descargar documento
Transcripción
descargar documento
Cultivo in-vitro vegetal Desarrollo aséptico de protoplastos, células , tejidos u órganos vegetales en un medio de cultivo , tan definido como sea posible y que se mantenga bajo condiciones ambientales controladas . Pasos para iniciar un cultivo in vitro 1- elección del explanto 2-Acondicionamiento y esterilización 3-Implantación en el medio de cultivo 4-Incubación Explanto Inóculo Trozo de material vegetado de una planta madre a ser cultivado ó Célula, tejido u órgano vegetal usado para iniciar un cultivo in-vitro Material vegetal a subcultivar que ya está en cultivo in-vitro Explanto •La elección del explanto depende del propósito del cultivo. Por ejemplo las yemas axilares y los meristemas son apropiados para micropogación. Explantos • Partes de órganos – Hojas – Tallos – Raíces – vástagos – Yemas axilares – Semillas – Hypocótilos • Tipos celulares específicos – Polen – Endosperma Elección del explanto • Fácil de esterilizar • Juvenil • Que responda al cultivo •Las partes aéreas son mas limpias que las subterráneas •Cuanto más pequeño sea el explanto más posibilidades de evitar problemas fitopatológicos (virus, microplasmas, bacterias), pero disminuye su posibilidad de desarrollo •Los tejidos internos suelen estar menos contaminados que los más externos •Explantos similares puede reaccionar de forma diferente por influyen: •Su localización en la planta madre •Su condición de juvenilidad Juvenilidad Frecuentemente asociada a buena habilidad para enraizar y/o ausencia de floración La iniciación de cultivos a partir de explantos no juveniles es problemática Dónde se localizan los tejidos juveniles? Juvenil es diferente de jóven Jóven se refiere a la edad, es el opuesto de viejo. Juvenil es el opuesto de adulto, Puede estar referido a: •Al período de desarrollo del vegetal en el cual el órgano se inició (las yemas latentes en la base de un tallo se iniciaron en los seedling) •La proximidad al sistema radicular Polaridad Un explanto en cultivo puede presentar polaridad en cuanto a la proliferación celular y /o a la morfogénesis Esto puede estar relacionado con su posición y/o orientación en la planta madre o con su orientación dentro del recipiente de cultivo Example of polarity: Shoot initiation happens only at one side of the leaf of Saintpaulia asepsis Evitar contaminación utilizando métodos de esterilización axénico Libre de asociación con otros organismos vivos Matar o inhibir microorganismos o sus esporas con calor, filtros, químicos u otros sistemas esterilización Los cultivos de tejidos son técnicas asépticas Esterilización • Bacteria and fungi will overgrow the explant on the medium unless they are removed • Pre-treatments to clean up the explant • Detergents • Sterilants and Antibiotics Pre-treatments • Transfer plants to a greenhouse to reduce endemic contaminants • Force outgrowth of axillary buds • Washing removes endemic surface contaminants Surface sterilization of plant material Base protocol 1. Wash explants in a mild detergent before treatment with the disinfecting solution. (Herbaceous material may not require this step). 2. Rinse explants thoroughly under running tap water for 10-30 minutes. 3. Submerge explants into the disinfectant solution. Seal bottle and gently agitate. 4. Under sterile conditions, decant the solution and rinse explants several times with sterile distilled water. Surface sterilization of plant material COMMONLY USED DISINFECTANTS FOR PLANT TISSUE CULTURE Disinfectant Concentration (%) Exposure (min) Calcium hypochlorite 9-10 5-30 Sodium hypochlorite* 0.5-5 5-30 Hydrogen peroxide 3-12 5-15 Ethyl alcohol 70-95 0.1-5.0 Silver nitrate 1 5-30 Mercuric chloride 0.1-1.0 2-10 Benzalkonium chloride 0.01-0.1 5-20 *Commercial bleach contains about 5% sodium hypochlorite, and thus may be used at a concentration of 10-20%, which is equivalent to 0.5-1.0% sodium hypochlorite. Sterilization procedures may be enhanced by: 1. Placing the material in a 70% ethyl alcohol solution prior to treatment with another disinfectant solution. The use of a two-step (two-source) sterilization procedure has proven beneficial with certain species. 2. Using a wetting agent, such as Tween 20 or 80 can be added to the disinfectants to reduce surface tension and allow better surface contact. 3. Conducting the sterilization process under vacuum. This results in the removal of air bubbles and provides a more efficient sterilization process. Surface sterilization of plant material An elaborated example of surface sterilization •Cut the plant material to an appropriate size to fit the container which will be used during the sterilsation procedure •Rinse plant material under running tap water •Shake for a few seconds in alcohol •HgCl2 (0.1 - 1%) + Teepol 2 drops/100ml: 3-5 min •Rinse in autoclaved distilled water •Commercial bleach 7-15% + Teepol 2 drops/100ml: 10-30 min Operations in the Sterile Cabinet: 1. Tie back your hair, roll your sleeves up and remove your watch and other jewellery. Wash your hands thoroughly with the disinfectant solution suitable for skin application. If allergic to any disinfectant wash your hands with water and wear a pair of surgical gloves. 