Microbiology of food and animal feed

Transcripción

Book of Abstracts
VI International Conference on Environmental, Industrial and Applied Microbiology – BioMicroWorld2015
Barcelona (Spain), 28-30 October 2015
VI International Conference on Environmental, Industrial and Applied Microbiology - BioMicroWorld2015
Introduction
XXIII
Plenary Lectures
XXIX
Session 1: Agriculture, soil, forest microbiology
1
1-Aminocyclopropane-1-carboxylate deaminase producing bacteria promote wheat growth under
water stress
454-Pyrosequencing reveals high and differential level of fungal diversity in the Oasis farming
system in Oman
A new Cryphonectria hypovirus 1 subtype found in Portugal
Agronomic evaluation in a greenhouse and farm level using AMF bio-fertilizers in a Colombian
grooseberry crop (Physalis peruviana L.)
Altruistic model of microbe-plant symbiosis: a conduit for constructing the highly
effective N2-fixers for crop inoculation
AMF Bio-Fertilization in greenhouse stage on high interest commercial forest species in the
Colombian Caribbean region
An extension of the individual-based modelling of soil organic matter INDISIM-SOM-NL to deal
with soil atmosphere
Analysis by PCR / DGGE of bacterial diversity of Oryza sativa, cultivated in southern Brazil and
their interaction with pesticides
Assesment of functional traits in the assemblage of endophytic fungi of Anacardium othonianum
Rizzini
Bacteria associated to ants and scales inhabiting red mangroves (Rhizophora mangle) in Bocas del
Atrato, Turbo, Antioquia, Colombia
Bacterial endophytes as biocontrol agents against root knot nematode
Biodiversity of indigenous alfalfa rhizobia isolated from soils in central Croatia
Biological activity of essential oils on the mycelial growth of the entompathogenic fungi Beauveria
bassiana, Metarhizium anisopliae and Isaria sp.
Biological Control on Seed Germination of Two Native Species from Cerrado Domain
Combined effects of arbuscular mycorrhizal fungi and PGP Rhizobacteria on growth and adaptation
to ultramafic soil of Carpolepis laurifolia, a New Caledonian endemic plant species
Common bean grown in field and inoculated with diazotrophic bacteria and P-solubilizing fungi
Comparison of antifungal activity of Myrthys communis L with Nystatin against Malassezia globosa
and Malasssezia furfur isolated from patients with Pityriasis versicolor and Sebborhoeic dermatitis
Comparison of commercial DNA isolation kits using two different hands and their impact on
microbial community of forest soils
Compatibility of Rhodotorula glutinis (Lv316) biopesticide with chemical fungicides used in
blackberry crops.
Compost from Siam weed (Chromolaena odorata) and cow dung effects on physicochemical
properties, yield and mineral elements of tomatoes
Control of Fusarium oxysporum using compost extract from Chromolaena odorata (Siam weed) and
cow dung
Culture and Molecular-based analyses reveal high fungal diversity in composts, organic fertilizers and
potting media
Diversity and abundance of bacterial metal transporter genes in contaminated soils
Diversity of acidophilic actinobacteria in mine area soils
Diversity of halotolerant rhizobacteria: Auxin production and biofertilization potential for Triticum
aestivum L. in salt amended soils
Effect of bacterial polysaccharide on the soil permeability
Effect of six (6) rhizosphere bacteria (Bacillus subtilis) dissolving the Natural Phosphate on the
growth and yield of maize (Zea mays L.) in Mali
2
3
Effect on Metaresistome and metabolic profile (CLPP) soil bacterial communities of different
agricultural management in Vitis vinifera plots
Effects of Inorganic Fertilizers and Organic Manure on Cyanobacteria of Paddy Fields
Endophytic bacteria isolated from two varieties of Oryza sativa cultivated in southern Brazil.
Evaluation of the biological activity of extracts obtained from bacteria associated with nematodes
against Leaf Cutting Ants Atta cephalotes Linnaeus (Hymenoptera Formicidae)
Exploration of microorganisms associated with insects, searching for active substances produced
from bacteria
31
32
33
34
Functional traits of endophytic and rhizosphere fungi and bacteria of Butia archeri Glassman roots
35
Genetic tools for site-specific tagging of Azospirillum brasilense strains with fluorescent proteins, for
visualization during plant root colonization by live cell imaging
36
6
Increasing value of Tilemsi rock phosphate (TRP) through endomycorrhizal fungi
37
7
Isolation and genetic characterization of bacteria and endophytic and rhizosphere fungi of Butia
archeri Glassman
38
Isolation and genetic characterization of endophytic and rhizospheric microorganisms from Butia
purpurascens Glassman
39
10
Isolation, identification and characterization as PGPR of rizosphere mercury-tolerant bacterial strains,
associated with plants grown in mercury contaminated soils (Almadén mining district, Ciudad Real)
40
11
Laccase activity in black chanterelle mushroom and its importance in forestry
41
12
Marine in Industrial Biotechnology: Biosorption by Sargassum glaucescens brown algae nanoparticle
at new membrane reactor
42
13
14
15
Metagenomic analysis of fungal communities from Himalayan forests
Microbial communities and transgenic crops: understanding the role transgenic crops may play in the
rise of antibiotic resistance
44-45
16
17
Microbial Community Assessment in a Pilot Scale Constructed Wetlands for Treating Horticultural
Leachates
46-47
4
5
8-9
43
Optimization of Extraction of Difenoconazole from Soil for UPLC-MS Analysis
48
18
19
PLFAs as bioindicators of the structural biodiversity of microorganisms in soil under aided
phytostabilization
49
20
Population structure and the interaction of ‘Candidatus Phytoplasma aurantifolia’ with acid limes
(Citrus aurantifolia) reveals
50
21
Potential of Rhizobacterial strains in Changing the Root Architecture of Arabidopsis thaliana and
Growth promotion of Triticum aestivum plant
51
22
Presence and survival of Escherichia coli during cow manure composting at different sampling
locations in a compost barn
52
23
Reduction of foliar diseases caused by Exserohilum turcicum and Puccinia sorghi using biological
control agents at field level in Argentina
53
24
Rhamnolipid biosurfactant to control anthracnose disease in chilli caused by Colletotrichum capsici
54
25
26
27
Screening of fungi associated with eggs and females of root-knot nematodes in Bangladesh and their
biocontrol potential
55
Seasonal changes in the functioning of fungal community in the coniferous forest soil and litter
56
28
29
Soil microbial ecotoxicology of synthetic and natural -triketone herbicides
57
Targeting Gut microbes: Novel approach for insect Control
58
I
30
II
The unseen battlefield – predatory behavior of Cupriavidus necator N-1
59
The use of fungal rot isolates and bioactivator for inhibit the growth of Phytopthora palmivora and
Lasiodiplodia theobromae and in decomposition of cocoa pod husks waste
60
Tolerance to UV radiation, osmotic stress and temperature of epiphytic bacterial biocontrol agents
against Exserohilum turcicum
61
Utilization of ACC-demainase containing rhizobacteria to alleviate tissue ACC concentration and
promote growth and physiology of velvet bean under water stress
62
Session 2: Environmental, marine, aquatic microbiology. Geomicrobiology
63
A comparative microbiological assessment of the Isipingo River and Palmiet River in Kwa-Zulu
Natal province to elucidate health risks
Analysis of the microbial composition and community structure throughout algal blooming season in
Hamilton Harbour, Lake Ontario
Antifungal Hassallidin producers, complete genome and LC-MS/MS characterization from C.
raciborskii strains.
Application of bioluminescence-based microbial biosensors for diagnosis of hydrocarbon in
groundwater samples
Bacterial biosensors for diagnostic determination of hydrocarbon in refined product contaminated
water samples
Bacteriological and Physico-chemical qualities of borehole water, in Imo state, Nigeria
Biodiversity of radioactive environment adapted bacterial communities constituting the biofilms of a
hydrothermal spring cave (Gellért Hill, Budapest, Hungary)
Calcium carbonate induced precipitation by native bacteria with potential use in biotechnological
applications
Characterization of the associated microbial communities of Thalassia hemprichii under different
light intensity regimes, Faafu atoll, The Maldives
Cross-species comparative analyses of secondary metabolite profiles and microbial communities
associated with different sponges from Okinawa, Japan
Cultivation of microalgae species in mixed wastewater for biodiesel and ß-carotene production
Direct and conductive mineral mediated interspecies electron transfer in methanogenic communities
from lakes and seas
Diversity and activity of microbial communities in the Gulf of Naples (Italy)
Diversity and potential applications of metal reducing bacteria from Australian thermal environments
Examining The Role of Soil pH on the Composition and Abundance of Nitrite Oxidising Bacteria
Fishing for innovative active molecules from an original collection of marine bacteria
Formation of Hematite from Ferrihydrite by Ferric Iron-reducing Clostridium sp. strain C8 under
Anaerobic Condition
Fungal communities on indoor surfaces with visible mold growths in apartment houses in South
Korea
How to protect specific bacteria introduced into activated sludge process against protists grazing
Identification of heavy metal resistance genes in Streptomyces strains from a former uranium mining
site
Identification of multi-drug resistant bacteria isolated from industrial sources
Inhibitory effect of erythromycin, tetracycline and sulfamethoxazole antibiotics on
anaerobic treatment of a pharmaceutical wastewater
Isolation and characterization of some fish pathogen Vibrio bacteriophages
Lectin histochemistry of germ-free fish generated from the ovoviviparous Guppy Poecilia reticulata
Main factors contributing to outbreaks of Edwardsiella ictaluri infection among riverine ayu in Japan
Metagenomic and metatranscriptomic analyses confirm the efficiency of nitrifying bacteria from
sewage sludge used for optimisation of the wet oxidation process
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82-83
84
85
86
87
88
89-90
91
Microalgae as a model for metal risk analyses
Microbial communities of highly alkaline, anthropogenic environment of saline soda lime, Poland
Microbiology of abandoned antimony‫ ٭‬bearing deposit in the Poproc area (Slovakia)
Molecular and metabolic characterization of a bacterial community associated to sediments with high
concentration of arsenic
Optimization of culture conditions for ‫ ٯ‬carrageenase production by Alteromonas macleodii strain
KS62
Physicochemical and Microbiological Assessment of Swimming Pools from Selected Hostels in
Osogbo Metropolis, South west, Nigeria
Plasticity in the gut microbial community and uptake of Enterobacteriaceae (Gammaproteobacteria)
in Bombus terrestris bumblebees nests when reared indoors and moved to an outdoor environmen
Predatory fungus (Zoophagus sp.) as a threat to rotifers inhabiting activated sludge
Preliminary studies of microbial community structure in Przemsza River and Biaa Przemsza River
water system, infuenced by lead and zinc mining (Silesia, southern Poland)
Probing the chalcopyrite-bacteria interactions and jarosite biosynthesis by Raman and FTIR
microspectroscopies
Prochlorococcus sp. of the Red Sea
Prokaryotic diversity of biofilms developed in the karst system of Gellért Hill (Budapest, Hungary)
Quantification of viable Enterococcus spp., and Pseudomonas aeruginosa through propidium
monoazide dye assisted qPCR array in surface water and sediments
Rhizo- and endophytic bacteria associated to White birch (Betula celtiberica Rothm. & Vasc.)
