“Compra, instalación, puesta en marcha y capacitación en la

Comentarios

Transcripción

“Compra, instalación, puesta en marcha y capacitación en la
“Compra, instalación, puesta en marcha y capacitación en la adquisición de equipos de
laboratorio, patrones metrológicos y equipos de campo para el Ministerio Agropecuario y
Forestal(MAGFOR), el Ministerio de Salud (MINSA) y el Ministerio de Fomento, Industria y
Comercio (MIFIC)”
Ref.: EuropeAid/134420/D/SUP/NI
Aclaraciones Técnicas
1. Lote 1 – ítem 7: Dispensador de líquidos con válvula dispensadora y
agarradera
Para seleccionar el dosificador correcto se solicita más detalles sobre ¿cuáles reactivos
son los que se dosificará?
Respuesta:
El dispensador de líquido con válvula y agarradera, se requiere solamente para almacenar
y entregar agua destilada, no se dosificarán reactivos.
2. Lote 1 – ítem 11: Sistema de osmosis inversa y de agua ultra pura integrado
para la producción de agua tipo I
No está especificada la cantidad de producción de agua que necesitan. Favor aclarar la
cantidad de agua ultrapura que se necesita por día?
Respuesta:
 La cantidad de agua se describe en el segundo párrafo de las especificaciones del
Sistema de Osmosis Inversa y
 De agua ultra pura, se necesita que produzca 15 litros por hora.
3. Lote 5 – ítem 5: Sistema de Evaporación
En las especificaciones se menciona como accesorio 2 gradillas para tubos de 50 ml. El
TurboVap permite el procesamiento de hasta 50 tubos de máximo 30ml a mínimo 1.5ml
(incluyendo tubos de 15ml fondo cónico para centrifugas).
¿Será un error en su solicitud de gradillas para tubos de 50ml, queriendo referirse a
“gradillas para 50 tubos”? ¿Tal vez lo que requieren es 2 gradillas, cada una con capacidad
de 50 tubos de 15ml?
Respuesta:
Las gradillas serian una para 50 tubos de 30 ml y otra para 50 tubos de 15 ml.
4. Lote 5 – ítem 15: Baño digital de circulación de agua
La información en las especificaciones sobre los métodos a realizar con el equipo es
prácticamente nula.
¿Podrían indicar más información acerca de los métodos que necesitan realizar con este
equipo?
Respuesta:
Para ser utilizado en métodos de enriquecimiento de Salmonella que se usan 42 o a 43°C
y para cualquier otra temperatura que requieran los procedimientos por eso se solicita
que nosotros podamos programar la temperatura.
1
5. Lote 5 – ítem 22: Autoclave de sobremesa
Favor aclarar ¿si lo que están solicitando en este ítem es un Autoclave de sobremesa
CLASE B?
Respuesta:
Si es un Clase B.
6. Lote 5 – ítems 70 al 74: Sistema de Ultra purificación de agua para PCR y
Accesorios
Estos ítems corresponden a la marca Pall según el número de artículo dado en las
especificaciones, sin embargo, también corresponden al modelo Cascada, cuyos
productos están disponibles en Asia solamente.
¿Favor aclarar y confirmar la posibilidad de ofrecer algún modelo de equipo y accesorios
similares?
Asimismo, no está especificada la cantidad de producción de agua que necesitan. Favor
aclarar ¿la cantidad de agua ultrapura que se necesita por día?
Respuesta:
Si se aceptara modelo de equipo y accesorios similares siempre y cuando corresponda a
la capacidad de 15 a 20 litros por día (capacidad de agua ultrapura requerida por día).
7. Lote 5 – ítem 98: Balanza Toploading
Favor confirmar la Sensibilidad requerida, ya que aparece 001gr. ¿Sería 0,001g o 0,01g lo
correcto?
Respuesta:
En cuanto a la balanza Toploading, la especificación de la sensibilidad de la balanza, la
medida correcta es 0,001g.
8. En relación al lote 1, ítem # 11 ¿Cuál será el uso del agua tratada?
(farmacéutico, laboratorio, etc.), ¿Cuál es la taza de flujo de los sistemas? O ¿cuál
es el flujo deseado de agua ultra pura por día, ya que hace mención a 1000 litros de agua,
no se sabe si por día o semana?
Respuesta:
El uso del agua será para los laboratorios (calibración de pequeños volúmenes, preparar
hielo, y para preparar soluciones).
Velocidad de flujo del producto [l/h] (± 20% a 25°C): 15 litros por hora
9. Del lote # 1, en relación a los ítems 27, 29, 32, los quieren de acero o
cerámica?
Respuesta:
Los ítems 27, 29 32, se requieren de Acero inoxidable
10. Del lote #1, del ítem 36 y 37, requieren estuche de transporte?
Respuesta:
Si, se requieren estuches.
2
11. Del lote #2, ítem 4, de que militraje requieren las bolsas plásticas, dan una medida única
para diferentes capacidades, favor aclarar?
Respuesta:
Bolsas de cierre plásticas Resellables o abre fácil, las medidas serían:
1. 27 cm ancho x 27,6 cm largo (20,000 unidades)
2. 18 cm ancho x 20 cm de largo (10, 000 unidades)
3. 15,2 cm ancho x 22,9 cm de largo (50,000 unidades)
4. 10 cm ancho x 15,5 cm de largo (15,000)
12. Del lote #2, ítem 8 y 9, cual va a ser el uso de estos termos, de que material los
requieren?
Respuesta:
Para el traslado de las muestras de alimentos de los SILAIS, a los diferentes Municipios al
Nivel Central y debe de ser de material externo de polietileno con aislante poliuretano.
13. Del lote #2, ítem 10, los Gorros los requieren tipo malla?
Respuesta:
Si, de malla
14. Del lote #2, ítem 11-14, de que tipo tela los requieren, pueden ser de fabricación
nacional?
Respuesta:
Tela sincatex y pueden ser fabricación nacional
15. Del lote #2, ítem 17, el Maletín de que material lo requieren, con divisiones internas o
sin divisiones, el cierre como lo requieren?
Respuesta:
De nylon resistente en el exterior. Compartimentos interiores y exteriores para mejor
organización. Seguridad con compartimento acolchado interior. Correa acolchada para
hombro.
16. Del lote #2, ítem 19, a que se refieren con sistema óptico en el foco/linterna?
Respuesta:
Es un foco/linterna corriente para inspeccionar.
17. Del lote #2, ítem 21, De que material requieren los capotes, pueden ser de fabricación
nacional.
Respuesta:
Material de nitrilo, puede ser nacional o importados.
18. Del lote #2, ítem 22 y 25, en relación a las botas que están solicitan tallas americanas y
centro americanas, se va a ofertar a como esta en el PBC.
Respuesta:
Nuestra talla es americana o América =Brasil.
19. Del lote #2, ítem 26, podrían dar mayor detalles de cada uno de los ítems?
Respuesta:
3
Son navajas en donde vienen insertos todos estos instrumentos necesarios para gente
que labora en el campo y mataderos.
20. Del lote #2, ítem 29, cual es el largo de la sonda de alveolo?
Respuesta:
O muestreador compuesto para granos oscilan entre las medidas de 1 a 2 m
21. Del lote #2, ítem 31, no hacen mención a la adquisición de filtros para las mascaras Full
face?
Respuesta:
En muchos casos las máscaras traen integrados los filtros, es necesario que vengan con
sus filtros.
22. Del lote #2, ítem 32, requieren filtros extras para las medias mascaras, porque la vida útil
de los filtros anda por 8-12 horas de uso?
Respuesta:
Si se necesitan filtros.
23. Artículo: 1.9 Purga química y aditamentos para sonda de temperatura y humedad.
 Set de protección para HMP155 (funda de polímetro, o-ring, etc): se refiere al filtro de
protección del sensor o a algún modelo de Radiation shield (DTR13, DTR05 o
STEVENSON SCREEN)?
Respuesta:
El set de protección se refiere al filtro de protección del Sensor

Set de calibración modelo HMK15 con Juego de sales con certificado de calibración:
o Que tipo de sales se precisan: para verificar el 11% de humedad relativa LICL,
para verificar el 33% de humedad relativa MGCL2, para verificar il 75% de
humedad relativa NACL, para verificar il 97% de humedad relativa K2SO4, o
todos?
Respuesta:
Todos
o
Cuantos contenedores para prueba se precisan, 2 o 3?
Respuesta:
Tres (3) contenedores
o
Se requiere el agua ionizada?
Respuesta:
No se requiere agua ionizada.
o
El termometro ha de ser a mercurio o capilar?
Respuesta:
El termómetro debe ser digital
o
Se requiere también el bolso de transporte?
4
Respuesta:
Si, se requiere el bolso de transporte
24. Item 3.6 : Favor de aclarar si se trata de una instalación para un solo piso o si es para más
pisos de un edificio.
Favor aclarar si existe posibilidad de alojar una unidad externa para cada Split.