2. Sterilize the inside of the cabinet by spraying with 70% alcohol and wiping dry with sterile tissue. 3. Collect and organize all the items you will need close to or inside the cabinet. 4. Working in the cabinet, take a sterilized piece of biomass with a pair of forceps (do not touch the plant material with your hands). Also sterilize your instruments by dipping them in alcohol between each manipulation and flaming them. El tamaño óptimo de un explanto es del orden de 0,5 a 1cm2. El medio de cultivo en relación a las características del explanto ü When you make an explant like an axillary bud, you remove it from the sources of many chemicals and have to re-supply these to the explants to allow them to grow. Shoot tip - Auxins and Gibberellins Leaves sugars, GAs Roots - water, vitamins mineral salts and cytokinins Azúcar: La concentración de sacarosa depende fundamentalmente de la edad del material vegetal a cultivar. Los tejidos jóvenes requieren concentraciones de azúcar. menores En términos generales el crecimiento y desarrollo de un cultivo se incrementa con el aumento de azúcar. Agua: En algunas especies un exceso de agua en los medios de cultivo (cultivos líquidos o sólidos con bajas concentraciones de agar) provoca la vitrificación del cultivo. pH is normally adjusted between 5.5 and 6.0 before autoclaving Para la mayoría de la especies el pH óptimo de un cultivo está comprendido entre 5.0 y 6.5. it governs the solubility of the salts influences the uptake of medium ingredients affects the gelling efficiency of agar Los valores pH bajos traen aparejados la baja estabilidad de algunos reguladores de crecimiento (auxinas y giberelinas) y vitaminas, la precipitación de sales del medio y la disminución de la absorción del amonio. pH is altered by autoclaving and during the culture period El acondicionamiento del mismo se realiza antes de la esterilización del medio, y el mismo sufrirá una disminución del orden de 0,3-0,5 unidades. FITORREGULADOR PROPOSITO RANGO Inducción de callos 10-30 µM Estimulación de organogénesis 1-10 µM Inducción de callos 10-30 µM Regeneración de raíces 1-10 µM AUXINAS IAA IBA 2,4-D Inducción y mantenimiento de callos y 1-50 µM cultivos sumergidos en estado indiferenciado pCPA ácido p-clorofenoxiacético Inducción y mantenimiento de callos y 1-50 µM cultivos sumergidos en estado indiferenciado NAA Inducción de callos 2-20 µM Inducción de raíces 0,2-2 µM CITOQUININAS K 6-furfurilaminopurina Inducción y crecimiento de callos y suspensiones 1−20 µM BAP Inducción y crecimiento de callos y suspensiones 0,5−5,0 µM Inducción de la multiplicación de vástagos, 5−50 µM yemas axilares y meristemas Inducción de morfogénesis (vástagos) 1−10 µM Multiplicación de yemas y meristemas 5−50 µM 2iP Inducción de callos (N-isopentenilaminopurina) Inducción de morfogénesis Zea 2−10 µM 10−25 µM Multiplicación de yemas, vástagos y meristemas 30−50 µM Inducción de morfogénesis 0,05−10 µM GIBERELINAS Gib A3 Promoción de crecimiento de vástagos 0,3−14 µM Incremento del desarrollo de embriones y 0,3-48 µM cultivo de óvulos ACIDO ABSISICO ABA Prevención de germinación precoz y 0,04−10 µM promoción del desarrollo de embriones somáticos Explanto Tallos adventicios Raíces Callos Auxinas Citoquininas Container types and closure devices Temperature Para la mayoría de las especies se trata de iniciar cultivos a lrededor de 22 ± 2°C. En general es aplicable que la temperatura más adecuada para el desarrollo de un cultivo es de 3 a 4ºC más elevada que la media que soporta la planta in vivo. Fotoperíodo Duración del día 16h. Bajas intensidades : cultivos mixotroficos. Intensidad de luz Para cultivos autotróficos se requieren mayores intensidades Recordar que la intensidad depende del tipo de sistema de cierre de recipiente de cultivo Callus Callus • Unorganized, growing mass of cells • Dedifferentiation of explant – Loosely arranged thinned walled, outgrowths from explant – No predictable site of organization or differentiation • Often can be maintained indefinitely by subculture, but may lose ability to redifferentiate • Compact vs friable • Habituation Maintenance of Callus General - Callus induction and maintenance media contain the same basal constituents. Most callus requires auxin and cytokinin in the maintenance medium, particularly after prolonged culture (except habituated cells). Callus is re-cultured after 4 to 6 cell doublings, when growth becomes nutrient limited in a batch culture. This interval is referred to as a subculture or passage. Callus morphology cells may be tightly joined and the tissue mass is one solid piece (compact) or cells are loosely joined and individual cells readily separable (friable), which is affected by the genotype or the medium composition. A friable callus is often used to initiate a liquid cell suspension culture Genotypic Effects on Callus Morphology