-3. Esta
construcción se transfectaron de manera transitoria, y 24 h después de la transfección, las células-1luc MDA-MB231-Id se trataron con CDB de 2 o 3 días y la actividad luciferasa se midió. Eficiencia de
la transfección y el análisis de cantidades iguales de proteína total fueron controlados por
cotransfección de las células con pCMVb que contienen β-galactosidasa. El tratamiento con CBD
resultó en una inhibición significativa de la actividad de la luciferasa, con la mayor inhibición que
ocurre en el día 3. El efecto de la baja regulación de Id-1 mRNA y de expresión promotor también
podría reproducirse en la línea celular MDA-MB436. En general, todos estos hallazgos se
correlacionaron con la inhibición de Id-1 de expresión tal como se evaluó mediante análisis de
Western.
CBD NO INHIBE LA INVASIVIDAD CELULAR EN CÉLULAS QUE ECTÓPICA EXPRESO ID-­‐1 Para determinar si Id-1 representa un mediador clave de los efectos del CBD en células de cáncer de
mama altamente agresivos, de Id-1 se expresa constitutivamente en las células MDA-MB231. El
ectópico de Id-1 gen, que no está bajo el control del promotor endógeno, se introdujo en las células
utilizando el vector retroviral pLXSN. Como control, las células fueron infectadas con un vector
pLXSN vacío (-Id-1). Ectópico Id-1 de expresión aumento de la invasión en las células MDA-MB231 de
acuerdo con nuestros estudios anteriores. Sin embargo, la diferencia en la invasión entre las células
que expresa ectópica de Id-1, o el vector de control que carece de Id-1, no se reflejó porque los
datos se representa como invasividad relativa (con todas las células de control fijados en 100%). En
las células que expresan el vector de control, el tratamiento con CDB llevado a una reducción
significativa en la invasividad de las células. Western Blot confirmó la baja regulación de Id-1 de
expresión en esta población celular. Es importante destacar que, y en contraste con los resultados
en las células de control, CDB no inhibió la invasión de células o de Id-1 expresión en células MDAMB231 + Id-1 que expresan ectópica de Id-1.
DISCUSIÓN Anteriormente puso de manifiesto que la proteína hélice-loop-hélice Id-1, un inhibidor de los
factores básicos de transcripción hélice-loop-hélice, juega un papel crucial en la progresión del
cáncer de mama. Id-1 estimuló la proliferación, la migración y la invasión en las células de cáncer de
mama. Por otra parte, la orientación de Id-1 de expresión parcialmente en las células del cáncer de
mama reduce la invasión in vitro y metástasis del cáncer de mama en modelos animales preclínicos.
Basándose en estos datos, la hipótesis de que Id-1 podría ser un candidato prometedor para futuras
estrategias de terapia, y que la inhibición de Id-1 de expresión y / o actividad podría ser de beneficio
para los pacientes con cáncer de mama. Este enfoque puede ser muy eficaz y segura en pacientes
con cáncer de mama avanzado, dado (a) la relación entre los altos Id-1 los niveles de expresión y
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
comportamientos celulares de cáncer de mama agresivos, (b) reducción parcial de Id-1 actividad
puede lograr resultados significativos, y (c) Id-1 de expresión es baja en los tejidos adultos normales,
lo que elimina la toxicidad no deseados por lo general asociados con las modalidades terapéuticas
disponibles en la actualidad.
Proponemos que el uso de la CDB, como un inhibidor de Id-1, representa una nueva estrategia para
tratar el cáncer de mama. Una amplia gama de compuestos cannabinoides fueron probados y CDB,
un constituyente de cannabinoides no psicoactivos, era el inhibidor más potente de la agresividad
de células de cáncer de mama humano a través de Id-1 mRNA y proteína de baja regulación.
Agonistas de cannabinoides de trabajo a través de CB 1 y CB 2 receptores se han mostrado para
actuar como inhibidores tumorales en una variedad de modelos de cáncer. Presentar evidencia
también muestra que el cannabinoide CBD constituyente, que tiene afinidad insignificante para CB 1
y CB 2 receptores, también tiene actividad antitumoral. E l vías moleculares primarias involucradas
en la inhibición del CDB de la invasión y la metástasis aún no se han aclarado. En general, los valores
de CI 50, aun estando dentro del rango observado por otros laboratorios, fueron inferiores a los
reportados por Ligresti et al. Esta diferencia se debe probablemente al hecho de que hicimos los
experimentos en las concentraciones séricas más bajas, que se han mostrado para mejorar la
actividad antiproliferativa de los cannabinoides.