growing on arsenic-contaminated soil and bioaugmentation with As-resistant and plant growthpromoting bacteria to enhance phytoremediation
Searching for Anti-Vibrio compounds from Indonesia Marine Actinobacteria
Shifts on bacterial community structure in Antarctica Fildes Peninsula soils with different levels of
metal concentrations
Siderophore-mediated iron dissolution from iron-bearing clays is controlled by mineral
cristallochemistry
Solubilisation of synthetic minerals by metal-resistant bacteria
Taxonomic Diversity and Physiological Properties of Limnohabitans in Freshwater Environment
Taxonomy two original strains belonging to the genus Caldicoprobacter , producing thermostable
xylanase and protease
The chances of successful biological bulking control in WWTPs in winter season
The role of an estuarine salinity gradient on key nitrogen processes
Towards the selection of the best discriminating parameters of microbial water quality: A case study
of a urban recreational water resource involving a dam-rivers complex in Córdoba, Argentina
Treatment of simulated textile effluent with acid red 151 dye by electrolytic process and evaluation of
its toxicity with Artemia salina ecotoxicological test
Use of Freshwater Mussel (Pilsbryoconcha exilis) to control streptococcal infection in juvenile tilapia
(Oreochromis niloticus)
Vibrio spp. isolated from scleractinian coral Acropora muricata with rapid tissue necrosis (RTN) and
reared in aquarium
96
97
98
99
100
101
102
103
104
105-106
107
108
109
110
111
112
113
114
115
116
117
118
Session 3: Microbiology of food and animal feed
119
A new target for highly specific molecular detection of of Escherichia coli by PCR amplification
A novel culture medium for Lactobacillus plantarum based on defatted rice bran
Aflatoxins B1, B2 G1 and G2 in corn from Spain. Determination by an optimized HPLC method
Antifungal potential of P. glandulosa at chitosan coatings
Antimicrobial activity of olive (Olea europaea) leaf extract to use during the elaboration process of
green table olives
Bacterial identification by LC-ESI-IT-MS/MS
120
121
122
123
124
III
92
93
94
95
IV
125-126
Bacteriocin: Antimycobacterial activity in milk and its molecular characterization
Bacteriocins produced by lactic acid bacteria isolated from Romanian traditional fermented foods
Bacteriological Quality of Kilishi Sold in Gombe Metropolis, Nigeria
Bacteriological quality of soya bean cake (awara) sold at Bayero University, Kano – Nigeria
Biodiversity of the characteristic microbiota in refrigerated, frozen and heat-treated donkey milk
Biomarker discovery for foodborne pathogen detection by LC-MS/MS
Cereal species affects biosynthesis of T-2 and HT-2 toxins by Fusarium sporotrichioides in grain
Combined application of chitosan and Cymbopogon citratus (Dc. Ex Nees) essential oil for
preventing Rhizopus soft rot on tomato fruits
Comparative genomics of food-derived Lactobacillus species strain with anti-fungal activity
Comparison of antimicrobial activity against some pathogenic bacteria of bacteriocins produced by
clinical and foodborne enterococci
Comparison of RAPD-PCR and PFGE results in typing of Streptococcus thermophilus strains
Denitrifying pilot plant optimization in Hydrogen sulphide related odour problems
Designing specific and efficient Lactobacillus based probiotics for broiler chickens
Detection of Panton Valentine Leukocidin, enterotoxin A and C in Methicilin Susceptible
Staphylococcus aureus (MSSA) isolated from bovine mastitis.
Detection of Salmonella and Campylobacter in chicken rinse water using a surface plasmon
resonance sensor
Determination of an efficient and economic medium for growth of some probiotic Lactobacillus
strains using response surface methodology
Determination of seven Mucor spp. growth behavior in relation to cheesemaking conditions
Differential count of Bifidobacterium spp using selective culture media in commercial probiotic
yogurt
Effect of drying conditions on the viability and stability during storage of a probiotic microorganism
impregnated in an extruded commercial feed for fry of tilapia
Effect of EK13 enterocin on the survival of Listeria innocua in a meat model under different
temperature fermentative conditions
Effect of hydrolysis of cheese whey proteins by Flavourzyme 1000 L on phenyllactic acid production
by Lactobacillus plantarum
Effect of in ovo injection of a novel probiotic Paenibacillus xylanexedens ysm1 on early growth and
intestinal microflora of broilers
Effect of postharvest application of Metschnikowia pulcherrima L672 as biocontrol agent on
`Ambrunés´ sweet cherries (Prunus avium L.)
Effects of anaerobic and respiratory adaptation on the physiological response of Lactobacillus casei
N87
Efficacy of crustacean chitosan against different species of the postharvest pathogen Colletotrichum
spp. isolated from mango fruits
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
Investigation of adaptation of Escherichia coli to high salt environment
159
Lactobacilli isolates bacteriocinogenic activity against potential pathogenic microbiota in poultry
meat products
160
Maleic acid enhances acid sensitivity of Listeria monocytogenes through inhibition of the Glutamate
Decarboxylase activity
161
Microbiological evaluation of food-contact surfaces and food handlers in Portuguese catering sector:
a preliminary study
162
Microbiological quality of olives and its antimicrobial action
163
MLVA for the subtyping of Salmonella enterica subsp. enterica serotype Dublin: report of France
raw milk cheese outbreak in 2012
164
MLVA profiles stability of Salmonella isolated from dry sausages during production and preservation
165
Occurrence of mycotoxin-producing fungi in Spanish corn
166
Pediococcus acidilactici KTU05-7 strain as an alternative for synthetic preservatives against
foodborne pathogens
167
Phenetic identification and characterization of Alentejo’s traditional dry-fermented sausage’s yeast
microbiota
168
Phenotypic characterization of multidrug-resistant Escherichia coli strains isolated from broiler’s
intestine in Oujda (Morocco)
169
Potentiation of functional and antimicrobial activities through synergistic growth of probiotic
Pediococcus acidilactici with natural prebiotics (garlic, basil)
170
Preparation of a semi-hard cheese from goat's milk using enzyme extracts of fungal origin
171
Prevalence of Salmonella spp., Campylobacter spp., Listeria monocytogenes, verotoxigenic E. coli in
healthy domestic ruminants in Northern Spain
172
Probiotic effectiveness of Lactobacillus plantarum isolated from pickled pepper
173
Probiotic properties and antioxidant capacity of Lactobacillus plantarum 15
174
Probiotic Yeast as vitamin factories: An affordable balanced food for malnourished
175
Quality evaluation of Cassava chips (abacha) produced from two local bitter varieties (Agbaoji TMS
3055) and (Nwaocha Esuclenta dulcis)
176
150
Relating microbiological and physicochemical patterns of a traditional Portuguese fermented sausage
along processing
177
151
Ribotyping bacterial community existing in fresh fruit juices
178
Rumen Mucosae Changes in Unweaned Lambs under the Influence of Some Feed Additives
179
Safety use of dairy enterococci as probiotic candidates
180
147
148
149
Enhancing detection of coliform bacteria by comparative genomics of lacZ sequences
152
Evaluation of antimicrobial activity of different solvents extracts of Hibiscus rosa-sinensis L. and
Cyclopia intermedia
153
Sensorial analysis of cow milk fermented by autochthonous lactic acid bacteria from camel milk
181
182
Evaluation of the anti-Campylobacter activity of Lactobacillus salivarius SMXD51, a bacteriocinproducing lactic bacteria, in broiler chickens
154
Sensory and microbiological quality of kale (Brassica oleracea var. acephala) packed in a modified
atmosphere using microperforation of packaging film
Fermentation by Lactobacillus acidophilus – an efficient tool to convert organic wastes as feedstuff in
fish feed formulation
155
Strategies for the control of Fusarium langsethiae, an emerging risk as a source of T-2 and HT-2
toxins in cereals
183
Influence of starter culture and ripening temperature on the survival of L. monocytogenes in
traditional Portuguese dry-fermented sausages
156
Temperature abuse and assessment of its impact on the shelf life of sliced meat under modified
atmosphere package
184
Innovative approach towards employing MiSeq next-generation sequencing technologies for
assessment of bacterial composition in fresh chicken meat
157-158
The monitoring for the evaluation of microbial contamination in Ready-to-eat products in Korea
185
The presence of SigB in Listeria monocytogenes leads to hypersensitivity to hydrogen peroxide under
186
V
VI
Lasiodiplodia theobromae
aerobic conditions
The role of the glutamate decarboxylase system against dicarboxylic acids in L. monocytogenes
187
Transcription analysis of seven genes responsible for starch degradation in lactic acid bacteria
188
Viability of Escherichia coli in butter, butter product and blend of milk and vegetable fat at frozen
conditions
189
Yogurt derived-bifidobacterium lactis and lactobacillus acidophilus modulate the cytokine secretion
by peripheral blood mononuclear cells from patients with ulcerative colitis
190
Session 4: Industrial microbiology
191
A low-cost solid fermentation medium for potential prodigiosin production by Serratia marcescens
UCP/WFCC 1549
Andean Thermal and Saline Springs: Reservoir of Biodiversity and Source of termostable enzymes
and metabolites
Bed moisture content, pressure drop and heat generation in a Solid State fermentation process for
Trichoderma asperellum Th204 in a fixed bed fermenter
Biochemical and microbiological description of spontaneous wheat sourdough from two Spanish
bakeries
Bioconversion of different sugars into ethanol by Vitreoscilla Hemoglobin (VHb) expression in E.coli
Bioconversion of Whey Lactose into Single Cell Protein using Killer Saccharomyces cerevisiae
Hybrids
Biosurfactant production by Candida glabrata (UCP1556) and Penicillium spinulosum using full
factorial design
Biotechnological production of biosurfactant in economic medium by Candida spp and evaluation of
biodegradation potential of petro derivates
Cholesterol biotransformation into androstane steroids by Rhodococcus species
Citric acid produced by Aspergillus sp (SIS 09) using agroindustrial waste derived from the fruit
industry in alternative media for submerged fermentation
Construction of plasmid vectors for expression of bacterial cellulase genes in Saccharomyces
cerevisiae for bioethanol production using cellulose as a substrate
192
Influence of nutritional supplementation on ethanol production by Scheffersomyces shehatae UFMG
HM52.2 using sugarcane bagasse hydrolysate
214
Kinetics of lipid accumulation of Candida lipolytica (UCP 0988) in synthetic medium and industrial
waste
215
Lactic acid fermentation of lignocellulose-derived substrates with (hemi)cellulolytic microbes
216
Microbial production of amino acids: developments and achievements of industrial application of the
technologies
217
Modelling citric acid production of Yarrowia lipolytica in a carrot juice-based medium by response
surface methodology
218
193
Molecular identification and production of xylanases and cellulases from various ascomycetes fungi
isolated from diverse environment
219
194
Optimization of biosurfactant production in fed-batch cultures using 2nd generation feedstocks
220
Partial characterization of xylanases from Bacillus oceanisediminis SJ3 isolated from Algerian soil
221
Pigment production by Penicillium spp isolated from Caatinga-Brazil soil using different carbon and
nitrogen sources
Poly--hydroxybutyrate production in Azospirillum brasilense strain Sp245: phbA, phbB and phbC
cloning and overexpression genes
222
196
197
198
Production of sour cassava starch in a pilot-scale fermentation process using starter cultures
224
199
Protease production by Cunninghamela echinulata (SIS 40) through submerged fermentation by
using factorial design
225
200
201
Solid state fermentation of Fusarium solani pisi on tomato industrial processing waste: Potential use
of the crude enzymes extract to enhance lycopene extraction
226
Study of the effect of RsmA on the expression of the algD gene in Azotobacter vinelandii
227
195
202
Culture conditions for bacterial cellulose production using low quality fruit juices
203
Cyclodextrin glycosyltransferase biosynthesis by genetically engineered fermentative Lactococcus
lactis in aerobic system
204
Degradation of aliphatic petroleum compounds by mixed microbial consortia
205
Determination of the microbiota associated with different methods of coffee fermentation, for the
production of special coffees in Antioquia, Colombia
206
Evaluation of bacterial strains obtained from Kefir as starter culture in production of fermented
sausage
207
Extraction of bacteriocin from the fermented broth of Lactobacillus plantarum ST16Pa using aqueous
two-phase polymer systems
208
Fluidized bed drying process of two granular prototypes based on yeast Meyerozyma guilliermondii:
Effect on cell viability after drying and during storage
209
Growth kinetic parameters and cell morphometry with batch cultures of Saccharomyces
cerevisiae and different initial concentrations of glucose
210
High Production and Characterization of Bioplastic from Halomonas organivorans DB4
211
Improved growth and use of maltodextrin as a cryoprotection and preservation in Lactobacillus
plantarum CECT 8150 strain submitted to freeze-drying process
212
Influence of carbon source and yeast extract concentration on the exopolysaccharide production by
213
Synthesis of amides and peptides using new enzyme function
228
Tannase production by Penicillium chrysogenum (SIS 25) through submerged fermentation using
alternative media containing agro-industrial residues
229
The interaction in vivo between sensor kinase GacS/RetS and GacS/LadS mediates the increase of
Alginate production in Azotobacter vinelandii
230
Transcriptional regulation of L-arabinose utilization genes in Corynebacterium glutamicum
231-232
Utilization of chestnut shell hydrolysate for xylitol production by Candida tropicalis
233
Utilization of organic residues for biosurfactant production by Serratia marcescens UCP/WFCC 1549
234
Session 5: Medical, veterinary and pharmaceutical microbiology
235
A floating all-in-one type of microbial fuel cell for wastewater treatment
A qualitative anti-protective antigen ELISA for serodiagnosis of human anthrax- field usable kit
Adhesion of Streptococcus mutans on tooth colored restorative materials
Agave fructans for different uses in health
Glucan administration enhances disease resistance in European eel (Anguilla anguilla)
American foulbrood is a disease that produces effects at colony level, but does not affect the
physiological parameters on nurse bees (Apis mellifera).