Respuesta:
1. Se aclara que se trata de una instalación para un solo piso.
2. Si existe, porque debería haber siempre esa unidad externa.
Se modifica la especificación del refrigerante Ecológico R410a por Refrigerante R22
25. Item 5.47: Campana extractora de gases y solventes: se requiere llave de suministro de
agua, favor aclarar si se requiere también un lavabo.
Respuesta:
La Campana extractora de gases y solventes el laboratorio de FQ no la requiere con ese
suministro de agua, ni tampoco el lavabo.
26. En las especificaciones técnicas de diversos artículos, se encuentra una referencia a una
determinada marca o modelo (por ejemplo, lote 5 item 48 Modelo 8890A-70 / lote 5
item 64 Eppendorf 5424). Quisiéramos saber si se acepta productos equivalentes o
superiores.
Respuesta:
1. Lote 5 ítems 48 Modelo 8890A-70: Si se aceptan productos equivalentes, siempre y
cuando se cumpla con las especificaciones solicitadas.
2. Se modifican las especificaciones del Lote 5 Ítem 64,
Donde se lee:
 Eppendorf 5424
 15,000 rpm,
 Dimensiones: 12 5/8” L x 9 ¼ W x 8 1/8H (32 x 23.6 x 22.7 cm)
 Peso neto: 29 ½ libras
 Capacidad: 48 ml. 120 V 60 Hrz.
 Rotor para 24 tubos incluido
 Requerimiento eléctrico 110V/60Hz
Deberá leerse de la siguiente manera:




15,000 rpm,
Rotor para 24 tubos incluido
Tubos de 1,5 ml a 2 ml para PCR
Requerimiento eléctrico 110V/60Hz
27. Lote No.1 Equipo para Laboratorio de Metrología LANAMET
Al objeto de asegurar la compatibilidad de los equipos a suministrar objeto de la
presente licitación con las facilidades disponibles actualmente en el Laboratorio de
5
Metrología (LANAMET), les agradeceremos nos confirmen si para la gestión de las
calibraciones, LANAMET dispone en la actualidad de algún software de control y
calibración y, en caso afirmativo, que nos indiquen si dicho software es el MET/CAL.
Respuesta:
En el caso del Software MET/CAL para gestiones de las calibraciones, en LANAMET no
se dispone.
Se solicita software para varios ítem del Lote 1;
1. Puente termométrico de Alta exactitud,
2. El baño líquido de alta estabilidad,
10. el lector digital de parámetros ambientales,
12. calibrador de presión patrón digital,
17. Comparador de masa de 1 kg, 23. Equipo de calibración para sonda de humedad
monitoreado y controlado por higrómetro primario con tecnología de espejo frío y
sensor de temperatura,
34. Patrón para la calibración de equipos de ensayos a tensión,
35. Patrón para la calibración de equipos de ensayos a compresión, como podrá observar
son varios los equipos a los que se les solicitan Software, según los técnicos cada uno se
corresponde para las funciones del equipos solicitado.
28. Solicitamos aclarar para el lote No. 2, ítem No.26 el ANEXO II+III:
ESPECIFICACIONES TÉCNICAS + OFERTA TÉCNICA página No.48 la descripción
corresponde a Navajas de acero inoxidables cantidad 100 (cien) adjunta a continuación,
ya que las especificaciones que se solicitan para este ítem no nos son lo suficientemente
claras en cuanto a los siguientes puntos:
No.Arto. 26 Navajas de acero inoxidable (100)

¿La cantidad solicitada corresponde solamente a la descripción del ítem No. 26.
Navajas de acero inoxidable o a cada uno de sus agregados?, por ejemplo:
1. Hoja grande, solicitan cantidad 100 unidades
2. Hoja pequeña, solicitan cantidad 100 unidades
3. Sacacorchos, solicitan cantidad 100 unidades
4. Abrelatas, solicitan cantidad 100 unidades
5. Destornillador, pequeño solicitan cantidad 100 unidades
6. Destapador, solicitan cantidad 100 unidades
7. Destornillador, solicitan cantidad 100 unidades
8. Desaislador pelacables, solicitan cantidad 100 unidades
Etc……

Requerimos una descripción más detallada de cada uno de los agregados para este
ítem correspondientes a los puntos No.1 al 31, y la definición de las cantidades si
son 100 unidades de cada una o 100 en total para así poder cotizarles un producto
de acuerdo a sus necesidades.
Respuesta:
Son en total 100 unidades y cada navaja lleva inserto estas especificaciones.
29. Aclararnos si para las gabachas del ítem No.12 del Lote No.2 se requiere algún tipo
específico de tela y cuántas bolsas llevarán las gabachas.
6
Respuesta:
Tela sincatex, con dos bolsas en la parte de abajo
30. Aclararnos si los Maletines tipo bolso ítem No.17 del Lote No.2 son de tela o de cuero.
Respuesta:
De nylon resistente en el exterior. Compartimentos interiores y exteriores para mejor
organización. Seguridad con compartimento acolchado interior. Correa acolchada para
hombro.
31. Aclararnos a que corresponden las 31 descripciones que aparecen después de la cantidad
de las navajas de acero inoxidable ítem No.26 del Lote No.2
Respuesta: Ver respuesta técnica No. 28.
32. Pregunta 1. Lote No.1 Item 9. ¿Se solicita únicamente los accesorios o una sonda
HMP155 completa con purga química más los accesorios?
Respuesta:
Se solicita únicamente la purga química; sin embargo si la purga requiere accesorios se
deberán incluir.
33. Pregunta 2. Lote No.1 En el ítem 10. Los 4 lectores digitales son iguales (es decir los 4
tienen 2 sondas de HR y Tempertura) o 3 de ellos tienen 1 sonda de HR y temperatura y
uno de ellos tienen 2 sondas? No lo vemos claro en la especificación
Respuesta:
Son cuatro (4) instrumentos para lectura de condiciones ambientales con iguales
características, por lo tanto, cada uno de los cuatro (4) debe traer su sensor de
temperatura, su sensor de humedad relativa y su sensor de presión barométrica de tal
forma que permita la toma de datos de las tres magnitudes mencionadas anteriormente
al mismo tiempo.
34. Pregunta 3. Lote No.1 Item 18. En la descripción del producto se encuentran descritos
dos tipos de polipastos, cuando el equipo únicamente puede llevar uno, en este caso,
¿cuál de los dos modelos de polipasto se debe ofertar: el polipasto DKUN 1-125 K V1
1/1 F4 o el polipasto DCS-pro 2-160 1/1?
Respuesta:
El polipasto solamente es uno y deben ofertar aquel que cumpla con las especificaciones
solicitadas.
35. Pregunta 4. Lote No.1 Item 4: el ítem solicitado corresponde al fabricante del propio
Baño: Fluke (HART Scientific). Siendo este fabricante de origen norteamericano, por lo
que no cumple los criterios de origen especificados en las condiciones de esta licitación.
Para este ítem, ¿se haría una excepción y se aceptaría como país de origen EEUU? ¿Hay
algún ítem adicional en el que exista salvedad para la regla de origen?
Respuesta:
Este ítem ha sido eliminado
7
36. Pregunta 5.¿Es Suiza un país de origen válido?
Respuesta:
Suiza no es un país elegible
37. Pregunta 6. Lote No.1 Item 12: ¿Se solicita un controlador de presión que regule la
presión en determinados puntos o además, un sistema de generación de presión (tipo
compresor y bomba de vacío) que aporte la presión a controlar?
Respuesta:
Para que funcione el patrón de presión se requiere que sea equipado con generador y
controlador de la presión en todo el rango solicitado, el controlador sea capaz regular
variaciones de volumen por cada rotación de 0,7 cm3 (0.04 cu.in.)
38. Pregunta 7.Lote No.1 Item 17. En el caso de que no exista ningún producto que cumpla
completamente o esté muy cerca de cumplir con las especificaciones requeridas y que
tenga como origen un Estado miembro de la Unión Europa o de un país incluido en
DCI/ILA ¿se aceptarán productos que cumplan con la especificación requerida cuyo
origen no cumpla este requisito de origen (Unión Europea o DCI/ILA)?
Respuesta:
No, no se aceptarán productos de un país no elegible; por tanto se realizaron las
siguientes modificaciones a las especificaciones técnicas de este Item:
Dónde se leía:
Características del Sistema
Capacidad máxima: 1100 g
División de escala: 0,01 mg
Repetibilidad: 0,02 mg
Tiempo de estabilización (típico): 10…20 s
Deriva de sensibilidad: ± 1,5 ppm / °C
Desviación por carga excéntrica: 0,0 µg
Permite ajuste interno y externo
Incluye pesa para ajuste externo E2-OIML con certificado de calibración (valor nominal
de acuerdo a requerimiento del comparador)
Software adicional con licencia para adquisición de datos en tiempo real por medio de
PC. Interface Lector-PC por conexión USB. Trabajo en ambiente Windows 7 permite
descarga de datos hoja cálculo Excel
Error! Reference source not found. para la (s) pesas con trazabilidad a las unidades
básicas del SI
Equipo instalado y probado en LANAMET por técnicos autorizados por el fabricante.