En este caso, nos informan de que el CDB actúa como un potente inhibidor de Id-1 puede inhibir
eficazmente genotípicas y fenotípicas cambios que permiten a los cánceres de mamas agresivas
para invadir y metastatizar. Lo más importante, la expresión ectópica de Id-1 en células de cáncer de
mama MDA-MB231 abolió los efectos del CDB sobre la invasión celular. Se infectaron las células con
un gen de Id-1 (vector pLXSN) que no está bajo el control de la endógena de Id-1 promotor.
CDB parece actuar por endógena de Id-1 la expresión génica abajo de la regulación en el nivel de
promotor, no como un resultado de ARNm y / o la desestabilización de la proteína. Por lo tanto, el
CDB no debe tener ningún efecto sobre la expresión de Id-1 a partir del vector pLXSN. De hecho, la
expresión ectópica de Id-1 en células de cáncer de mama MDA-MB231 fue capaz de suprimir los
efectos de la CDB.
Estos datos indican que Id-1 es un factor clave, cuya expresión debe ser regulada en el fin de
observar los efectos beneficiosos de la CDB sobre la reducción de la agresividad de células de
cáncer de mama. Con base en los resultados anteriores, se sugiere que la disminución de Id-1
proteína tras el tratamiento CDB podría en consecuencia conducir a una baja regulación de los
genes que promueven el crecimiento como Zfp289, así como a una baja regulación de los genes que
promueven la invasión, como la metaloproteinasas de matriz de tipo membrana (MT1-MMP).
Debido CDB inhibe de Id-1 expresión en células de cáncer de mama agresivo, una estrategia de
diseño racional de fármacos se podría utilizar para crear potencialmente análogos más potentes y
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
eficaces. Por otra parte, la reducción de Id-1 de expresión con cannabinoides también podría
proporcionar una estrategia terapéutica para el tratamiento de cánceres agresivos adicionales
porque de Id-1 de expresión se encontró que era hasta reguladas durante la progresión de casi
todos los tipos de tumores sólidos investigados.
REFERENCIAS Marcadores Braun S, Harbeck N. moleculares de la metástasis en el cáncer de mama: la
comprensión y las perspectivas para el diagnóstico y la prevención de la novela actual Expert Rev
Mol Med 2001; 3 :1-14..
Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H. El Número de Identificación de proteínas:
un regulador negativo de ADN hélice-bucle-hélice de unión a proteínas de la célula 1990; 61 :49-59..
Perk J, Iavarone A, familia Benezra R. Id de proteínas hélice-loop-hélice en el cáncer de Nat Rev
Cancer 2005;. 5 :603-14.
Fong S, Itahana Y, Sumida T, et al. . De Id-1 como un objetivo molecular en la terapia para la invasión
de células de cáncer de mama y metástasis Proc Natl Acad Sci EE.UU. 2003; 100 :13543-8.
Minn AJ, Gupta GP, Siegel PM, et al. Los genes que median la metástasis del cáncer de mama a
pulmón Naturaleza 2005;. 436 :518-24.
Pertwee RG. . Farmacología de los receptores cannabinoides CB1 y CB2 Pharmacol Ther 1997; 74
:129-80.
Bifulco M, Di Marzo V. Orientación del sistema endocannabinoide en la terapia del cáncer:. Un
llamado para una mayor investigación Nat Med 2002; 8: 547-50.
Guzmán M. Cannabinoides: agentes anticancerígenos potenciales de Nat Rev Cancer 2003; 3 :74555..
McPartland JM, Russo EB. El cannabis y extracto de cannabis:? Mayor que la suma de las partes J
cannabis Ther 2001; 1 :103-32.
Showalter VM, Compton DR, Martin BR, Abood ME. Evaluación de la unión en una línea celular
transfectada que expresa un receptor cannabinoide periférico (CB2):. Identificación de ligandos
selectivos del subtipo de receptores de cannabinoides J Pharmacol Exp Ther 1996; 278 :989-99.
Un Ligresti, Moriello AS, Starowicz K, et al. La actividad antitumoral de los cannabinoides planta con
énfasis en el efecto del cannabidiol en carcinoma de mama humano J Pharmacol Exp Ther 2006;.
318: 1375-87.