Anti-diarrheal Role of fermented milk with B. bifidum associated Lb.acidophilus
Anti-hyperglycemic potential of lactobacilli fermented milk components
236
237
238
239
240
241
VII
223
VIII
242
243
Antimicrobial activity of Mexican propolis on important infectious agents in animal health
Antimicrosporidian activities of lip peptides and sulphated polysaccharides from algae and their
potential to control honeybee nosemosis
Antiphage activity of sera from patients receiving staphylococcal phage preparations
Bacillus illness Mimicking cutaneous anthrax in South India
Bacteria as resistant microorganisms in decomposition of mummified human remains
Blood biochemistry, haematology and leukocyte phagocytosis after application of probiotic bacteria
and chlorophyll in dogs
Brucellosis and immunochemical tests
Candidates for universal vaccine against influenza virus
Characterization of microbial community structures of cow rumen and manure by pyrosequencing
and Q-PCR
Characterization of Probiotics for GLP-1 production in NCI-H716 cell line
Comparative study of enzyme linked immunosorbent assay (ELISA) and rapid test screening methods
on HIV, HBsAG, HCV and syphilis among voluntary donors in Owerri, Nigeria
Correlation between aggregation, hydrophobicity and adhesion capability of authochtonous
Lactobacillus strains
Current diversity of infectious hematopoietic necrosis virus (IHNV) in Japan
Detection of bacteriocin structural genes in faecal enterococci from dogs
Detection of Mycobacterium bovis in organs of slaughtered cattle by DNA-based Polymerase Chain
Reaction and Ziehl-Neelsen techniques in Bauchi State, Nigeria
Development of a PCR for the detection of Demodex folliculorum infestation in the periocular area
Development of rapid protocol for routine identification of Tsukamurella species by MALDI-TOF
Mass Spectrometry
Diabesity management through inhibition of nutrient digestion and absorption
Distribution of indoor and outdoor saprophytic fungi in some public places in Isfahan
Dynamics of Campylobacter jejuni shedding in a broiler flock experimentally infected with two
different strains
Effect of dietary shifts on infection progression and immune response in rabbits challenged with
Mycobacterium avium subspecies paratuberculosis
Effect of interferon expression by supplementation with high-concentration ascorbic acid in rainbow
trout onchorhynchus mykis
Effect of operational changes in tetracycline resistance gene proliferation in anaerobic digestion of
OTC medicated cattle manures
Efficacy of an Allium extract against pathogens associated with mastitis in goats
Efficacy of new antiviral treatments for hepatitis C virus
Enterocin M-producing strain Enterococcus faecium AL41 with probiotic properties and its
application in horses
Enterocins and their beneficial effect in rabbits husbandry
Evaluation of a new device for the detection of Group B Streptococcus in pregnant women
Evaluation of the effect of ICI118,551, a beta adreno-receptor antagonist , and alum, as adjuvants for
increasing the efficiency of vaccination against Salmonella typhimurium
Evolutionary creation of new phenol-lyase activity on a related scaffold by rational design and flow
cytometry-based high throughput screening
Fish and waterbirds as possible reservoirs and vectors of Vibrio cholerae
Gut microbiome profile in rabbits experimentally infected with Mycobacterium avium subspecies
paratuberculosis and fed a regular or a high fiber diet
Hemolysin II cytotoxic activity on mice primary hepatocytes and intestine smooth muscle cells.
Honeydew honey compared with manuka honey in the treatment of infected non-healing wounds
Human blood plasma activates the production of B. cereus pore-forming toxin HlyII
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
Immune response to UreA and UreB of Helicobacter acinonychis delivered on the surface of
recombinant Bacillus subtilis spores
In silico characterization of proteins implicated in the Dot/Icm secretion apparatus and related
virulence effectors in the fish pathogen Piscirickettsia salmonis
In vitro activity of ceftaroline against clinical isolates of Haemophilus spp. and Moraxella catarrhalis
In vitro and in vivo protection against Lactococcus garviae infection by the enterocin AS-48 producer
strain Enterococcus faecalis UGRA10
Infections by emergents yeasts
Introducing Clinical Microbiology to secondary school science teachers in Catalonia
Investigation of Trichomonas vaginalis infection among Women of child bearing age in Owerri, Imo
State, Nigeria
Microbiota assessment of the domestic environment of dogs from a town in Brazil.
Middle East Respiratory Syndrome Coronavirus infections in Iran from 2013-2015
Molecular characterization of Carnivore protoparvovirus-1 in wild carnivores in Spain reveals wide
host range and cross-species transmission
Phenotypic and molecular characterization of Klebsiella sp from urine samples of in- and out-patients
in some health institutions in Nigeria
Phosphorylation of Giardia lamblia End-binding 1 Protein by Aurora Kinase
Postoperative infections associated with semiautomatic retractors O'Sullivan O' Connors, Balfour and
Soriano
Preliminary characterization of bacteriophages against Staphylococcus aureus strains from bovine
mastitis: a functional molecular epidemiology approach
Prevalence of Malaria in Blood Donors and Neonates: a Study of Congenital and Transfusion
Transmitted Malaria at Sunyani Regional Hospital, Sunyani Municipal Hospital and Berekum Holy
Family Hospital in the Brong Ahafo Region, Ghana
Prevalence of rotavirus and adenovirus associated with diarrhea among displaced communities in
Khartoum, Sudan
Public health implications and risk factors assessment of Mycobacterium bovis infections among
abattoir personnel in Bauchi State, Nigeria
Recombinant spores of Bacillus subtilis presenting influenza A matrix 1 protein elicit immune
response in mice
Relative adherence index and biofilm formation ability as markers for virulence in Gardnerella
vaginalis isolated from mexican women with and without vaginosis
Role of -actinin 2 in cytoadherence and cytoxicity of Trichomonas vaginalis
Role of cysK and cysM genes from S . Typhimurium in resistance to bactericidal antibiotics
Search for pathogenic yeasts on medical devices.
Seroprevalence of Chlamydia pneumoniae infection in patients with acute coronary syndrome
The annotation of Piscirickettsia salmonis LF89 genome reveals the presence of two functional
variants of the Hfq sRNA-chaperone
The diversity of fungi in potting soils
The interactions of quorum-sensing activator PlcR and RNA-polymerase on Bacillus cereus toxins
promoters.
Variation in viral shedding patterns between poultry and wild terrestrial bird species infected
experimentally with reassortant avian influenza virus (H9N2)
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
Session 6: Antimicrobial agents and chemotherapy. Antimicrobial resistance
306
-lactamases of Acinetobacter baumannii clinical strains
A methodological framework to monitor pollution with antibiotics and antibiotic resistant
microorganisms – the EnviroAMR project.
A new vector to express protein from environmental cDNA toward to find new antimicrobial agents
A novel vaccine approach for limiting Salmonella establishment in plant surfaces
307
308
IX
279
X
309
310
Antibacterial activity of Laurus nobilis in Algeria
Antibacterial activity of locally isolated thermophilic fungus, Myceliophthora thermophila
Antibacterial activity of papain hydrolysed camel milk whey
Antibacterial activity of serine protease inhibitor from hemocytes of Lasiodora sp. (Araneae:
Theraphosidae)
Antibacterial and Phyto-chemical potentials of Moringa oleifera (Okweoyibo) on some wound and
enteric pathogenic bacteria
Antibiogram, virulence determinants, and genetic diversity of integron-positive Escherichia coli
isolates recovered from treated wastewater effluent and receiving aquatic milieu in Durban, South
Africa
Antibiotic susceptibility of Staphylococcus aureus and Staphylococcus épidermidis isolated from eye
infections in Tlemcen (Algeria)
Antimicrobial activity of grapefruit seed
Antimicrobial activity of nisin-loaded pectin particles
Antimicrobial effect of essential oils of some Algerian plants against toxegenic E. coli O157: H7
Antimicrobial metabolites isolated from terrestrial Streptomyces sp.