Equipos de prueba son suministrados por el proveedor
Deberá leerse de la siguiente manera:
Características del Sistema
Capacidad máxima: 1110 g
División de escala: 0,01 mg
Repetibilidad: 0,03 mg
8
Tiempo de estabilización (típico): 10…20 s
Desviación por excentricidad: 15 µg/mm
Permite ajuste interno y externo
Protector contra corrientes de aire motorizado
Incluye pesa para ajuste externo E2-OIML con certificado de calibración (valor nominal
de acuerdo a requerimiento del comparador)
Software adicional con licencia para adquisición de datos en tiempo real por medio de
PC. Interface Lector-PC por conexión USB. Trabajo en ambiente Windows 7 permite
descarga de datos hoja cálculo Excel
Error! Reference source not found. para la (s) pesas con trazabilidad a las unidades
básicas del SI
Equipo instalado y probado en LANAMET por técnicos autorizados por el fabricante.
Equipos de prueba son suministrados por proveedor.
39. Pregunta 8. En caso de respuesta negativa a la pregunta 7, ¿se aceptará un equipo que
tenga el plato de pesaje de manera estándar, es decir, no suspendido y que si que cumpla
el criterio de origen?
Respuesta:
Se eliminó el requerimiento de Plato de pesaje suspendido (colgante) para eliminar error
por cargas excéntricas. Ver Respuesta No.38.
40. Lote No.2 Item 17 Maletín tipo Bolso: Favor dar más especificaciones del tipo de maletín
que necesitan como por ejemplo. Material o propósito de mismo.
Respuesta:
De nylon resistente en el exterior. Compartimentos interiores y exteriores para mejor
organización. Seguridad con compartimento acolchado interior. Correa acolchada para
hombro.
41. Lote No.2 Item 18 Lupa con pinzas: Favor indicar magnificación de la lupa, dimensiones
de las pinzas o uso que se le dará a este producto.
Respuesta: Este es para ver cualquier materia extraña que se encuentre en el alimento
y etiqueta que tenga letra pequeña ilegible.
42. Lote No.2 Item 19 Foco/Lienterna: Favor indicar que quieren decir con sistema óptico.
Dar más especificaciones de este producto.
Respuesta:
Ver Respuesta No.16.
43. Lote No.2 Item 24 Dosificadores de BM: Favor indicar si necesitan solamente el
dosificador o lo necesitan completo con el tanque. De no necesitar el tanque favor
indicar las especiaciones del tanque que usan para saber qué tipo de dosificado es
apropiado para acoplarse a este tanque.
Respuesta:
Tal y como se indica en las especificaciones técnicas se requiere tanque y protector de
acero inoxidable.
9
44. Lote No.3 Item 1 Refrigeradores: Favor confirmar que necesitan que se refrigerador con
freezer porque indican sistema de descongelación automática. Favor indicar el rango de
temperatura que no fue especificado y si requieren refrigeradoras comerciales o
especiales para laboratorio.
Respuesta:
Son refrigeradoras no frost que se descongele automáticamente y no son especiales, son
para el reguardo de los alimentos que se reciben.
45. Lote No.3 Item 2 Congeladores: Favor indicar el rango de temperatura del congelador
por ejemplo -25°C. 40°C, -86°C. Especificar si requieren un congelador horizontal o
vertical.
Respuesta:
Congeladores verticales
El rango de temperatura (- 40 a -20) °C.
46. Lote No.3 Item 6 Split: Favor especificar que quieren decir cuando indican control
remoto compatible con el computador.
Respuesta:
Que contenga control remoto
47. Lote No.3 Item 9: Congeladores vertical: Favor indicar el rango de temperatura del
congelador por ejemplo -25°C. 40 °C, -86°C.
Respuesta:
El rango de temperatura (- 40 a -20) °C.
48. Lote No.4 Item 4: Plato caliente. Favor indicar rango de temperatura y velocidad de
agitación que necesitan.
Respuesta:
El rango de temperatura debe ser como mínimo 300 °C, con agitación de al menos 1200
rpm
49. Lote No.4 Item 5: Sistema de Evaporación Turbo VAP LV: Estimados este equipo no
viene con gradilla para tubos de 50ml, favor indicar si se aceptara solo la gradilla para
tubo de fondo cónico de 15ml o añadirán otro. Las siguientes opciones:
 10 x 75 mm tubos de hasta 4 mL
 12 x 75 mm tubos de hasta 4 mL
 13 x 100 mm tubos de hasta 7 mL
 16 x 100 mm tubos de hatsa 12 mL
 16 x 125 mm tubos de hasta 16 mL
 20 x 150 mm tubos de hasta 30 mL
 10 mL fondo cónico tubos de hasta 10 mL
 15 mL fondo cónico tubos de hasta 15 mL
 15 mL volumétrico Auto Trace tubos de hasta 15 mL
 1.5 – 2.0 micro centrífuga tubos 1.5 – 2.0 mL
 12 x 32 mm tubo de automuestreador de hasta 15 mL
10
Respuesta:
Las gradillas serian una para 50 tubos de 30 ml y otra para 50 tubos de 15 ml.
50. Lote No.4 Item 6: Gabinete de seguridad Biológica Clase II: Favor definir ancho de la
campana requieren 3 ó 5. El precio de duplica entre una de 3 y una de 5 pies.
Respuesta:
Gabinete de seguridad Biológica Clase II, el ancho efectivamente es de 5 pies
51. Lote No.4 Item 26: Diluidor Gravimétrico: Para este equipo la precisión menor es de
0.05g no de 0.005 favor confirmar que fue un error de digitación.
Respuesta:
Si no existe precisión de 0,005 se aceptaría menor de 0,05g
52. Lote No.4 Item 30 al Item 45 cepas: Estos cepas son consideradas como una arma
biológica potencial debido a que son cepas puras de microorganismos patógenos por lo
cual para poder ofertarlos se debe llenar el formulario adjunto. Cabe destacar que todos
los proveedores de estas cepas requieren un compromiso del cliente final en el cual se
llena el documento anexo responsabilizando del buen uso y manejo de estas cepas.
Respuesta:
Es importante aclarar que las cepas que se requieren presentan las especificaciones
técnicas requeridas y que se ha ejemplificado dando números de referencia de ATCC y
NCTC para ayudar en la búsqueda de las mismas, las cepas equivalentes a las
especificaciones técnicas solicitadas pueden ser de colecciones de Europa o Asia.
Los oferentes tendrán que buscar las cepas con las especificaciones descritas en cada
ítem.
El formulario será llenado una vez se adjudique.
53. Lote No.4 Item 49: Evaporador con corriente de Nitrógeno N-EVAP: favor confirmar si
desean todas las características opcionales descritas en el Item y no desean el generador
de nitrógeno.
Respuesta:
Si se desean todas las características opcionales, lo que deseamos es un evaporador con
corriente de nitrógeno, no un generador de nitrógeno.
54. Lote No.4 Item 55: Sistema Térmico ISO: Podría indicar a qué fabricante corresponden
las especificaciones descritas o el número de catálogo o referencia del mismo.
Respuesta:
El equipo deberá cumplir con las especificaciones técnicas descritas en el pliego.
55. Lote No.4 Item 59: Calentador de aluminio, incubador de tubos: Favor indicar el tipo de
tubos que trabajará para poder cotizarle modulo apropiado. Indicar de cuantos bloques
necesita el calentador.
 Opciones disponibles:
11
Micro tubos: 35 x 0.4 ml; 24 x 0.5 ml; 24 x 1.5 ml.
Tubos: 35 x 6 mm; 20 x 10 mm; 20 x 13 mm; 12 x 16 mm; 6 x 20 mm; 6 x 25 mm
Láminas: 5 on slant; 8 horizontales
Cubetas: 15 x 1 cm cuvettes
Crisoles: 2 x 30 ml crisoles de niquel
Tubos tipo Dolphin: 24 x 1.5 ml
Micro tubos: 1 x 96 pocillos 0.2 ml
Micro placas: 1 x 96 pocillos
Respuesta:
El tipo de tubo es 0,5ml; 1,5ml; 2ml para PCR. El calentador necesita 10 diferentes
termobloques intercambiables
56. Lote No.4 Item 60: Destilador de agua: Favor tomar en cuenta que los destiladores por
el requerimiento de su resistencia de calentamiento son de 220 Voltios no de 110 V.
favor aceptar destiladores con ese requerimiento eléctrico.
Respuesta:
No hay ningún problema con el requerimiento eléctrico, puede ser de 220 voltios
57. Lote No.4 Item 61: Micro centrífuga: Favor el tamaño de tubo que requieren que tenga el
rotor.
Respuesta:
El tamaño del tubo que se utiliza es de 1,5 ml a 2 ml para PCR.
58. Lote No.4 Item 64: Centrífuga de 24 plazas con rotor: Favor confirmar que trabajaran
con tubos de 2ml para el rotor de 24 tubos.
Respuesta:
Se trabajan con tubos plásticos de 2 ml para PCR.