Arabidopsis Tobacco 3.0 mg/L 2,4-D Compact Callus Friable Callus Medium Effects on Tobacco Callus Morphology 0.1 mg/L kinetin 3.0 mg/L 2,4-D friable callus 2.0 mg/L IAA 3.0 mg/L 2-iP compact callus Cytogenetic/genetic variation – Cells of callus are genetically very heterogeneous and the heterogeneity increases during culture Regenerated plants will reflect this genetic variation (somaclonal variation). Somaclonal variation – genetic variation that arises in somatic (non-germ line) cells However, morphogenetic competence is more associated with genetically stable (e.g. meristematic) cells The cytogenetic changes that occur are polyploidy/aneuploidy, translocation, epigenetics etc, although the exact genetic basis for most somaclonal variation is unknown Cytogenetic variation can be minimized by choosing explants that are meristematic and maintain callus in media that favor cell division epigenética es “el estudio de cambios heredables en la función génica que se producen sin un cambio en la secuencia del ADN”. Ejemplo de Epigenética TCAGCTGACTGACTGACTGATCGACTGTTAGCTGACTCAGCTGATCGACTAG TCAGCTGACTGACTGACTGATCGACTGTTAGCTGACTCAGCTGATCGACTAG Las bases son las mismas, pero pueden “marcarse” con diferentes métodos para modificar su expresión, al igual que se hace con un texto usando diferentes tipos de letra, subrayado o negrita para destacar los títulos u otras partes. EPIGENÉTICA Mecanismos silenciadores Comprende: Metilación de DNA Modificación de histonas: Deacetilación Metilación RNA de interferencia Callus Growth Patterns I. Growth patterns leading to continued proliferation of unorganized callus – maintenance II. Growth patterns leading to organized development morphogenesis (adventitious organogenesis or somatic embryogenesis) Callus Growth Is Predominantly at the Periphery of the Tissue Division E. Sutton, UC Davis Senescencia Células meristemáticas División Diferenciación aumento de protoplasma Célula madura Muerte celular Expansión I. Growth Patterns Leading to Continued Proliferation of Unorganized Callus A. Induction of growth (manifested as a lag) - Fresh medium induces quiescent cells (stationary phase) to enter the cell cycle, G1⇒S⇒G2⇒M. Cells in G1 phase proceed through S (DNA/RNA synthesis) phase and then through a short G2 phase prior to mitosis B. Division phase - rapid increase in cell number through periclinal (parallel to nearest surface) divisions subjacent to the periphery of the callus, and followed by anticlinal (perpendicular to surface) divisions. Division >> fresh weight gain resulting in substantial reduction in cell volume (regressive growth), cells dedifferentiate (become meristematiclike), C. Cell expansion - no differentiation II. Growth patterns leading to organized development A. Induction of growth (lag) – B. Division phase – C. Differentiation - cell division slows, during this period differentiation occurs which is then followed by cell expansion resulting in the development of an organized structure. morphogenesis (adventitious organogenesis or somatic embryogenesis) Jerusalem Artichoke Tuber Callus Cell number increases 10-fold in the first 7 days and cells dedifferentiate into meristematic cells Induction Cell division Differentiation • Organogenesis • Somatic embryogenesis Shoot Organogenesis of Tobacco High cytokinin Low cytokinin Somatic Embryogenesis of Carrot 2,4-D (mg/L) Organogenesis The formation of organs (such as leaves, shoots, roots) on a plant organ, usually of a different kind. Organogenesis ü The process of initiation and development of a structure that shows natural organ form and/or function. ü the ability of non-meristematic plant tissues to form various organs de novo. ü the production of roots, shoots or leaves. ü These organs may arise out of pre-existing meristems or out of differentiated cells. ü This, like embryogenesis, may involve a callus intermediate but often occurs without callus. Plant Organogenesis ü Indirect: – This pathway includes a callus stage. • Callus: Undifferentiated tissue that develops on or around an injured or cut plant surface or in tissue culture. ü Direct: – It bypasses a callus stage. The cells in the explant act as direct precursors of a new primordium • An organ or a part in its most rudimentary form or stage of development Organogenesis indirecta Explanto → Callos → desarrollo meristemoide → Primordio • Auxin/cytokinin 10:1-100:1 induces roots. • Auxin/cytokinin 1:10-1:100 induces shoots • Intermediate ratios around 1:1 favor callus growth. Embriogénesis somática Somatic Embryogenesis ü The production of embryos from somatic or “non-germ” cells. ü Usually involves a callus intermediate stage Somatic Embryos üTissue culture conditions can be modified to cause to somatic cells to reprogram into a bipolar structure üThese bipolar structures behave like a true embryo - called somatic embryos El desarrollo de los embriones somáticos pasa por los mismos estados morfológicos de desarrollo que un embrión cigótico: proembrión globular, trapezoidal, embrión cordiforme y torpedo.