Antimicrobial potential of probiotic bacteria
Bacteriocins of Lactic Acid Bacteria isolated from tomatoes post-harvest
Bacteriophage for sensing of pathogens
Bioactive molecules secreted by new Actinomadura strain isolated from Ezzemoul Sebkha of Ain
M'lila (Algeria)
Biodiversity and antimicrobial activity from endophytic fungi isolated from Morinda citrifolia
Biological activities from the methanolic extract of Buchenavia tetraphylla
Carbapenem resistance among of Klebsiella pneumoniae clinical isolates in Iran
hitosan as an lipopolysaccharide-binding and endotoxin-neutralizing agent
Chlorination effects on bacterial diversity and antibiotic resistance gene profiles of treated
wastewater: a metagenomic insight
Combating pathogenic microbes through E. coli based silver nano tools
Detection of Escherichia coli producing beta-lactamase extended spectrum (ESBL) isolated from
patients with urinary tract infection in Jundiaí, São Paulo, Brazil
Determination of frequency of blaTEM & blaSHV genes among Escherichia coli isolates from Karaj
City
Determination of the efficacy of phosphomycin on carbapenemase (KPC)-producing Klebsiella
pneumoniae clinical isolates
Effect of polyphenols extracted from honey on Methicillin-Resistant Staphylococcus aureus
Endophytic Nocardiopsis dassonvillei and Amycolatopsis orientalis isolated from Brazilian tropical
savannah presented antibiosis against pathogens
Enterobacter cloacae: a multicenter study on antibiotic resistance in the west of Algeria
Environmental filtering reduces antibiotic resistance genes abundance in urban wastewater treatment
plants
Evaluation of antibiotic resistance genes in human impacted environments from Romania: a
preliminary step for an environmental protection strategy
Expression of Cellulose and Curli Fimbriae by Escherichia coli and Klebsiella pneumoniae:
Antibiotic Resistance and Extended Spectrum Beta-Lactamases
Fate of tetracycline resistant Enterococci and tetracycline resistance genes during wastewater
treatment
Genes of aminoglycoside resistance in vancomycin-resistant and vancomycin-susceptible
Enterococcus faecium strains
Genetic characterization of antibiotic resistance in Enterococcus spp. from ready-to-eat salads
Genetic relatedness in MDR Salmonella Enterica isolates harbor class 1 integron from human and
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
poultry in Iran
Impact of zinc feed supplementation of piglets to the proportion of multidrug-resistant Escherichia
coli
In vitro antibacterial activity of ethanolic extracts of Mentha spicata L. and Artemisia campestris
from Algeria
In vitro antimicrobial activities of extracts from rare actinomycetes against MDR Gram-positive
bacterial pathogens
In vitro susceptibility of Candida albicans to alcoholic extract of Matricaria chamomilla and its
comparison with Amphotericin B
In vitro synergy of minocycline combinations against Extensively-Drug -Resistant Acinetobacter
baumannii
In-vitro Study of Antimicrobial and Antioxidant Activities of Essential Oils from Three Khaya
Species
Inhibition of sulphate reducing bacteria by green silver nanoparticles for biofouling mitigation
Microbial and crustacean Chitosan: Isolation, characterization and antimicrobial activity
Molecular characterization of antibiotic resistant Pseudomonas aeruginosa isolates deriving from
aquatic environments of Greece
Nanostructural silver particles in aqueous and organic dispersions and their microbiological activity
346
347
348
349
350
351
352
353
354
Naphthoquinones Produced by Submerged Culture of the Basidiomycete Quambalaria cyanescens
355
New formulations of the amphotericin B in the treatment of the invasive candidiasis
356
New lipophilic derivatives of isoniazid
357
Phenotypic and genotypic antibiotic resistance in staphylococci from ready-to-eat salads
358
Phenotypic Detection of Extended Spectrum -Lactamases (ESBLs) among Clinical Bacterial
Isolates obtained from Daura General Hospital, Katsina State, Nigeria
359
Phenotypic expression and prevalence of ESBL-producing Enterobacteriaceae in patients’ samples
from various wards of Mulago Hospital, Uganda
360
Phylogeny and antibiotic resistance of Escherichia coli isolated from Mytilus galloprovincialis in
Algeria
361
Polysaccharides of red seaweeds as antibacterial substances
362
Pore forming drugs: antimicrobial mechanism and clinical applications
363
Potential antibacterial activity of Zygophyllum album in vitro and in vivo
364
Prevalence and risk factor analysis of MRSA in pig herds in Latvia
365
335
336
Prevalence of antibiotic resistant Enterobacteriaceae in wastewater treated effluent
366
Pyrazinecarboxamide Analogues, Synthesis and Antimycobacterial Evaluation
367
337
338
Removal of antibiotics and antibiotic resistance genes in veterinary hospital effluent by alternative
fungal treatment
368
Role of prodigiosin in antimicrobial activity
369
Screening of antibiotic producing Actinomycetes from the sediments of undisturbed forest areas of
Asella, Ethiopia and its hyper activity after mutation
370
340
Screening, isolation, purification and partial characterization of a novel peptide with antifungal
activity from Streptomyces griseoplanus TKJ2
371
341
339
342
343
344
Searching for new receptors for Class II bacteriocins in lactic acid bacteria
372
Synergistic antibacterial interaction between some Mediterranean plant extracts (Inula viscosa,
Anacyclus valentinus) and antibiotics
373
Synthesis and Application of Chitosan Nanoparticles for the Development of Antibacterial Health
374
XI
345
XII
Care Textiles
Synthesis and bio-evaluation of novel 7-hydroxy-coumarin derivatives
375
Synthesis and evaluation of antimicrobial dendrimers based on acyl lysine oligomers (OAKs)
sequences
376
Synthesis and in-vitro biological activity of novel 2-chlorobenzoic acid derivatives
377
The influence of antimicrobial disinfectant on quality of microbial DNA typing
378
Towards the Clostridium difficile mucosal vaccine based on Bacillus subtilis spores
379
Two stages of pathway-specific regulation of auricin biosynthesis in Streptomyces aureofaciens CCM
3239
380
Water-soluble Moringa oleifera lectin (WSMoL) affects growth, survival and cell permeability of
corrosive and pathogenic bacteria
381
Session 7: Microbial physiology, genetics, evolution and adaptation
382
Alterations of ubiquinone system and fatty acids compositions of Rhizopus arrhizus UCP402 and R.
arrhizus UCP402x (mutant) mediated by pyrene
Analysis of the extracytoplasmic function factors (ECFs) in the tetralin degrader Sphingopyxis
granuli strain TFA
Bacterial diversity in the whole gut of giant African Snail, Achatina fulica
Characterization and Phenotypic analysis of two novel putative transcription factor involved in
ergosterol biosynthesis and sexual development in Aspergillus nidulans
Comparative genomic analysis of Streptacidiphilus spp.
Comparative surface glycoconjugates cytochemistry in Zygomycetous fungi
Comparison of O-antigen gene cluster from E. coli O157 from human and non-human strains
Competence development and horizontal plasmid transfer in natural Escherichia coli strains
Cytochrome bd oxidase of Porphyromonas gingivalis is involved in oxidative stress resistance
383
E. coli Dps without its DNA binding activity (Dps'18) can compensate for the role of S. aureus
MrgA in hydrogen peroxide resistance
Effect of ionizing radiation on the physiology of Escherichia coli
Exopolysaccharides isolated from selected Actinomycetes – characterisation and application
From genome to phenotype: an integrative approach to evaluate the natural diversity of Lactococcus
lactis subsp. lactis
Genome-wide analysis of Mycobacterium tuberculosis strains isolated from patients with pulmonary
and extrapulmonary tuberculosis in Russia
Global transcriptome response of Methylocystis sp. strain SC2 to salt stress
Growth characteristics under in vitro nasal environment are different among strains in Staphylococcus
aureus
Identification of genes affecting mutation rate in Pseudomonas putida by a novel papillation-based
assay
Microbial endocrinology in Staphylococcus aureus: modulation of internalization, biofilm formation
and gene expression of virulence global regulators by cytokines
Molecular epidemiology of Mycobacterium tuberculosis by fingerprinting methods in south of
IRAN ( 2014)
Mucus binding properties of L. casei group strains before and after oxidative stress
Nine close homologues of general stress response sigma factor SigB are regulated by complex
interconnected pathways through a great number of anti-sigma factors and anti-anti sigma factors in
Streptomyces coelicolor A3(2)
Nodule-specific and nodule-induced Monosaccharide Transporters (MSTs) in Medicago truncatula
Non-protective role of sigB against oxidative stress in Listeria monocytogenes
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
Not so simple, not so subtle: The interspecies competition between Bacillus simplex and Bacillus
subtilis and its impact on the evolution of biofilms
PadR-like Protein (MSMEG_6227) is a major protein in the membrane of Mycobacterium smegmatis
dormant cells
Physiological role of a seemingly superfluous metabolic pathway in streptomycetes
Presence of agr allotype and tsst-1 gene in Staphylococcus aureus isolated from bovine mastitis in
Brazil
Proliferation is an alternative to bacterial growth arrest under starvation
Putatively hypoxia-regulated genes that control the carbon allocation and metabolism in the nodule of
Medicago truncatula
Regulatory Effects of ComA and Spo0A Proteins on the lutR Expression in B. subtilis
Relict Vavilovia formosa rhizobia-legume symbiosis: so unlike the others
Response of paddy soil microorganisms to salt stress
Reversible mutations in agr locus in Staphylococcus aureus
RNA binding protein mediated regulation of lipid biosynthesis
Short-term adaptation to redox stress via genomic mutations in E. coli
The bacteriochlorophyll biosynthesis of the marine bacterium Dinoroseobacter shibae and its lightdependent regulation
The immunoregulatory effects of the non-motile Piscirickettsia salmonis flagellin in Salmo salar cells
The Mycobacterium tuberculosis P-type ATPase CtpG preferentially transports copper across the
mycobacterial plasma membrane
The P-type ATPase CtpF is involved in the Ca2+ ions pumping across the Mycobacterium
tuberculosis plasma membrane
The role of convergent transcription of overlapping genes in quorum sensing regulation in
Pectobacterium atrosepticum
Transcriptome analysis of Debaryomyces hansenii cells acclimated to non-salt and high salt
environments.
Two-headed outer- and inner-arm dyneins of Leishmania sp bear conserved iq-like motifs
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
Session 8: Biofilms
425
A comparative study of Staphylococcus aureus adhesion to the fluorine-containing surfaces obtained
by various methods of ion-plasma technology
Amyloids-DNA complexes mediate adherence and cohesiveness of bacterial biofilms
Antibiofilm activity of major compounds of essential oils against Salmonella enteritidis
Assessment of tolerance development in L. monocytogenes-E. coli dual-species biofilms to Pronase
and Benzalkonium chloride treatment
Bacterial emboli new biofilm-like structures, the formation of which requires the interaction of
plants and microbes
Biocontrol of Staphylococcus aureus by bacteriophage K in the food industry
Biofilm formation by Staphylococcus aureus and Staphylococcus epidermidis in stainless steel and
polypropylene coupons
Biofilm formation potential of indigenous arsenic resistant bacterial isolates from industrial effluents
Biofilm models development and their use in the evaluation of antibacterial products, treatments and
coatings.
Biofilms of MRSA and MSSA under scanning electron microscopy
Chitosan nanoparticle enhance the efficiency of the methylene blue-induced lethal photosensitization
of methicillin-resistant Staphylococcus aureus biofilm
Does dibenzothiophene (DBT) and poly aromatic hydrocarbons effect biofilm versus planktonic
growth of DBT degrading strains?