59. Lote No.4 Item 67: Afilador automático de cuchillas para micrótomo: Favor indicar la
marca de cuchillas que poseen actualmente porque el moelo de afilador está en
dependencia del modelo de cuchillas. Favor especificar si son tipo Shandon o tipo
Spener.
Respuesta:
Las cuchillas que se requieren son de talle alto.
60. Lote No.4 Item 69: Baño maría para flotación de tejidos: favor indicar si aceptan un baño
que en vez de ser circular sea rectangular dimensión externa 32 x 32 cm.
Respuesta:
El baño maría si puede ser rectangular o circular.
61. Lote No.4 Item 81: congelador vertical ultra-baja temperatura: favor aceptar
congeladores con temperatura hasta -86°C. Favor especificar el volumen del congelador.
Respuesta:
12
Se aceptara congelador con rango de temperatura de (-86 a -50) °C, el volumen del
congelador puede ser de (500 a 800) L.
62. Lote No.4 Item 82: Sistema de bomba de vacío: Favor indicar con qué sustancias
trabajará la bomba. Requieren que sea resistente a químicos o libre de aceite. Favor
indicar el desplazamiento de aire que requieren CFM (L/min).
Respuesta:
Bomba de vacío resistente a químicos con un desplazamiento de aire de (0,31 a 112)
CFM (0, 53 – 190) m3/h.
63. Lote No.4 Item 83: Horno de calor seco: Favor indicar la capacidad de la cámara en pies
cúbicos o litros. Favor confirmar el rango de temperatura no sea de 50 a 240°C- Favor
aceptar un honro con dimensiones aproximadas externas de 64.0 x 82.0 x 56.5 cm.
Respuesta:
La capacidad de la cámara puede ser entre 50 a 60 litros, el rango de temperatura puede
ser de 50 °C a 225 °C o de 50°C a 150 °C, se puede aceptar un horno con las
dimensiones externas mencionadas.
64. Lote No.4 Item 93: Termómetro: favor especificar si lo que necesita es un termómetro
con punta de acero inoxidable o un Hidrómetro a como hace referencia 608-h1.
Respuesta:
Lo que se requiere es un dispositivo para medir temperatura y humedad relativa.
65. Lote No.4 Item 96: electrodo combinado de ph: favor indicar marca y modelo del ph al
que se va acoplar este electrodo al igual del tipo de conector que utiliza BNC, DIN, ETC.
Respuesta:
Este electrodo es para el Kit de pH- metro con Certificado de Trazabilidad, descrito en
el ítem 29 del lote 5.
LOTE 6
66. Lote No.6 Item 1: Estación de trabajo compacta para PCR: Favor indicar ancho de la
estación que necesitan. Favor aceptar también que la parte frontal sea plástica resistente
a UV.
Respuesta:
Dimensión de la estación: Profundidad de 27 a 29 pulgadas, ancho de 23 a 28 pulgadas,
alto de 36 a 39 pulgadas. En caso de que la parte frontal no sea de cristal se aceptara
material plástico resistente a UV.
67. Deseamos ver si es posible cambiar las especificaciones de los siguientes equipos, todos
del lote 6: Item 1 y 8: solicitamos se acepte equipo de rotor en vez de placas y con
calentamiento por aire en vez de peltier, pues estos son equipos inclusive con mejor
precios y desempeño que los equipos de placas y no requieren calibraciones costosas
para el usuario. Asimismo, para la cámara CCD también se acepte método de captura
por fotomultiplicador que da mejor resolución que la CCD, Item 3, La pantalla a color
13
puede ser táctil o no, este detalle no interfiere con el correcto desempeño y
funcionamiento del equipo.
Respuesta:
El ítem 1 del lote 6, no tiene relación con lo solicitado.
Los ítem 2 y 8 que son los relacionados a lo solicitado: No se aceptara equipo de rotor.
Ítem 3: La pantalla debe ser táctil
68. Quisiéramos que nos aclaren si el entrenamiento indicado de dos semanas para todos los
ítems de lote 6 es de dos semanas por equipo o de dos semanas para todo el lote. O si
más bien va en función de lo requerido de acuerdo a fábrica para cada entrenamiento de
cada equipo en particular.
Respuesta:
Tal como se especifica en el punto No.11 de las Instrucciones a los Licitadores para el
LOTE No.6 únicamente se solicita formación básica para uso y manejo de los items
2, 8, 9, 10 y 11.
69. Lote 1 Item 11: Sistema de Osmosis inversa y de agua ultra pura integrado para la
producción de agua Tipo I.
En el pliego de licitación se pide cuanto sigue:
 Se debe proveer cartuchos de repuesto para cumplir todos los requisitos tanto
de entrado como de salida del agua. Set de cartuchos de repuesto para
garantizar la producción de 1000 litros de agua.
Para poder ofrecer lo requerido necesitaríamos saber cuál es la calidad de agua presente
en el laboratorio y con la cual será alimentado el sistema de agua ultra pura.
Podrían indicarnos por favor sus características físico-químicas? Concentración de iones,
calcio, magnesio, partículas en suspensión, etc.
O en caso contrario indicar un número de cartuchas definido.
Respuestas:
Características Fisicoquímicas:
Sólidos Suspendidos: (0 a 1000) mg / L
Conductividad (400 a 1000) ms/cm
Calcio (menor a 150) mg / L
Magnesio (menor a 50) mg/ L
70. Lote 6 Item 1: Estación de trabajo compacta para PCR.Por favor indíquenos las
dimensiones de la cabina PCR y las dimensiones del plano de trabajo necesarias.
Respuesta:
Dimensión de la estación: Profundidad de 27 a 29 pulgadas, ancho de 23 a 28 pulgadas,
alto de 36 a 39 pulgadas.
71. Lote 6 Item 10 Cámara digital Registro geles
Podrían por favor detallar la aplicación específica de este equipo e indicar si será
necesario ser conectado a otro equipo, si es así por favor indíquennos marca y modelo y
las características necesarias para su conexión.
Respuesta:
Esta cámara es para tomar fotos a geles de electroforesis y va montada en un cono
oscuro (HOOD) de 5,5 cm de diámetro, se utilizan filtros para bromuro de etidio.
14
No se necesita conectarse a otro equipo, la cámara se monta en el cono oscuro.
72. Lote 6 Item 12 Reactivos biología molecular (Puesta en marcha biología molecular).
Nos pueden indicar las cantidades requeridas. Además, favor de especificar sobre la
secuencia (parte de la cadena) de DNA que se debería identificar.
Respuesta:
La secuencia de ADN que se requiere es la siguiente:
Reactivo
Presentación
Tampón de extracción(Kit Extracción
ADN, Qiagen DNeasy Plan Mini kit)
Buffer 10X
dNTPs mM
MgCl2
Cebadores=
HLBas
f:
TCGAGCGCGTATGCAATACG
Cebadores=
HLB
r:
GCGTTATCCCGTAGAAAAAGGTAG
TaqMan MGBProbe 4316034 56FAMAGACGGGTGAGTAACGC/G3NFQ
TaqMan Universal PCR Mix
Agua bidestilada estéril
250 xrns
Cantidad
/2000muestras
4
Kit de reacciones 1000U
Kit # R0192
50mM
10,000pmol
1
160g.
5ml
156 µl
10,000pmol
156156 µl
6,000pmoles
2
Taq DNA polimerasa
PVP10K
Mix
27 ml
Libre
de
Nucleasas 3 frascos
(grado
biología
molecular)
Kit
4
Polyvinylpyrrolidone
1,28g
73. Lote 1 – ítem 17: Balanza comparador de masa hasta 1 kg con dispositivo
pesada bajo la balanza
Este ítem está especificado con base en los modelos de una marca en particular cuyo
origen no es elegible según las pautas de la Unión Europea, por lo cual solicitamos hacer
la corrección para que los requerimientos sean abiertos, equitativos y transparentes a
favor de los oferentes nacionales e internacionales.
Favor confirmar la posibilidad de ofrecer comparadores de masa que permiten ajustar
patrones de masa y peso de acuerdo con las recomendaciones de la OIML (R-111) para
la clase E1 e inferior. De igual forma se solicita ampliar el criterio incluyendo los
comparadores de masas que comprenden dos componentes: Uno de ellos con módulo
electrónico, y el otro el sistema de medición mecánica precisa. Y todos los elementos de
la cámara de pesada fabricados a partir de vidrio o de metal que minimizan la influencia
de cargas electrostáticas en el resultado de pesaje.
Finalmente, favor aclarar cuál es el propósito de la especificación de “dispositivo de
pesada bajo la balanza”? (en vista de que pertenece a las características del fabricante
cuyo origen no es elegible) Y confirmar la posibilidad de ofrecer comparadores que se
utilizan para garantizar la trazabilidad de las mediciones de masa y la verificación de los
pesos de acuerdo con la metrología legal, sin que sea necesario un dispositivo de pesada
bajo la balanza.