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
SD McAllister, Chan C, Taft RJ, et al. Los cannabinoides inhiben selectivamente la proliferación e
inducen la muerte de las células de glioblastoma multiforme humanas cultivadas J Neurooncol
2005;. 74 :31-40.
Lin CQ, Singh J, Murata K, et al. Un papel para Id-1 en el fenotipo y la hormona esteroide respuesta
agresiva de las células de cáncer de mama humano Cancer Res. 2000;. 60 :1332-40.
Thompson EW, Paik S, N Brunner, et al. Asociación de aumento de la invasividad de la membrana
basal con ausencia del receptor de estrógeno y la expresión de vimentina en líneas celulares de
cáncer de mama humanos J Cell Physiol 1992;.150 :534-44.
Fong S, Debs RJ, Desprez PY. . Id genes y proteínas como objetivos prometedores en el tratamiento
del cáncer Tendencias Mol Med 2004; 10 :387-92.
Desprez PY, Lin CQ, Thomasset N, Sympson CJ, Bissell MJ, Campisi J. Una nueva vía para la invasión
de células epiteliales mamarias inducidas por la proteína hélice-loop-hélice Id-1 Mol Cell Biol 1998;.
18 :4577-88.
Pagliaro L, Felding J, Audouze K, et al. Nuevas clases de inhibidores de proteína-proteína interacción
y las nuevas herramientas para su desarrollo Curr Opin Chem Biol 2004;. 8 :442-9.
Kogan NM, Rabinowitz R, Levi P, et al. . Síntesis y actividad antitumoral de los derivados quinonoide
de los cannabinoides J Med Chem 2004; 47: 3800-6.
Massi P, Vaccani A, S Ceruti, Colombo A, Abbracchio MP, efectos Parolaro D. antitumorales de
cannabidiol, un cannabinoide no psicoactivos, en líneas celulares de glioma humano J Pharmacol
Exp Ther 2004;. 308: 838-45.
McKallip RJ, Jia W, Schlomer J, Warren JW, Nagarkatti PS, Nagarkatti M. apoptosis inducida por el
cannabidiol en células de leucemia humana: a novel papel del cannabidiol en la regulación de
p22phox y expresión Nox4 Mol Pharmacol 2006;70 :897-908. .
Galve-Roperh I, Sánchez C, Cortés ML, del Pulgar TG, Izquierdo M, Guzmán acción antitumoral de los
cannabinoides M.: La participación de la acumulación de ceramida sostenido y activación de la
quinasa regulada por señal extracelular Nat Med 2000; 6: 313-9. .
Sánchez C, Galve-Roperh I, Canova C, Brachet P, Guzmán M. Δ9-tetrahidrocannabinol induce la
apoptosis en células de glioma C6 FEBS Lett 1998;. 436 :6-10.
Jacobsson SO, Rongard E, Stridh M, Tiger G, Fowler CJ. . Efectos suero dependiente del tamoxifeno y
los cannabinoides sobre la viabilidad de células de glioma C6 Biochem Pharmacol 2000; 60 :1807-13.
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org
Chandrasekaran R, McAllister SD, SD Patel, Moore DH, Abood ME. Esclerosis lateral amiotrófica:.
Retrasa la progresión de la enfermedad en ratones mediante el tratamiento con un cannabinoide
Amyotroph Lateral esclero Otros neurona motora Disorders, 2004; 5 :33-9.
Russo E, F. Grotenhermen cannabis y los cannabinoides: farmacología, toxicología y potencial
terapéutico. El Hawthorne Integrativa Healing Press; 2002.
Wade DT, Makela P, P Robson, Casa H, Bateman C. ¿Los extractos medicinales a base de cannabis
tienen efectos generales o específicos sobre los síntomas de la esclerosis múltiple? . Un estudio
doble ciego, aleatorizado, controlado con placebo en 160 pacientes Mult esclero 2004; 10 :434-41.
Ling MT, Wang X, Zhang X, Wong YC. Las múltiples funciones de Id-1 en la progresión del cáncer de
Diferenciación 2006;. 74 :481-7.
INFORMACIÓN
MCCRID: ARKMCCR-00151
PUBMED ID: 18025276
PMCID: N/A
Nombre Original: Cannabidiol as a novel inhibitor of Id-1 gene expression in aggressive breast
cancer
cells.
2015
Este documento es solo para fines educativos y uso no comercial. Más información en
www.medicalcannabiscostarica.org

Documentos relacionados