Electron microscopy analysis of interaction between Staphylococcus aureus, Candida albicans and
polyurethane
426
XIII
406
XIV
427
428
429
430
431
432-433
434
435
436
437
438
439
Electron tomography reveals nanostructure and intercellular pipelines in phenanthrene-grown
biofilms of Delftia acidovorans Cs1-4
Gramicidin S is the best antibiotic against resistant biofilm forming pathogens
Honeydew honey and its antibacterial peptide defensin-1 as an effective anti-biofilm agent
Magnesium ions inhibit biofilm bundles formation of Bacillus species within milk
Microbial colonization of solar panels in an arid environment, affects the efficiency of photovoltaic
panels
Morphological characteristics of Shewanella biofilms formed on graphite electrodes in
bioelectrochemical systems
N-Acyl homoserine lactone from biofilm-forming uropathogenic Escherichia coli and Klebsiella
pneumoniae isolated from urinary tract infection, Cartagena-Colombia
Non-toxic photocatalytic nanorod coatings for prevention of marine biofouling
Organic acid treatments to control biofilms formed by S. aureus on different surfaces
Pectobacterium atrosepticum SCRI1043 produces exopolysaccharides in model cultures and infected
plants
440
Post-transcriptionally generated cell heterogeneity regulates biofilm formation in Bacillus subtilis
441
442
443
444
Biodegradation of free cyanide at different concentration and without carbon source
472
Biodegradation of motor oil by different bacterial cultures
473
Biodegradation of oil and grease (O&G) by bacteria from Saudi Arabia wastewater
Biodegradation of the highly complex polyaromatic hydrocarbon pyrene by bacteria Bacillus
lenichiformis and Ralstonia sp from the coastal region of Saudi Arabia
474
475-476
Biodegradation potential of Paenibacillus sp. strain HD1PAH on anthracene and benzo(a)anthracene
477
Biodegradation potential of the soil bacterial community from a polluted site in the northern of
Portugal
478
Biodeterioration in wooden churches from Romania. Case study: The church from Amarasti, Vâlcea
County
479
Biodeterioration of a XIII century parchment roll: new approaches for the studies and the restoration
strategies
480
Bioleaching of mining waste rich in antimony and arsenic by the Aspergillus niger strains and
autochthonous microflora
481
450
Screening of antifouling microorganisms and its performance evaluation
451
Biological and physical cleaning of Çay
rhan lignites (Turkey)
482
Structure and functional prediction using computational simulation of a multi-domain protein
involved in motility and chemotaxis in A. brasilense Sp245.
452
Biological low cost treatment of pesticides using mixed bacterial culture
483
Bioremediation of perflurinated compounds and gasoline mixture evaluated by conductivity
484
Biosurfactant produced by Cunninghamella elegans UCP 0542 using corn steep liquor (CSL) and
soybean oil waste (SOW) as a nutritional source and application in bioremediation of soil
contaminated by petroleum derivatives
485
Carbonate biomineralization and microbial diversity of cave speleothems for applications in
Sustainable Materials
486
445
446
447
448
449
Theorem on Cancer Metastasis Treatment by Bacteria and Its Biofilms: Past, Present or Future
453
Theoretical model for identifying potential compounds with activity agonist quorum sensing in
Pseudomonas aeruginosa
454
Three AHL-acylases of Pseudomonas sp. 1A1 isolated from wastewater treatment plant, and their
competence for controlling biofilm formation
455
Session 9: BBB - Biodeterioration, Biodegratation, Bioremediation
456
Changes of bacterial community in soil contaminated with lubricant oil after bioremediation by PCRDGGE
487
Aerobic degradation of lindane combining bacteria and zero valent iron nanoparticles
Alternative treatments for textile effluent using Moringa oleifera and Saccharomyces cerevisiae
Analysis of microbial communities in biofilms associated with gypsum deposits on the walls of a
cave and a shelter decorated classified as UNESCO World Heritage sites
Analysis of the microbial community of highly petroleum polluted soil obtained from dredging of
petroleum waste storage pit as an approach for evaluation of its bioaugmentation potential
Are syntrophic acetate oxidazing (SAO) bacteria more common in high ammonia-loaded anaerobic
digesters than we think?
Assessment of diesel and biodiesel multiple Degrading potential of fungal isolates from caatinga soil
and mangrove sediments (PE, Brazil)
Assessment of microbial community structure inhabiting long term oil contaminated soil: Tracking
taxonomic profiling and functional characterization using next generation sequencing technology
Bioaugmentation of a PAH-contaminated former gas plant site
Biodegradation ability of Trametes versicolor enzyme system on PAHs
Biodegradation of biodiesel and diesel blends
Biodegradation of Bisphenol A by native and modified by linear-dendritic co-polimers Laccase from
Trametes versicolor
Biodegradation of chlorinated pollutants in contaminated marine sediments: structure and metabolic
potentialities of indigenous microbial communities
Biodegradation of cyanotoxins – basic studies and possible applications
Biodegradation of di octyl phtalate (DOP) and di isononyl adipate (DINA)
Biodegradation of Diesel Oil by Penicillium sp.
457
458
459
Characterization of a novel decarboxylase involved in the metabolic pathway of degradation of 2hydroxy-1-naphthoic acid from Burkholderia sp. strain BC1
488
Characterization of an extracellular medium-chain-length polyhydroxyalkanoate depolymerase from
Variovorax sp. DSH-2
489
460
Chemical and biological treatment of effluents containing cyanide from a gold mine
461
462
463
464
465
466
467
492
Complex natural amendments enhance cellulolytic activity of bacterial consortium
493
Crude biosurfactant from glycerol for environmental application
494
Degradation kinetics of 2,4-D and atrazine by regional strain of Trametes versicolor (L.:Fr.) Pilat in
Morelos State, Mexico
495
Degradation of alkanes under high hydrostatic pressure: microbial degraders from the West Iberian
Margin
496
Degradation of carbon steel AISI 1020 coupons immersed in blends containing 90% Diesel B6 and
10% Seawater and 90% Diesel B30 and 10% Seawater
497
468
Degradation of carvedilol by the filamentous fungus IM 6303
498
469
470
471
Degradation of diesel by Aspergillus sp.
499
Development of biological treatment strategy for simultaneous detoxication of chromium and azo
dyes pollutants released by the leather processing industry
500
XV
490-491
Comparative proteomic analyses of an ETBE degrading bacterial consortium
XVI
Diesel oil degradation by filamentous fungi alone and in consortium
501
contaminated soil remediation
Dominant bacteria involved in alkylphenols degradation in oil-contaminated wastewaters
502
Multiple heavy metals response and antibiotic sensitivity pattern of Bacillus subtilis strain KPA
Effect of dibenzothiophene (DBT) on the growth Pseudomonas fluorescens and induction of
production biosurfactant
503
Obtaining of a bacterial inoculum able to degrade reactive dyes in aerobic conditions
528
529
Effect of salinity on diesel biodegradation by Candida lipolytica UCP 0988
504
PAH biodegradation potential of Enterobacter aerogenes PB 39 isolated from crude of contaminated
soil- Significance for bioremediation
Evaluation of changes in microbial community structure and functional genes in petroleumcontaminated soil through a bioremediation monitoring process
505
Phylogenetic diversity of marine bacteria capable of degrading medium-chain-length
polyhydroxyalkanoates
530
Evaluation of microbial diversity in historical velvet textiles from the Museum of King John III’S
Palace at Wilanów, Poland
506
Physiological response of bacteria consortium to the presence of intact and autoclaved freshwater
sapropel (gyttja) derived from the Eastern Latvia
531
Evaluation of the capacity of Pseudomonas sp. S4 and Bacillus megaterium to tolerate and
accumulate some heavy metals
507
Pseudomonas anguillarum enhances the efficiency of a microbial consortium in the detoxification
and remediation of a soil contaminated by Polyciclic Aromatic Hydrocarbon (PAHs)
532
Evaluation of the suitability to use sulfide-reduction bacteria in wetlands and biorreactors to
bioremediate acid drainage from copper mining in Ecuador
508
Purification and characterization of a depolymerase enzyme from Brevundimonas sp. that degrade
aliphatic polyesters
533
Hydrocarbon biodegradation in coastal environments: Bacterial characterization and biostimulation
treatments.
509
Redox mediator evaluation in the azo dye biodegradation
534
Reduction of selenite to red elemental selenium by methane oxidizing bacteria
535
Implementation of a biological treatment system for arsenite detoxification using Pseudomonas
arsenicoxydans immobilized on zeolite.
510
Remediation of Pentachlorophenol by microbial community exists in the aerobic-anaerobic interfaces
established by the rice rhizosphere (Oryza sative L.)
536
527
Influence of bioaugmentation and additional carbon sources on 4-chlorophenol degradation in soil
511
512
Removal of a mixture of chiral pharmaceuticals by an aerobic granular sludge bioreactor and its
effects on the biomass
537
Insights into selenite reduction and biogenesis of elemental selenium nanoparticles by two
environmental isolates of Burkholderia fungorum
513
Removal of As(III) and As(V) using a bio-catalytic calcification reactor with arsenic resistant
ureolytic-calcifying bacterial strain
538
Investigation of Çay
rhan lignite biodesulphurization of microoganisms isolated from coal itself
Isolation and evaluation of cellulolytic bacteria from gut of Giant African snail, Achatina fulica
(Bowdich)
514
Reusable Bacteria Immobilized Electrospun Nanofibrous Web for Decolorization of Methylene Blue
Dye in Wastewater Treatment
539
Isolation and Identification of Bacteria Capable of Degrading Crude Oil Under Aerobic Conditions in
River Nile State
515
Structural insights into the protein ligand interaction of sensory domain of aromatic-responsive
transcription regulator PoxR
540
Isolation and molecular identification of actinomycetes from wastewater treatment plant and capable
of growing on Roundup herbicide as a sole source of carbon and energy
516
Studies on biodegradation of phenolic compounds by Aspergillus glaucus strain
541
Study Comparative degradation of Kerosene by Yeast and Bacteria
542
Kinetic and thermodynamic models applied to the removal of Acid Blue 161 dye by Saccharomyces
cerevisiae from effluents
517
Landfarming of IFO contaminated beach sand through oleophilic, slow release fertilizers, poultry
compost and plant based biosurfactant
518
Living composites of electrospun yeast cells for bioremediation
519
Mercury resistance and volatilization by moderately thermophilic hydrocarbonoclastic bacteria from
Kuwaiti desert soil
520
Metagenomic analysis of microbial consortium isolated from petroleum-contaminated soil
521
Metagenomic insight into bacterial community diversity and functions in chlorinated hydrocarbon
contaminated groundwater undergoing bioremediation
522
Microbial community changes upon composting on a coir pith medium with different hydrocarbon
mixtures
523
Microbial community composition in granular sludge anaerobic ammonium-oxidizing (anammox)
reactor revealed by metagenomic approach
524
Minimal inhibitory concentration of chemical agents in the control of microorganisms in saline water
525
MiSeq next-generation sequencing technologies for assessment of bacterial metabiome in petroleum-
526
Synthesis of Sustainable Construction Materials with Microbial Carbonate Binders
543
Unleashing the role of uncultured bacteria in 2,4-dichlorophenol degradome
544
Use of PCR-DGGE based molecular methods to assessment of microbial diversity during anaerobic
treatment of antibiotic combinations
545
Session 10: Biotechnologically relevant enzymes and proteins
546
An Input-Output Linearizing controller for producing Angiogenin from E.coli
Anthracene biodegradation by filamentous fungi
Bioactive products produced by Actinomycetes from Amazon soil
Bioprospecting for cellulose-degrading fungi in the Brazilian savannah.
Biotechnological properties of chitinases of Shewanella basaltis strain isolated from the marine
environmental
Canola meal as alternative substrate for -glucosidase production by Trichoderma viride: potential of
the crude extract for biomass saccharification
Characterization of recombinant laccase (BPCotA) from Bacillus pumilus MK001 and its potential
for phenolics degradation
Class I and class II hydrophobins from filamentous fungi isolated from banana rachis in Colombia.