15
Respuesta:
Ver respuesta de la pregunta No.38
74. Lote 2 – ítems 1 y 2: Guantes de látex tallas “L” y “M”
Favor aclarar si se requieren 30 mil guantes talla “L” y 10 mil guantes talla “M” en cajas o
paquetes de 100 pares, o si se trata de 30 mil cajas/paquetes de guantes talla “L” y 10 mil
cajas/paquetes de guantes talla “M”??
Respuesta:
Se mantienen las especificaciones tal como se describen:
Ítem 1: 30,000 (treinta mil) pares de guantes, en paquetes o cajas de 100 pares, talla "L",
Ítem 2: 10,000 (diez mil) pares de guantes, en paquetes o cajas de 100 pares, talla "M" ,
75. Lote 2 – ítem 4: Bolsas plásticas con cierre Zip lock
Favor aclarar el tamaño de las siguientes bolsas (¿ancho, espesor, longitud?):
 Bolsas de 5 libras (20.000 unidades), tamaño?
 Bolsas de 3 libras (15.000 unidades), tamaño?
 Bolsas de 2 libras (10.000 unidades), tamaño?
Respuesta:
Bolsas de cierre plásticas Resellables o abre fácil, las medidas serían::
1. 27 cm ancho x 27,6 cm largo (20,000 unidades)
2. 18 cm ancho x 20 cm de largo (10, 000 unidades)
3. 15,2 cm ancho x 22,9 cm de largo (50,000 unidades)
4. 10 cm ancho x 15,5 cm de largo (15,000)
76. Lote 2 – ítem 7: Máscaras quirúrgicas rectangulares
Favor aclarar si ¿se requieren 5 mil máscaras en total en cajas o paquetes de 50 unidades,
o si se trata de 5 mil cajas/paquetes de 50 unidades de máscaras cada caja/paquete?
Respuesta:
Se mantienen las especificaciones tal como se describen en el Anexo II + III
(Especificaciones técnicas).
Lote 2 ítem 7: 5,000 (cinco mil) mascaras en total, en cajas o paquetes de 50 unidades
77. Lote 2 – ítem 21: Capotes de dos piezas
En el cuadro de ítems de las IAL la descripción de este ítem dice Talla M-L-XL, mientras
que en las especificaciones técnicas propiamente sólo se indica Talla única.
Favor aclarar si efectivamente son 260 capotes Talla única (para adultos) o si debe
desglosarse esa cantidad en tallas M, L y XL?? Si es lo segundo, cuál sería la cantidad por
cada talla?
Respuesta:
Se mantienen las especificaciones tal como se describen en el Anexo II + III
(Especificaciones técnicas).
16
Son 260 capotes, talla única.
78. Lote 2 – ítem 22: Botas con punta de hierro
En las especificaciones propiamente se mencionan 2 tipos distintos de tallas:
- Unas son talla 8, talla 7, talla 9
- Otras deben ser talla 40 y talla 42
En vista de que los tipos de tallas difieren según el país o región de origen, es decir son
distintos en Europa (por ejemplo Reino Unido), Asia (por ejemplo China) e incluso
América (por ejemplo Brasil)
Favor aclarar que se podrán entregar los tamaños equivalentes a las medidas según el
tipo de talla que se utiliza en el país del fabricante??
Respuesta:
Nuestra talla es americana o América =Brasil
79. Lote 2 – ítems 3, 31 y 32: Lentes protectores, Máscaras full face y Medias
máscaras antigás, respectivamente
Las especificaciones técnicas de estos ítems corresponden, e incluso en uno de ellos
mencionan la marca 3M, que según tenemos entendido son hechas en EEUU, lo cual va
en contra de lo aceptado por la Unión Europea en sus bases de licitación.
Favor aclarar que se pueden ofertar productos similares con origen permitido.
Respuesta:
Se pueden ofertar productos similares con origen permitido. Y se elimina la marca 3M
para los filtros, pero si se necesitan con filtro.
80. Lote 2 – ítem 32: Medias máscaras antigás
Las especificaciones técnicas literalmente dicen:
“Medias máscaras antigás, gases, vapores y químicos con sus filtros 3M 6000 serie del
respirador 100 (cien)”.
Favor aclarar a qué se refiere con “100 (cien)” al final de esas especificaciones? Es la serie
del ítem en referencia o se requiere entregar 100 filtros??
Respuesta: Hacer caso omiso al 100, son setenta y cuatro máscaras antigás y deben
llevar su par de filtros las que se requieren.
81. Lote 4 – ítem 7: Lector microplacas ELISA
Favor aclarar si 6 segundos es el tiempo total de medición y referido a qué formato de
placa??
17
Además, qué se entiende por "homogeneizador"…. si se hace referencia a la capacidad
de agitar?
Respuesta:
Si la lectura debe ser en 6 segundos (tiempo total), el formato de placa es 96 pozos, es
correcto homogenizador es la capacidad de mezclar.
82. Lote 5 – ítems 6 y 7: Cabina de seguridad tipo 2 y Base Cabina de seguridad
tipo 2
Favor aclarar si estos dos ítems corresponden uno al otro, es decir, ¿si la base solicitada
como ítem 7 es para usarla con la cabina solicitada como ítem 6?
O si ¿pueden ser ofertados como independientes uno del otro, es decir, hasta de distinta
marca?
Respuesta:
Lo que necesitamos es que la base sirva para colocar la cabina es decir que tenga las
especificaciones solicitadas, efectivamente es para colocar el ítem 6.
83. Lote 5 – ítems 33, 34, 35, 41, 42 y 43: Cepas de Referencia Internacional
Estas especies especificadas conforme a la ATCC y NCTC (Norteamericanas) no pueden
ser iguales en otras colecciones de origen elegible (por ejemplo la NCCB de Holanda).
Favor indicar los números de referencia que son aceptables para ustedes de las
colecciones de los organismos europeos como la NCCB, la ECCO, BCCM, CCAP, CIP,
DSMZ o incluso alguna de Asia.
Asimismo, favor aclarar qué tipo de empaquetado se requiere… ¿cualitativo o
cuantitativo?
Respuesta:
Es importante aclarar que las cepas que se requieren presentan las especificaciones
técnicas requeridas y que se ha ejemplificado dando números de referencia de ATCC y
NCTC para ayudar en la búsqueda de las mismas, las cepas equivalentes a las
especificaciones técnicas solicitadas pueden ser de colecciones de Europa o Asia.
Los oferentes tendrán que buscar las cepas con las especificaciones descritas en cada
ítem.
El etiquetado puede ser cualitativo o cuantitativo, y la presentación puede ser en pastillas
o ampollas.
84. Lote 5 – ítem 94: Cribas
Favor aclarar cómo es la distribución del total de 30 unidades solicitada en relación con
la cantidad de cribas de cada set, según los tipos de granos especificados.
Es decir, favor aclarar cuántos sets deben entregarse para cada tipo de grano
especificado.
Respuesta:
18
10 Cribas de Maíz, 10 cribas de sorgo y 10 de arroz, con las especificaciones descritas en
el pliego (Anexo II+III Especificaciones técnicas).
85. Lote 6 – ítem 12: Reactivos puesta en marcha Biología Molecular
Tal como lo indica la especificación, estos reactivos son para el diagnóstico de
huanglongbing por PCR en tiempo real, sin embargo, la información disponible
públicamente sobre este ensayo indica que se realiza usando instrumentos desarrollados
por ABI (Applied Biosystems – Invitrogen) y por Cepheid, ambas de origen EEUU, lo cual
impide ofertar el juego completo de reactivos tal como se ha especificado.
Favor corregir las especificaciones para poder ofertar reactivos de un fabricante de
origen elegible.
Respuesta:
Favor remitirse a la respuesta técnica No.72
86. Lote 1 – ítem 7: Dispensador de líquidos con válvula dispensadora y
agarradera
Para seleccionar el dosificador correcto se solicita más detalles sobre ¿cuáles reactivos
son los que se dosificará?
Respuesta:
El dispensador de líquido con válvula y agarradera, se requiere solamente para almacenar
y entregar agua destilada, no se dosificarán reactivos
87. Lote 1 – ítem 11: Sistema de osmosis inversa y de agua ultra pura integrado
para la producción de agua tipo I
No está especificada la cantidad de producción de agua que necesitan. Favor aclarar la
cantidad de agua ultrapura que se necesita por día?
Respuesta:
La cantidad de agua se especifica en el segundo párrafo de las especificaciones del Sistema
de Osmosis Inversa y de agua ultra pura, se necesita que produzca 15 litros por hora.
88. Lote 5 – ítem 5: Sistema de Evaporación
En las especificaciones se menciona como accesorio 2 gradillas para tubos de 50 ml. El
TurboVap permite el procesamiento de hasta 50 tubos de máximo 30ml a mínimo 1.5ml
(incluyendo tubos de 15ml fondo cónico para centrifugas).
¿Será un error en su solicitud de gradillas para tubos de 50ml, queriendo referirse a
“gradillas para 50 tubos”? ¿Tal vez lo que requieren es 2 gradillas, cada una con capacidad
de 50 tubos de 15ml?
Respuesta:
Las gradillas serian una para 50 tubos de 30 ml y otra para 50 tubos de 15 ml.