XVII
XVIII
547-548
549
550
551
552
553
554
555
Cloning, expression and culture optimization of a dihydrolipohyl dehydrogenase with Diaphorase
activity from Bacillus spharicus PAD in E.coli
Covalent immobilization of new D-aminoacylase and characteristics of obtained preparation
Effective and low-cost saccharification of pineapple peel by Trichoderma viride crude extract with
enhanced levels of -glucosidase activity
Engineering, screening and selection of catalytically superior Cyathus bulleri laccase variants in
Pichia pastoris
Enhanced Pectinases Synthesis from Two Fungus of Soil
Enhancement of the catalytic activity of ferulic acid decarboxylase and trans-anethole oxygenase by
genetically engineered Escherichia coli BL21 (DE3)
Enzymatic synthesis of caffeic acid phenethyl ester catalyzed by crude extracts with chlorogenate
hydrolase activity
Evolution of group I introns and homing endonucleases among closely related Coccomyxa
phycobionts
Expression and characterization of novel DNA polymerase from Geobacillus sp. Strain SK72
Heterologous expression and application of enzymes in the pulping industry
Immobilization of the human enteropeptidase light chain on bead cellulose particles
Impact of copper sulphate on oxidoreductive lignin-modifying enzymes and polyphosphate produced
by Trichoderma harzianum isolated from mangrove sediment
Isolation and screening of lipase-producing endophytic fungi
Isolation, characterization and gene expression of two -xylosidases from Humicola grisea var.
thermoidea by Pichia pastoris
Keratinolytic proteinase from Bacillus pumilus AD-W with promising peptide-production activity
Kinetics Properties of Marine Chitinase from Novel Red Sea Strain of Bacillus
Laccase isozymes from Ganoderma lucidum MDU-7: biochemical characterization, catalytic
properties and differential role during oxidative stress
LAGLIDADG homing endonucleases encoded within the chloroplast psbB gene from lichen
phycobionts
Metabolic and physiological biodiversity of actinomycetes isolated from saline soils of Melghir
(Algeria)
Metagenomic mining for novel thermostable -transaminases
Mutagenesis of soluble methane monooxygenase (sMMO) from Methylosinus trichosporium OB3b
Partial characterization of the cellulolytic enzyme produced by Filamentous Fungi
Phylogenetic, three-dimensional and docking analyses of an endo--(1-6)-D-galactanase from
Colletotrichum lindemuthianum and genes of the Colletotrichum sp.
Production of extracellular amylase in Bacillus subtilis under mild stress condition of certain
antimicrobials
Production of L-phenylalanine by a coupled enzymatic system of aminotransferase and aspartase
from Erwinia carotovora
Production of lipase by Cunninghamella echinulata (SIS 37) through Factorial Design
Production of recombinant human enterokinase light chain by methylotropic yeast Pichia pastoris
Protease production using fish waste as a substrate
Protein display in Caulobacter crescentus - adapting the Surface layer for human therapeutic
applications
REALCAT: Advanced high throughput bio(chemical)technologies platform for biorefineries hybrid
catalysts design
Response surface methodology to optimize partition and purification of two recombinant
oxidoreductase enzymes in aqueous two-phase systems
Superoxide Dismutase Activity as an Adaptative Response to Cadmium Stress in Aspergillus
nidulans
Synthetic homodimer of GEOker keratinase for efficient biodegradation of keratin by-products
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
The enzymes of extremophilic halophiles involved in conversion of waste glycerol to valuable
compounds: glycerol carbonate (GlyC) and glycidol (GlyD)
Thermoascus aurantiacus RCKK: a potential source of thermostable biomass hydrolyzing enzymes
589
Session 11: Microbial production of high-value products: drugs, chemicals, fuels, electricity...
591
Aerobic degradation as a pre-treatment for anaerobic digestion of the organic fraction of municipal
solid waste (OFMSW)
Analysis of antimicrobial compounds in algae
Assessment of polyhydroxyalkanoate production from VFAs generated via acidogenic fermentation
of poultry manure
Biobutanol production of strain Clostridium beinjerinckii using cassava wastewater and glucose as
substrate
Bioemulsifier production by yeast isolated from soil contaminated with diesel oil
Bioprospecting Colombian native bacteria for the transformation of pentoses and hexoses into ethanol
Biosynthesis of polyhydroxyalkanoates by a mixed bacterial culture from aromatic hydrocarbons
Biosynthesis of silver nanoparticles by Pseudomonas rhodesiae
Characterization of halophilic bacteria with biotechnological application isolated from Salt Mine at
Zipaquirá, Colombia
Chitin, chitosan and biosurfactant production by Cunninghamella phaeospora using agroindustrial
wastes
Comparation of biosurfactant production between wild-type and recombinant strain using crude
glycerol
Comparative transcriptome analyses of Pseudomonas putida KT2440 during PHAs synthesis
Engineering of a thermoanaerobe for macroalgal carbohydrate utilization
Evaluation of C/[NP] ratio on mesophilic anaerobic digestion
Fatty acids profile produced by Yarrowia lipolytica ATCC 8661
Formation of secondary structures of cry11 genes from Bacillus thuringiensis in DNA shuffling
conditions: an experimental and computational approach
Genetic studies of orf12: a gene of unknown function involved in the biosynthesis of clavulanic acid
in Streptomyces clavuligerus
Investigation of neutral lipid production by Synechocystis PCC6803 and Scenedesmus sp.
Knowing bioprospecting resources in aquatic environments of Colombian Orinoquía. Special case of
Actinobacteria in Guaviare River
Lignocellulolytic enzymes production by cultivation of Pleurotus Ostreatus on paper mill sludge
Low-cost production of biosurfactant by Cunninghamella phaeospora using agro-industrial wastes
Metabolic engineering of Saccharomyces cerevisiae for the production of avenanthramide analogous
endowed with bioactive properties
Microalgae as a source of Value added products
Microbial consortium converting polish lignite into methane
Microbial diversity of saline environments: Looking for cytotoxic compounds
Microbial teamwork: concerted hydrolysis of cellulose using surface displayed cellulases on
Pseudomonas putida
Modeling BCAA’s metabolic pathway and knockout prediction improving the production of
surfactin, a biosurfactant from Bacillus subtilis
Molecular characterization and metabolic potential of rhizobacterial strain isolated from saffron soil
rhizosphere
Molecular mechanisms for sensing and responding to electrode potentials in Shewanella oneidensis
MR-1
Optimization of the medium components in biosurfactant production by Mucor circinelloides UCP
001 with response surface methodology
Overflowing Continuous Cultures: a way to manage excess of foaming during the production of
592
XIX
XX
590
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620-621
622
623
surfactant in reactors
Pathway-specific Regulation of the Biosynthesis of Nosiheptide
Pediococcus acidilactici PD3 – an unexpected producer of lactic acid from inulin
Production and optimization of extracellular invertase from a novel fungal strain via solid state
fermentation
Production and preliminary characterization of biosurfactant produced by Mucor circinelloides UCP
001 in alternative medium
Production of chitin, chitosan and biosurfactant by Cunninghamella phaeospora through submerged
fermentation using water soluble substrates
Production of value-added chemicals from biomass through microwave followed by microbiological
fermentation
624
625
626
627
628
629
$
!
!
$
5
*
!!
!
<
-
!
"$8!!S7
$
!!
!
;
!
;!
!
*''0:
Ricotta whey medium for production of biosurfactant by Pseudomonas aeruginosa
630
RSM for production of levan by Bacillus licheniformis in high sucrose medium
631
Synthesis of prebiotic, galacto-oligosaccharides using cell bound -galactosidase of Kluyveromyces
marxianus NCIM 3465
632
The preparation of constructs for secretome pathway study in yeast Candida utilis
633
Valorization of heavy vacuum gas oil via bioupgrading and bioconversion to biosurfactants by
Pseudomonas aeruginosa AK6U
634
Whole cell biotransformation system for synthesis of alkyl-glycosides and fructo-oligosaccharides
635
Session 12: Methods and technology development
636
A synthetic bacterial regulatory circuit to detect protein-protein interactions in vivo with single
molecule sensitivity
A way to improve the viability of encapsulated Bifidobacterium longum 51A in order
to reach the intestinal tract
An improved method for extracting DNA from Cryptosporidium oocysts using immunomagnetic
separation and surfactant extraction treatment
Application of Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in
Pseudomonas aeruginosa isolates derived from aquatic environments of Greece
Bioreactor dynamic modelling and control in a decentralized wastewater treatment plant with spectral
online monitoring
Comparative studies of ion exchange chromatography and yeast application for desalting fibersol-2
Comparison of various DNA extraction methods for Fusarium solani detection and enumeration with
real-time PCR
Conductive capsules for culture and screening of electroactive bacteria
Consequences of gene and cluster translocation on their expression in Streptomyces albus J1074
Development of a high throughput cell-free metagenomic screening platform
Emerging nano-platforms based on thermostable archaeal viruses
High Resolution Melting (HRM) Analysis coupled with Spectral Angular Distance as a high
throughput tool to screen large number of environmental samples for changes in bacterial community
structure.
High-throughput Screening of Molecular Binders using Novel Intracellular Particle Display System
Initial findings on the efficiency of a non-thermal “Plasma Bullets” experimental design for the
disinfection of contaminated surfaces
Looking for alternative methods for bacteria monitoring in aquatic environment
Mass degradation to reduce cytotoxic products as an individual behavior-rule embedded in a
microbial model for the study of the denitrification process
Microbes auxotrophic for unnatural amino acids: a novel biological containment system
Microcapsule preparation of essential oil of Lippia intergrifolia and its application on peanut seed
637
638
639
640-641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
XXI
..
.0
.3
.4
..:
..
..
Introduction
Going "single-molecule" and "single-cell": study of microbial biology using super-resolution
techniques
This book contains a selection of the abstracts that were accepted for presentation at the VI International
Conference on Environmental, Industrial and Applied Microbiology (BioMicroWorld2015), which was
held at the beautiful Historic Building of the University of Barcelona (UB), in Barcelona, Spain, during
October 28th – 30th 2015.
High-throughput (next-generation) sequencing
Interactions of microbial pathogens with host cells and processes
Metagenomics: complex microbial communities (soil, human body, ocean water...)
Microarrays in microbiology
BioMicroWorld (which evokes the concept/image “biological microscopic world”) is a well-established
forum that has brought together researchers in the applied microbiology field every two years since 2005.
This forum is aimed at communicating current progress in the fields of environmental, industrial, food, or
medical microbiology, as well as in microbial biotechnology or technology development. Being a truly
international meeting (with all editions having been attended by researchers from more than 40 countries),
it also aims at serving as an instrument for building bridges to strengthen global collaborations in many
microbiological issues that are global in nature.
Microbe-metal interactions in the environment
Microbial biosensors
Microbial diversity: uncultivated microorganisms
Microbial life of the rhizosphere (the below-ground parts of plants) and phyllosphere (the aerial parts
of plants)
"Microbial oceanography": dynamics of marine microbial communities and their global impact
The organization called for research papers dealing with the following topics:
Microbial Source Tracking (MST) and water quality
Core Topics - General Sessions
Agriculture, soil, forest microbiology
Microbial surfaces and envelopes
Microbial subversion or evasion of host cell pathways
Molecular mechanisms of antimicrobial resistance
Environmental, marine, aquatic microbiology. Geomicrobiology
New antibiotics with no or weak selection for resistance and antibiotics alternatives
Parasite biology
Industrial microbiology
Medical, veterinary and pharmaceutical microbiology
Plant pathogens and the need of a global increase of food production: understanding the relationship
between bacterial, viral and eukaryotic filamentous pathogens and their plant hosts
Antimicrobial agents and chemotherapy. Antimicrobial resistance
Quantitative microbiology. Bioinformatics
Microbial physiology, genetics, evolution and adaptation
Quorum sensing
Biofilms
Rapid microbiology of food-borne pathogens
BBB - Biodeterioration, Biodegratation, Bioremediation
Simulation of the microbial micro-environment through modern micro-scale engineering
Biotechnologically relevant enzymes and proteins
Structural vaccinology: structure-based design of vaccines
Microbial production of high-value products: drugs, chemicals, fuels, electricity...
Synthetic (micro)biology and microbial engineering: technological developments and applications
Methods and technology development
Systems (micro)biology
The human microbiome: structure, function, and relevance in important human diseases
Some other hot topics
Viral pathogenesis
Analytical and imaging techniques
Antimicrobial surfaces
The following people formed the organizing and the international scientific advisory committees of the
conference.
Antiseptics and disinfectants
Attenuation of virulence as "antimicrobial" strategy
Organizing Committee
Bacterial polymers: biosynthesis, modifications and applications
Bacterial stress responses in biotechnological and environmental applications
Bacterial toxins
Biocontrol by bacteriophages
A. Méndez-Vilas, Formatex Research Center, Spain
(General Coordinator)
J. A. Mesa González, Formatex Research Center,
Spain
A. Solano Martín, Formatex Research Center, Spain
(General Coordinator)
E. Torres Hergueta, Formatex Research Center, Spain
J. Mesa González, Formatex Research Center, Spain
Biosecurity and microbial forensics: awareness, prevention, preparedness, detection, response and
recovery
Cellular microbiology
Exploiting fungi in bioremediation
XXIII
XXIV
International Scientific Advisory Committee
Ki Jun Jeong, Korea Advanced Institute of Science
and Technology (KAIST), South Korea
María del Mar Jiménez Gasco, The Pennsylvania
State University (PSU), USA
Howard Junca, Nueva Granada Military University
(UMNG) & CorpoGen, Colombia
Ece Karatan, Appalachian State University (ASU),
USA
Joseph Kreit, Mohammed V University, Morocco
Tino Krell, Experimental Station of El Zaidin (CSIC),
Spain
Kyoung Lee, Changwon National University (CNU),
South Korea
Seyed Abbas Shojaosadati, Tarbiat Modares
University, Iran
Raeid M. M. Abed, Max-Planck Institute for Marine
Microbiology (MPI Bremen), Germany
Sergio Alarcón, Rosario Chemistry Institute (IQUIRCONICET), Argentina
Itziar Alkorta, University of the Basque Country
(UPV/EHU), Spain
Vasu Appanna, Laurentian University, Canada
Elisabet Aranda, Water Researcher Institute,
University of Granada (UGR), Spain
Juan Arbiza, University of the Republic (UdelaR),
Uruguay
Juan A. Ayala, Center for Molecular Biology Severo
Ochoa (CSIC-UAM), Spain
Raquel Martín-Sampedro, National Institute for
Agricultural and Food Research and Technology
(INIA), Spain
Jose Luis Martínez, National Center for
Biotechnology (CNB), CSIC, Spain
Joan-Miquel Balada-Llasat, The Ohio State
University Wexner Medical Center (OSUWMC), USA
Petr Baldrian, Institute of Microbiology, Academy of
Sciences of the Czech Republic (CAS), Czech
Republic
Virginia Martínez, The Novo Nordisk Foundation
Center for Biosustainability (CFB), Technical
University of Denmark (DTU), Denmark
Magdalena Martínez Cañamero, University of Jaén,
Spain
Egon Bech Hansen, National Food Institute, Technical
University of Denmark (DTU), Denmark
Ana Beloqui Elizazu, Karlsruhe Institute of
Technology (KIT), Germany
Luis Martinez-Sobrido, University of Rochester
Medical Center, USA
Alexis Mendoza-León, Central University of
Venezuela (UCE), Venezuela
P. N. Bertin, University of Strasbourg, France
Yves Blache, University of the South Toulon-Var
(UTLN), France
Luis Menéndez Arias, Center of Molecular
Biology Severo Ochoa (CSIC - UAM), Spain
Manuel Montalbán-López, University of Groningen,
The Netherlands
Sonia Borrell, Swiss Tropical and Public Health
Institute, University of Basel (UNIBAS), Switzerland
Théodore Bouchez, National Research Institute of
Science and Technology for Environment and
Agriculture (IRSTEA), France
Miguel A. Moreno, VISAVET Health Surveillance
Centre, Complutense University of Madrid, Spain
Rosario Muñoz, Institute of Food Science,
Technology and Nutrition (ICTAN - CSIC), Spain
Gilda Carvalho, New University of Lisbon (UNL),
Portugal
Atilio Pedro Castagnaro, Institute of Agro-Industrial
Technology of Northwestern Argentina (ITANOA),
CONICET-EEAOC, Argentina
Marcia Nitschke, University of Sao Paulo (USP),
Brazil
George Nychas, Agricultural University of Athens
(AUA), Greece
Adrian Oehmen, New University of Lisbon (UNL),
Portugal
Grazyna Palamarczyk, Institute of Biochemistry and
Biophysics, Polish Academy of Sciences, Poland
Felipe Cava, Laboratory for Molecular Infection
Medicine (MIMS), Umeå University, Sweden
Ana M. Cerdeño-Tárraga, European Bioinformatics
Institute (EMBL-EBI), United Kingdom
Yijun Chen, China Pharmaceutical University (CPU),
China
Yusuf Chisti, Massey University, New Zealand
Samuel Cirés, James Cook University (JCU),
Australia
Rolf Daniel, Georg-August University Göttingen,
Germany
Willem M. De Vos, Wageningen University and
Research Centre (WUR), The Netherlands
Lorenzo Pastrana, University of Vigo, Spain
Roshan Paul, Hohenstein Institute, Germany
Manuel Pinelo, Technical University of Denmark
(DTU), Denmark
Lucía Pita, GEOMAR - Helmholtz Centre for Ocean
Research Kiel, Germany
Maria Prado Alvarez,, University College Cork,
Ireland
Beatriz Prieto Simon, University of South Australia,
Australia
Danilo Ercolini, University of Naples Federico II
(UNINA), Italy
Anil Kumar Puniya, College of Dairy Science &
Technology, Guru Angad Dev Veterinary & Animal
Sciences University, India
Pei-Yuan Qian, Hong Kong University of Science and
Technology (HKUST), Hong Kong
Svetlana Ermolaeva, Gamaleya Institute of
Epidemiology and Microbiology, Russian Academy of
Medical Sciences (RAMS), Russia
Maria Leonor Faleiro, The University of Algarve
(UAlg), Portugal
Maria Reis, New University of Lisbon (UNL),
Portugal
Peter Richard, VTT Technical Research Centre of
Finland, Finland
Stefano Fazi, Water Research Institute, National
Research Council (IRSA - CNR), Italy
Dolores Fernández Ortuño, The Institute for
Mediterranean and Subtropical Horticulture La
Mayora (IHSM-University of Málaga-CSIC), Spain
Jorge Rodríguez, Masdar Institute of Science &
Technology, United Arab Emirates (UAE)
Alexandro Rodríguez Rojas, Freie Universität Berlin,
Germany
Simona Rossetti, Water Research Institute, National
Research Council (IRSA-CNR), Italy
Lucía Gallego, University of the Basque Country
(UPV/EHU), Spain
Alessandra J. Garcés da Silva, Central University of
Venezuela (UCE), Venezuela
Badal C. Saha, National Center for Agricultural
Utilization Research (NCAUR), United States
Department of Agriculture (USDA), USA
Paula García Fraile, Institute of Microbiology,
Academy of Sciences of the Czech Republic (CAS),
Czech Republic
Frédéric Gaspar, Institute of Chemical and Biological
Technology (ITQB), Portugal
Gholamreza Salehi Jouzani, Agricultural
Biotechnology Research Institute of Iran (ABRII), Iran
Eduardo Santero Santurino, Pablo de Olavide
University (UPO), Spain
Bernhard Schink, University of Konstanz, Germany
Martin Senz, Research Institute for Biotechnology and
Water in Berlin, Germany
Marta Ginovart, Polytechnic University of Catalonia
(UPC), Spain
Giorgio Giraffa, Research Centre for Forage and
Dairy Productions (CRA - FLC), Italy
Roland J. Siezen, Radboud University Medical Centre
(RUNMC), The Netherlands
Giuseppe Spano, University of Foggia, Italy
James Gomes, Indian Institute of Technology Delhi
(IIT Delhi), India
Malka Halpern, University of Haifa, Israel
Jordi B. Torrelles, The Ohio State University Wexner
Medical Center (OSUWMC), USA
Anna Trusek-Holownia, Technical University of
Wroclaw, Poland
Enrique Herrero Acero, Austrian Centre of Industrial
Biotechnology (ACIB), Austria
Marc Heyndrickx, Institute for Agricultural and
Fisheries Research (ILVO), Belgium
Mark Turner, The University of Queensland (UQ) &
Queensland Alliance for Agriculture and Food
Innovation (QAAFI), Australia
Marie-Joëlle Virolle, University Paris-Sud, France
XXV
Jean-Luc Jany, University of Brest (UBO), France
XXVI
Karola Vorauer-Uhl, University of Natural Resources
and Life Sciences (BOKU), Austria
Igor B. Zhulin, University of Tennessee (UT), USA
Jobsinlifesciences.com, an online job board specifically focused on the Life Sciences industry. It
acted as media sponsor.
Sergey Zotchev, Norwegian University of Science and
Technology (NTNU), Norway
This sixth edition gathered around 530 participants, who came from nearly 70 countries, that presented
about 581 works (from the nearly 800 submitted initially). These figures confirm BioMicroWorld as a
stable medium-sized meeting in its field.
In addition to the regular contributions, we were proud to have the following distinguished invited
researchers speaking as plenary lecturers:
Joana Azeredo (CEB-UM, Portugal), who talked about “The “Hide and Seek Game” played by
biofilms and bacteriophages”.
SIRE Life Sciences, a recruitment & executive search consultancy dedicated exclusively to the
European Life Science industry. It acted as media sponsor.
The formal proceedings of the meeting, featuring some full papers of works presented during the
conference, will be released as a book titled "Microbes in the spotlight: recent progress in the
understanding of beneficial and harmful microorganisms". This book will be published by BrownWalker
Press (Boca Raton, FL, USA), which will ensure an adequate international distribution and availability.
We hope attendants and readers in general will find the content of this book of abstracts interesting,
inspiring and useful and we look forward to seeing another fruitful edition of the conference in 2017.
Hermann J. Heipieper (UFZ, Germany), who talked about “Marine hydrocarbonoclastic bacteria
and their capabilities to bioremediate marine oil spills: Functional Genomics, Physiology,
Biochemistry”.
Ali Karami (Baqiyatallah University of Medical Sciences, Iran) who talked about
“Molecular detection and identification of microbial infections: methods and kits”.
Christophe Lacroix (ETH Zürich, Switzerland), who talked about “Integrated multi-scale strategies
to investigate nutritional compounds on the gut microbiota and host health: A story of iron”.
Angel M. Ramos (UCM, Spain), who talked about “Be-CoDiS and Be-FAST: Mathematical models
to predict the spread of human and livestock diseases with real data. Application to the 2014-15
Ebola Virus Disease epidemic and livestock diseases”.