89. Lote 5 – ítem 15: Baño digital de circulación de agua
19
La información en las especificaciones sobre los métodos a realizar con el equipo es
prácticamente nula.
¿Podrían indicar más información acerca de los métodos que necesitan realizar con este
equipo?
Respuesta:
Para ser utilizado en métodos de enriquecimiento de Salmonella que se usan 42 o a 43°C
y para cualquier otra temperatura que requieran los procedimientos por eso se solicita
que nosotros lo podamos programar la temperatura.
90. Lote 5 – ítem 22: Autoclave de sobremesa
Favor aclarar ¿si lo que están solicitando en este ítem es un Autoclave de sobremesa
CLASE B?
Respuesta:
Si es un autoclave de sobremesa clase B.
91. Lote 5 – ítems 70 al 74: Sistema de Ultra purificación de agua para PCR y
Accesorios
Estos ítems corresponden a la marca Pall según el número de artículo dado en las
especificaciones, sin embargo, también corresponden al modelo Cascada, cuyos
productos están disponibles en Asia solamente.
¿Favor aclarar y confirmar la posibilidad de ofrecer algún modelo de equipo y accesorios
similares?
Asimismo, no está especificada la cantidad de producción de agua que necesitan. Favor
aclarar ¿la cantidad de agua ultrapura que se necesita por día?
Respuesta:
Si se aceptara modelo de equipo y accesorios similares siempre y cuando corresponde a
la capacidad de 15 a 20 litros por día.
92. Lote 5 – ítem 98: Balanza Toploading
Favor confirmar la Sensibilidad requerida, ya que aparece 001gr. ¿Sería 0,001g o 0,01g lo
correcto?
Respuesta:
En cuanto a la balanza Toploading, la especificación de la sensibilidad de la balanza, la
medida correcta es 0,001g.
93. Lote 6 artículo 8: a) De la descripción del equipo no queda claro si se precisa que
tenga 96 pozos o 384. Favor aclarar si se requiere uno de los dos o ambos.
b) Favor de aclarar si se precisa también ejecutar la HRM (High Resolution Melting).
Respuesta:
Se requiere el de 384 pozos y si se precisa ejecutar HRM (High Resolution Melting).
20
94. Lote 6 artículo 11: Precisamos saber cuál es el uso detallado que se pretende hacer del
equipo. Precisan de solo un extractor? Cuantas muestras por día se deben analizar?
Respuesta:
Si se precisa de un solo extractor y se analizaran como mínimo 32 muestras simultaneas
95. Se modifican las especificaciones técnicas del Lote I, Item 2 de la siguiente forma:
Donde se leía:
-
BAÑO
LÍQUIDO
DE
CALIBRACIÓN
DE
ALTA
ESTABILIDAD
TERMOSTÁTICAMENTE CONTROLADO CON SET POINT DIGITAL
Cantidad: 1 (uno)
Características del Sistema
Rango de trabajo: -10 ºC a 110 ºC
Estabilidad máxima: ± 0,8 mK @ 0 ºC y ±3 mK @ 100 ºC (demostrada por certificado
con resultados medidos para el baño)
Uniformidad: < ± 4 mK @ 100 ºC (demostrada por certificado con resultados
medidos para el baño)
Resolución del Set Point: 0,002 ºC
Calentadores: 500 W y 1000 W
Zona mínima de trabajo (Profundidad): 457 mm
Zona mínima de trabajo (diámetro): 100 mm
Volumen: 42 L
Fuente de entrada (power supply): 230 VAC (±10 %), 60 Hz, 9 A. Cumple
originalmente a toma corriente según normativa nicaragüense.
Accesorios para calibración de termómetros con adaptador de nivel del líquido y
carrusel para calibración de hasta 10 termómetros líquido en vidrio.
Equipo para mantener/fijar celdas de puntos fijos
Adaptador de nivel de líquido
carrusel para montaje y protección de termómetros (mínimo 5 Termómetros)
sistema monocular de aumento 8X
Adaptador de nivel de fluido para calibración de termómetros líquido en vidrio
Comunicación: RS-232, USB e IR
Garantía mínima: 1 año
Instalación en laboratorio de termometría de LANAMET y entrenamiento para uso
Software e interfase baño-computadora para controlar automáticamente el baño. La
conexión a PC debe realizarse por puerto USB
Incluye, líquido necesario para trabajar a temperaturas entre -10 a 30 °C según
volumen necesario.
Con aditamentos para calibración de termómetros y mantenimiento de celdas de
punto triple del agua marca Fluke modelos 5901A-9-1053 (alto: 450 mm, diámetro: 50
mm) y 5901B-G (alto: 180 mm, diámetro: 30 mm) existente en LANAMET
El equipo debe ser instalado y probado en LANAMET por técnicos debidamente
autorizados por el fabricante. Los equipos de prueba son suministrados por proveedor
Deberá leerse de la siguiente forma:
BAÑO
LÍQUIDO
DE
CALIBRACIÓN
DE
ALTA
ESTABILIDAD
TERMOSTÁTICAMENTE CONTROLADO CON SET POINT DIGITAL
Cantidad: 1 (uno)
Características del Sistema
21
-
-
Rango de trabajo: -30 ºC a 40 ºC
Estabilidad máxima: ± 0,6 mK @ 40 ºC (demostrada por certificado con resultados
medidos para el baño)
Uniformidad: ± 0,2 mK @ 40 ºC (demostrada por certificado con resultados
medidos para el baño)
Resolución del Set Point: ≤ 0,01 ºC
Calentadores: 1000 W
Zona mínima de trabajo (Profundidad): 530 mm
Zona mínima de trabajo (diámetro): 100 mm
Volumen: > 7 L
Fuente de entrada (power supply) aproximada: 230 VAC (±10 %), 60 Hz, 9 A.
Cumple originalmente (de fabrica) a toma corriente según normativa nicaragüense.
Bloque igualador de bronce con cuatro agujeros de 8 mm de diámetro por 160
mm de profundidad para colocar sensores de temperatura
Accesorios para aumentar el nivel del líquido y la profundidad de calibración de
termómetros (incluso TLV de tallo largo)
Carrusel rotativo para montaje y protección de aproximados 10 termómetros
líquido en vidrio y un termómetro patrón en el centro.
Equipo para mantener/fijar celdas de puntos fijos
carrusel (mínimo 5 Termómetros
sistema monocular de aumento 8X
Garantía mínima: 1 año
Software e interfase baño-computadora para controlar automáticamente el baño.
La conexión a PC debe realizarse por puerto USB (o RS232 con adaptador USB
preparado con controladores para windows 7 y más reciente)
Incluye, líquido necesario para trabajar a temperaturas entre -30 a 40 °C según
volumen necesario (dos veces el volumen a utilizar)
El equipo debe ser instalado y probado en LANAMET por técnicos debidamente
autorizados por el fabricante. Los equipos de prueba son suministrados por
proveedor
96. Se elimina el Item No.5 Bloque igualador para horno Fluke, modelo 9260
97. Se elimina el Item No.6- Bloque igualador para horno Fluke, modelo 9260
Aclaraciones Administrativas:
1. Conforme a lo previsto en el Artículo 13 de las Instrucciones a los Licitadores de la
Licitación de Referencia, atentamente les solicitamos las siguientes aclaraciones:
Participación y Origen:
1.1 En el Artículo 3 “Participación” y en el Artículo 4 “Origen” de las Instrucciones para
los Licitadores, se establece que los participantes y todos los suministros y materiales
deberán ser originarios de un Estado miembro de la Unión Europea o de uno de los
países o territorios que entran dentro del ámbito de aplicación de los instrumentos
específicos del Programa DCI/ALA con el cual se financia el contrato, o sean
autorizados por dichos instrumentos jurídicos.
Consultado al respecto el Reglamento (CE) No.1905/2006 del Parlamento Europeo y
del Consejo, de 18 de diciembre de 2006, por el que se establece un Instrumento de
Financiación de la Cooperación al Desarrollo, y lo dispuesto en su Artículo 31
22
respecto a los requisitos de elegibilidad, así como el Anexo A2b Elegibilidad en los
programas 2007-2013 de la Guía Práctica de los procedimientos contractuales para
las acciones exteriores de la Unión Europea, no nos queda claro si los países
miembros del Comité de Ayuda al Desarrollo (CAD) de la OCDE son elegibles a
tales efectos, en virtud ser aplicable el acceso recíproco u otro mecanismo
contemplado por el programa.
La consulta viene motivada porque en algunos de los lotes, entre los bienes
solicitados se han identificado características técnicas y/o referencias de productos
que corresponden a equipos específicos de marcas como FLUKE (que se fabrica en
Estados Unidos de América), MITUTOYO (origen Japón), SERAPHIN (origen
Estados Unidos), METTLER (origen Suiza), BIO-RAD (origen Estados Unidos de
América) o THERMO (espectofotómetro Nanodrop 2000, origen Estados Unidos de
América).
En consecuencia, solicitamos confirmación si los productos originarios de países tales
como Estados Unidos de América, Japón y/o Suiza son elegibles a efectos de origen.
Respuesta:
Estados Unidos de América, Japón y Suiza no son países de origen elegible en este
proceso.
1.2 En el supuesto de que la respuesta a la consulta anterior fuera negativa y atento a lo
indicado en el documento “Instrucciones a los licitadores” en su apartado 1.2 que
señala que “Los suministros deben conformarse enteramente a las Especificaciones
Técnicas del expediente de licitación (anexo técnico) y ajustarse en todos los aspectos a los
planos, cantidades, modelos, muestras, medidas y demás instrucciones”, solicitamos se
revisen las especificaciones técnicas requeridas y, en su caso, se modifiquen aquéllas
que correspondan a productos cuyos países de fabricación no satisfagan la regla de
origen.
Respuesta:
Se han realizado los ajustes correspondientes a través de las aclaraciones técnicas
contenidas en este documento.
1.3 En el supuesto de que fuere necesario publicar nuevas especificaciones técnicas por
lo indicado en los puntos anteriores, y con sujeción al alcance de los cambios y a la
fecha en la que estos fueren comunicados a los oferentes, solicitamos se considere la
posibilidad de un aplazamiento en la fecha de presentación de propuestas, a fin de
permitir a los oferentes la adecuación de su oferta a los eventuales cambios.
Respuesta:
El segundo corrigendum otorgará un plazo adicional para preparar las ofertas y
realizar consultas que se consideren necesarias.
2. Pregunta 5. ¿Es Suiza un país de origen válido?
Respuesta: No, Suiza no es un país de origen aceptable en este proceso.
3. Dudas en relación a la parte de la documentación:

Servicio de post-venta: En la descripción genérica de los servicios a suministrar
descrita en las Instrucciones a los licitadores se lee “la entrega, la descarga, la instalación,
la puesta en servicio, el servicio posventa”. Sin embargo, en las condiciones
23
particulares de contrato o no se requiere el servicio o se hace referencia solamente a
la formación en el utilizo de algunos equipos. Favor confirmar que no se requiere
servicio de post-venta (solo formación para algunos equipos).
Respuesta:
El único servicio requerido después de la entrega, instalación y puesta en servicio de
los equipos es la inducción básica para el uso de los equipos, así como la formación
solicitada.

Requerimientos necesarios que debe tener el lugar donde se deben instalar
los equipos: en las Instrucciones a los licitadores Parte 1 Oferta técnica se hace referencia
exclusivamente a los equipos “mencionados en el párrafo anterior” (o sea los que
precisan de la formación). Sin embargo, en la Parte 3 Documentación, se requiere un
detalle de los requerimientos necesarios para la instalación de cada uno de los
equipos ofertados. Favor de aclarar para que equipos hay que detallar los
requerimientos en objeto.
Respuesta:
Lo que se solicita son los requerimientos básicos necesarios para la instalación de
todos los equipos descritos en su oferta.

Favor de aclarar si la exención de impuestos se aplica a todos los licitadores, tanto
nicaragüenses como extranjeros.
Respuesta:
Si, la exención de impuestos se aplica a todos.

En el modelo de desglose presupuestario, al final de la ficha se encuentran las piezas de
recambio y consumibles, que no figuran en los documentos de licitación. Favor de
aclarar si se requieren o no.
Respuesta:
Se requiere lo descrito en el formato: “B.II + B III c4f_annexiitechspeciiitechoffer_es especificaciones técnicas.doc” publicado dentro del pliego de licitación.
4. Por este medio, deseo solicitar aclaración al proceso de adquisición arriba indicado en
relación a los siguientes puntos:
En la clausula 10.1 de las Condiciones Particulares del lote #1 y 2, indica que todos los
bienes deben ser originarios de los Estados Miembros de la Unión Europea, en relación a
esta clausula, se observa sin embargo que solicitan bienes de marcas especificas que no
corresponden a un país miembro de la unión europea. Podría mencionar los países
incluidos en los programas DCI o ICD del cual menciona esta clausula.
Respuesta:
a. Las personas físicas que sean nacionales de uno de los siguientes países y las personas
jurídicas allí establecidas:
uno
de
los
Estados
miembros
de
la
Unión
Europea:
Alemania, Austria, Bélgica, Bulgaria, Chipre, Dinamarca, Eslovaquia, Eslovenia, España, Est
onia, Finlandia, Francia, Grecia , Hungría, Irlanda, Italia,Letonia, Lituania, Luxemburgo, Mal
ta, Países Bajos, Polonia, Portugal, Reino Unido, República Checa, Rumania, Suecia.
- de uno de los Estados candidatos reconocidos oficialmente por la Unión Europea :
Antigua República Yugoslava de Macedonia, Croacia, Turquía, Islandia, Montenegro.
24
- de uno de los Estados
Islandia, Liechtenstein, Noruega.
miembros
del
Espacio
Económico
Europeo:
b. Los programas geográficos : Las personas físicas que sean nacionales de los siguientes
países y las personas jurídicas allí establecidas :
América Latina: Argentina, Bolivia, Brasil, Chile, Colombia, Costa Rica, Cuba, Ecuador, El
Salvador, Guatemala, Honduras, México, Nicaragua, Panamá, Paraguay, Perú, Uruguay,
Venezuela.
Asia: Afganistán, Bangladesh, Bhután, Camboya, China, India, Indonesia, República Popular
Democrática de Corea, Laos, Malasia, Maldivas, Mongolia, Myanmar/Birmania, Nepal,
Pakistán, Filipinas, Sri Lanka, Tailandia, Vietnam. Asia Central: Kazajstán, República
Kirguistán, Tayikistán, Turkmenistán, Uzbekistán. Oriente Próximo: Irán, Irak, Omán,
Arabia Saudí, Yemen, Sudáfrica.
d. Las personas físicas que sean nacionales de cualesquiera de los países para los que se
haya establecido el acceso recíproco relativo a su ayuda exterior, así como a las personas
jurídicas establecidas en ellos. En este caso el único país es Australia
f. Organizaciones internacionales :
(a) las organizaciones de Derecho internacional público creadas por acuerdos
intergubernamentales y las agencias especializadas creadas por aquéllas;
(b) el Comité Internacional de la Cruz Roja (CICR);
(c) la Federación internacional de las Organizaciones nacionales de la Cruz Roja y de la
Media Luna Roja;
(d) el Banco Europeo de Inversiones y el Fondo Europeo de Inversiones.
5. En la clausula 26.3 inciso b), de las Condiciones Particulares del lote #1, se habla de un
saldo del 60% a partir de la recepción provisional de los bienes, en cuantos días se haría
efectiva la cancelación, se tiene previsto dar un anticipo del 40%, también dice que no
solicitaran una garantía de anticipo?
Respuesta:
Según el artículo 26.3 de las condiciones generales del expediente de licitación, el pago
final se hará 60 días después de la recepción provisional y la entrega de la factura
correspondiente. En cuanto a la garantía de prefinanciación no se solicitará en los lotes 1,
2, 3, 4 y 5; para el lote 6 sí solicitará garantía de prefinanciación.
6. En la clausula 13, de las Condiciones Particulares del lote #1, el calendario solicitado es
solo para el oferente adjudicado o hay que incluirlo como parte de la oferta.
Respuesta:
Si, es solo para el oferente adjudicado.
7. En relación a la Instrucciones para los Licitadores, el oferente tiene que adjuntar el
cuadro que hace mención a los puntos de entrega, firmado y sellado por el oferente?
Respuesta:
No, el cuadro es de referencia para la entrega de cada uno de los lotes e ítems.
8. Por este medio se les remite nuestra solicitud formal por escrito debido a que
requerimos varias aclaraciones en los Documentos de Licitación, para lo cual
25
procedemos conforme a lo dispuesto en la Cláusula 13 de las Instrucciones a los
Licitadores. El detalle de nuestras consultas es el siguiente:
En la Cláusula 26.3 (Principios generales de pago) de las Condiciones Especiales del
Contrato para cada lote se indica:
26.3 Para obtener los pagos, el Contratista debe remitir al Órgano citado en el párrafo
26.1:
Como excepción al artículo 26.5 de las Condiciones Generales, no se exigirá una garantía
de prefinanciación.
b) Para el saldo del 60 %, la(s) factura(s) por triplicado a partir de la recepción
provisional de los suministros.
Previa exención, el pago final al Contratista de los importes debidos se efectuará en un
plazo no superior a noventa días tras la recepción por el Órgano de Contratación de una
factura y de la solicitud del certificado de recepción provisional.
Por lo tanto, favor aclarar:
8.1 La primera línea donde dice “Para obtener los pagos, el Contratista debe remitir al
Órgano citado en el párrafo 26.1”, ¿si esto se refiere al 40% de prefinanciación
máxima?
Respuesta: Si, el máximo de prefinanciación es el 40%.
8.2 Favor confirmar que “Como excepción al artículo 26.5 de las Condiciones Generales,
no se exigirá una garantía de prefinanciación” para obtener ese pago inicial del
40% (máximo).
Respuesta: No se exigirá garantía de prefinanciación en los lotes n° 1, 2, 3, 4 y 5.
8.3 Favor confirmar si dicha excepción al artículo 26.5 aplica para cualquier monto de
garantía o que al menos no se solicitará la garantía de prefinanciación si el monto de
cada lote está por debajo de EUR 300,000.00?
Respuesta: Sí el 40% del monto de prefinanciación es superior a 300,000 EUR el
Órgano de Contratación solicitará la Garantía de Prefinanciación.
8.4 ¿Cuáles son los documentos que entonces habría que remitir para el pago inicial del
40%?
Respuesta: Las pruebas documentales que se les solicitará en la carta de
adjudicación y la garantía de prefinanciación en los casos que el 40% del monto a
prefinanciar sea superior a 300,000 EUR.
A diferencia de la cláusula 26.3 de las Condiciones Especiales, la cláusula 26.3 de la
CONDICIONES GENERALES indica que… “El pago del saldo final se efectuará en
un plazo de 60 días….”.
8.5 Favor confirmar ¿dentro de cuántos días se hará el pago del saldo (restante) del 60%?
Respuesta: De acuerdo a lo establecido en el Proyecto de contrato, en el numeral
3.2 “En caso de ambigüedad o divergencia entre los documentos mencionados, sus
26
disposiciones se aplicarán según el orden de prioridad citado.”, en este caso, se
aplicará lo establecido en las condiciones particulares, es decir, 90 días.
9. Lote 1 – ítem 17: Balanza comparador de masa hasta 1 kg con dispositivo
pesada bajo la balanza
Este ítem está especificado con base en los modelos de una marca en particular cuyo
origen no es elegible según las pautas de la Unión Europea, por lo cual solicitamos hacer
la corrección para que los requerimientos sean abiertos, equitativos y transparentes a
favor de los oferentes nacionales e internacionales.
Respuesta: Se han modificado las especificaciones técnicas de este item.
remitirse a las aclaraciones técnicas No.38.
Favor
10. Lote 6 – ítem 12: Reactivos puesta en marcha Biología Molecular
Tal como lo indica la especificación, estos reactivos son para el diagnóstico de
huanglongbing por PCR en tiempo real, sin embargo, la información disponible
públicamente sobre este ensayo indica que se realiza usando instrumentos desarrollados
por ABI (Applied Biosystems – Invitrogen) y por Cepheid, ambas de origen EEUU, lo cual
impide ofertar el juego completo de reactivos tal como se ha especificado.
Favor corregir las especificaciones para poder ofertar reactivos de un fabricante de
origen elegible.
Respuesta: Se han modificado las especificaciones técnicas de este item.
remitirse a las aclaraciones técnicas No. 72.
Favor
11. Estamos muy interesados en participar en la licitación Asistencia Técnica para
implementar y certificar sistemas de gestión en los sectores productivos (calidad,
inocuidad, ambiente, entre otros) y en Organismos Evaluadores de la Conformidad
(OEC) para su acreditación, sin embargo vemos que uno de los criterios de selección
indica lo siguiente:
3) Capacidad técnica del candidato [basada en los apartados 5 y 6 del formulario de
solicitud]
Criterios para personas jurídicas y físicas:
(1) El candidato ha trabajado satisfactoriamente durante los años 2010, 2011 y 2012, en
al menos 3 proyectos con un presupuesto como mínimo igual al de este
contrato en ámbitos relacionados con el mismo.
dado que el presupuesto máximo es de 1, 030,000 euros, y que las referencias como
mínimo entendemos deben ser por este monto, queremos solicitarles reconsiderar el
monto mínimo de referencias de proyectos similares ejecutados y la antigüedad de los
proyectos, ya que proyectos de este tipo por el monto indicado son muy difíciles de
identificar usualmente son por montos mucho menores. Este planteamiento es
considerando que nosotros somos una corporación con presencia en muchos países con
una trayectoria desde el año 1981 realizando servicios de consultoría en gestión de toda
índole, proyectos de calidad, ambientales, salud ocupacional, laboratorios y muchos más,
muchos de los cuales son de cifras importantes pero no llegan a la cifra solicitada.
27
Dado lo anterior y apelando al espíritu de que mientras más empresas con la competencia
técnica participen, más opciones Ustedes tendrán para escoger al mejor, es que apelamos a que
reconsideren los siguientes aspectos:


Aceptar como referencias válidas proyectos de al menos 100,000 USD.
Ampliar el plazo de antigüedad de consultorías similares al menos para los últimos
10 años.
Como les comentaba nosotros hemos realizado muchos trabajos con montos mayores o
menores al que solicitamos, en ámbito público y privado con resultados muy positivos y
de valor agregado en donde nuestras cartas de referencias podrán constatarlo de Ustedes
requerirlas. Sabemos cómo desarrollar proyectos de amplio alcance como el suyo, y
tener los perfiles adecuados para ello. Sabemos que contamos con la capacidad técnica
para desarrollarles un excelente proyecto y que Ustedes queden plenamente satisfechos,
solemos esforzarnos mucho por alcanzar altos niveles de desempeño, y queremos
participar, pero este requisito planteado (monto de referencias) no nos permitiría y por
ello apelamos a su juicio para su reconsideración.
Respuesta:
El anuncio de licitación establece en el criterio 3 el siguiente cumplimiento:
3. La capacidad técnica del licitador basado en los puntos 5 y 6 del formulario de
presentación de una oferta para un contrato de suministros.
 El licitador ha trabajado satisfactoriamente en al menos dos (2) proyectos con un
presupuesto como mínimo de €. 500,000 (quinientos mil euros) para el lote 1; €.
100,000 (cien mil euros) para el lote 2; €. 250,000 (doscientos cincuenta mil euros)
para el lote 3; €. 400,000 (cuatrocientos mil euros) para el lote 4; €. 350,000
(trescientos cincuenta mil euros) para el lote 5 y €. 200,000 (doscientos mil euros)
para el lote 6, en ámbitos relacionados con cada uno de los lotes para el cual
participa y que fueron ejecutados en cualquier momento durante el siguiente período:
2010 – 2012.
Al respecto, las condiciones se mantienen tal y como están publicadas.
12. Solicitamos se pueda ampliar el tiempo de entrega de los bienes en 30 días adicionales.
Respuesta: las condiciones se mantienen tal y como están establecidas.
13. Favor confirmarnos que los precios de la oferta deberá ser precio DDP, en el que el
oferente realiza todas las gestiones aduanales hasta la entrega de los bienes en condición
DDP con excepción de los trámites de exoneración de todo tipo de impuesto que nos
entregaría de acuerdo a lo indicado pág. 16 de 23 inciso 12.
Respuesta: confirmado, la entrega es en DDP, en cuanto a la exoneración de
impuestos, el ofertante realizará los trámites, con la documentación que el Órgano de
Contratación le debe de facilitar para exonerar de los impuestos correspondientes, para
todos los bienes.
14. El oferente indicara en los formatos de precios los valores DDP que está ofertando, al
ser DDP el oferente solicitará la exoneración de impuesto incluido el IVA, favor aclarar
cómo será este procedimiento con el MIFIC.
28
Respuesta: Los precios incluidos en el formato deben ser sin impuestos, en cuanto al
procedimiento está aclarado en la respuesta anterior.
15. Es posible que acepten ofertas en las que nos puedan faltar ítem en alguno de los lotes.
Respuesta: No, se deben ofertar todos los ítems de cada lote al que se presente.
16. Solicitamos se acepte la presentación de una solo garantía del licitador por la suma de los
lotes a presentar, en la cual se indicará los montos de cada lote y el total global de la
garantía.
Respuesta: se debe presentar una garantía por cada lote, tal y como está estipulado en
el expediente de licitación, ya que los lotes se deben presentar por separado.
17. Entendemos que en este tipo de proceso no se deben de incluir ninguna documentación
legal, administrativa, financiera del oferente, puesto que esta es requerida posteriormente
al oferente adjudicado en caso de requerirse, favor confirmar si esto es lo correcto o en
su defecto indicarnos que documento requieren con la presentación de oferta.
Respuesta: las instrucciones de lo que debe de presentar se encuentran dentro del
expediente de licitación.
18. La oferta puede ser para uno o todos los lotes y el tipo de contrato es de precios
unitarios, la consulta es: que si existe la posibilidad de que esta licitación sea adjudicada
por ítem? O confirmar se adjudicará por lote conforme entendemos en el documento de
licitación.
Respuesta: la licitación se adjudicará por lote y deberá incluir todos los ítems, las
ofertas que no incluyan todos los ítems de los lotes serán desestimadas.
19. Qué pasaría si en algunos de los lotes se nos presenten casos en los que el producto este
descontinuado y se tiene que ofertar el modelo actual, entendemos que esto debe ser
aceptado favor confirmar.
Respuesta: los equipos presentados deberán cumplir con las especificaciones requeridas
o deberán mejorar a estas, como mínimo debe cumplir con lo requerido.
******
29

Documentos relacionados