A. Solano Martín
General Coordinator
Formatex Research Center
C/Zurbarán 1, Planta 2, Oficina 1
06002 Badajoz
Spain
A. Méndez-Vilas
General Coordinator
Formatex Research Center
C/Zurbarán 1, Planta 2, Oficina 1
06002 Badajoz
Spain
A practical workshop dealing with the currently active research topic of mathematical/computational
modeling in microbiology, titled "Modelling bacterial dynamics using the R software", was held during
the conference. The aim of this workshop was to provide participants with an excellent opportunity to
learn the statistical approaches to fit non-linear models for the characterisation of bacterial kinetics. The
workshop was chaired by Ursula Gonzales-Barron and Vasco Cadavez (Polytechnic Institute of Braganza,
Portugal).
The following companies had a role in the conference:
Source BioScience, a trusted provider of state of the art laboratory services and products to the
healthcare and clinical, life and applied sciences and biopharma industries. It exhibited at the
conference.
Pyro Science, a manufacturer of high-precision optical oxygen sensors. It sponsored the conference.
Computational and Structural Biotechnology Journal (CSBJ), an Elsevier online journal, placing
a strong emphasis on functional and mechanistic understanding of how molecular components in a
biological process work together through the application of computational methods. It acted as media
sponsor.
XXVII
XXVIII
PLENARYLECTURES
Marine hydrocarbonoclastic bacteria and their capabilities to bioremediate marine
oil spills: Functional Genomics, Physiology, Biochemistry
The “Hide and Seek Game” played by biofilms and bacteriophages
H. J. Heipieper
J. Azeredo, D. P. Pires, L. D. R. Melo, D. Vilas Boas, and S. Sillankorva
Department of Environmental Biotechnology, Helmholtz Centre for Environmental Research-UFZ, Permoserstrasse 15,
04318 Leipzig, Germany
CEB – Centre of Biological Engineering, LIBRO – Laboratório de Investigação em Biofilmes Rosário Oliveira, University
of Minho, 4710-057 Braga, Portugal
Marine oil contaminations received public awareness due to the ongoing discussions of the environmental
catastrophes of the Exxon Valdez tanker in Alaska in 1989, the Prestige tanker at the Spanish coast in 2002, and
especially after the Deepwater Horizon oil spill in 2010 where about 700,000 tons of crude oil were released into
the Gulf of Mexico. Here and in other marine environments polluted by crude oil, a special group of Gramnegative, gamma-proteobacteria named marine hydrocarbonoclastic bacteria were detected as key players in
bioremediation [1]. These bacteria can only metabolize a few organic acids (acetate, pyruvate), and feed on a
variety of aliphatic hydrocarbons instead. Several of these extraordinary marine bacteria such as Cycloclasticus
sp., Marinobacter sp., Thalassolituus sp., Neptunomonas sp., Oleiphilus sp., Oleispira sp. and Alcanivorax sp.
have been discovered in the sea all over the world always occurring in very small abundance. In case of an oil
spill, however, they show a kind of bloom and can represent up to 80-90 % of the bacterial community [2].
Biofilms constitute an important survival strategy for microorganisms, and therefore are ubiquitous in the
environment, being involved in many chronic and difficult to treat infections. Bacteriophages (phages), as natural
predators of bacteria, have evolved and found routes to successfully reach and kill their hosts within the biofilm
structure. On the other hand, the biofilm phenotype confers protection to phage predation. In this talk, the
backstage of the “hide and seek game” played by phages and bacteria within biofilms will be shown by providing
a description of the biofilm features that hinder phage interaction with the host as well as the mechanisms used
by phages to interact with biofilms.
Key words: phage, biofilm, matrix, infection, lysis
Among the marine hydrocarbonoclastic bacteria, the mesophilic Alcanivorax borkumensis and the psychrophilic
Oleispira antarctica are the best investigated species. The functional genomics of both bacteria were
characterised [3,4]. In addition, detailed physiological studies regarding the adaptive strategies to their aliphatic
substrates as well as to environmental stress conditions were carried out [4,5].
These investigations revealed the enormous adaptive potential of marine hydrocarbonoclastic bacteria regarding
catabolic genes, cell surface modifications, incorporation of fatty acid intermediates into membranes and
regulation of several stress response genes.
Acknowledgements This work was partially supported by a collaborative project (BACSIN, Contract No. 211684) of the
European Commission within its Seventh Framework Programme.
Keywords: oil spill, marine hydrocarbonoclastic bacteria, bioremediation, adaptation
References
[1] Hazen et al. 2010. Deep-sea oil plume enriches indigenous oil-degrading bacteria. Science 330:204-208.
[2] Yakimov et al. 2007. Obligate oil-degrading marine bacteria. Curr. Opin. Biotechnol. 18:257-266.
[3] Schneiker et al. 2006. Genome sequence of the ubiquitous hydrocarbon-degrading marine bacterium Alcanivorax
borkumensis. Nature Biotechnol. 24:997-1004.
[4] Kube et al. 2013. Functional genome analysis of Oleispira antarctica RB-8, a key oil-degrading bacterium in cold and
deep marine environments. Nature Commun. 4:2156.
[5] Naether et al. 2013. Adaptation of hydrocarbonoclastic Alcanivorax borkumensis SK2 to alkanes and toxic organic
compounds - a physiological and transcriptomic approach. Appl. Environ. Microbiol. 79:4282-4293.
XXIX
XXX
Integrated multi-scale strategies to investigate nutritional compounds on the gut
microbiota and host health: A story of iron
Molecular detection and identification of microbial infections: methods and kits
Ali Karami
C. Lacroix
Research Centre of Molecular Biology, Baqiyatallah University of Medical Sciences, Iran
Laboratory of Food Biotechnology, Department of Health Science and Technology, ETH-Zurich, Schmelzbergstrasse 7,
Zürich, Switzerland.
Detection and identification of microbial agents is important step for accurate diagnosis of infectious diseases for
treatment or prevention from spread to the society. Classical methods like culture, subculture, biochemical,
immunological or other typing process are very time consuming, labor intensive, expensive and results are
presented very late for the physician or the patient. There have been tremendous efforts to develop new rapid
detection methods for microbial agents specially by indirectly analyzing antibodies to the agents or directly
detection specific antigens by serological methods. But with advances in Molecular understanding of microbial
molecules specially DNA, RNA and proteins and more importantly having rapid genome sequence of infectious
agents it hase been great progress in developing new fast detection and identification methods. Molecular
Methods like PCR and its derivatives like nested PCR, Real time PCR, RFLP, AFLP, next generation sequencing
and development of isothermal PCR, micro fluidic DNA amplification methods, hybridization techniques,
Microarray, DNA chips, Protein Chips, lab on a chips and rapid immunological kits (lateral flow ) on the base of
monoclonal antibodies for rapid screening of field and environmental samples are few examples of these
technologies.
The gut is home to a complex ecosystem made of innumerable different bacteria, harbouring over 3 million
genes which is about 100 fold the coding capacity of our own genome. Scientists are only beginning to map this
largely uncharted territory with the goal of improving health and well-being and gaining understanding of many
chronic diseases. The human gut microbiota composition and metabolic activities are impacted by the diet and
reciprocally, host metabolism and metabolites also interact with the gut microbiota and diet shaping a complex
interaction network driving gut health [1]. Evidence of microbial perturbations and even dysbiosis of the human
gut microbiota have been reported for many diseases and disorders including diabetes, malnutrition and obesity.
It is, therefore, crucial to better understand the relationships between host, diet and the gut microbiota, starting by
investigating the specific effects of the main components of the diet.
Iron (Fe) deficiency is one of the most common nutritional deficiencies affecting especially children and women
in developing countries. Therefore, WHO recommends as a counteracting strategy either Fe supplementation of
vulnerable groups or Fe fortification of staple foods. However, Fe is poorly absorbed and 90-95% of ingested Fe
passes into the colon where it can interact with the gut microbiota. Fe is a key co-factor in many enzymatic
reactions and is necessary for most organisms including commensals of the gut and enteric pathogens. However
the effects of Fe deficiency and supplementation on gut microbes and gut health are not well characterized. Fe
supplementation or fortification studies have reported an increase in infectious diseases including gastrointestinal
disease symptoms such as diarrhea and dysentery. Therefore, concerns have been raised about the safety of
untargeted Fe supplementation at high doses especially in areas with an increased infectious disease burden.
There are numerous instruments and kit based methods developed for this purpose even personal detection
systems, mobile labs and central reference laboratories are looking for rapid and even ultra rapid detection
methods.
Even there are remote sensing detectors in military to detect presence of microbial agents from far distances this
is applicable in biodefense and national security.
In this presentation I will introduce latest development in the field of simple, rapid and ultra Rapid detection and
Identification methods for microbial photogenes in the world of infectious diseases.
There is still a limited understanding of the mechanisms underlying the effects of unbalanced microbiota. We
developed integrated multi-scale strategies involving combination of advanced in vivo and in vitro studies in a
systematic approach to elucidate the complex effects and mechanisms of nutritional compounds on gut
microbiota and host health [2]. In this presentation the application of strategy and novel tools will be illustrated
for the elucidation of mechanisms of dietary iron on the gut microbiota of infants and inflammation of humans
living in different environment. Our data from in vitro (continuous colonic fermentation and cellular) and in vivo
(conventional and gnotobiotic rats) models of Fe deficient diet and human studies suggest that Fe
supplementation is safe in environment with low infectious disease. Furthermore iron resulted in increased
activity of the gut microbiota and energy extraction from the diet, as shown by enhanced production of short
chain fatty acids, especially butyrate, during iron repletion. In contrast Fe supplementation of infected and
malnourished infant in Africa resulted in promotion of enteropathogens and inhibition of beneficial bacteria,
exacerbated existing gut inflammation, and interacted with pathogen virulence. From our research, safer iron
supplementation strategies for infants in developing countries were designed. This includes the formulation of
multi-nutrient supplements targeting both gut health and iron sufficiency, and the screening and development of
novel strains of bifidobacteria with high iron binding ability.
Keywords: gut microbiota, dietary iron, models, host interaction, pathogens, inflammation
References
[1] Chassard, C., Lacroix, C. 2013. Carbohydrates and the human gut microbiota. Curr. Opin. Clin. Nutr. Metab. Care
16:453-460.
[2] Lacroix, C., de Wouters, T., Chassard, C. 2015. Integrated multi-scale strategies to investigate nutritional compounds
and their effect on the gut microbiota. Curr. Opin. Biotechnol. 32:149–155.
XXXI
XXXII
Be-CoDiS and Be-FAST: Mathematical models to predict the spread of human and
livestock diseases with real data. Application to the 2014-15 Ebola Virus Disease
epidemic and livestock diseases
Ángel Manuel Ramos
Department of Applied Mathematics, The Complutense University of Madrid, Plaza de Ciencias 3, 28040-Madrid, Spain
In this talk we will show recent works of our group regarding the mathematical modelling of epidemics and
applications to real cases.
We will present a first version of two new deterministic spatial-temporal epidemiological model, called BeFAST (Between Farm Animal Spatial Transmission) and Be-CoDiS (Between-Countries Disease Spread).
Be-FAST (Between Farm Animal Spatial Transmission) focuses on the spread of animal diseases between and
within farms. The major original ideas introduced by Be-FAST are the study of both within and between farms
spread, the use of real database and dynamic coefficients calibrated in time according to farms characteristics
(e.g., size).
Be-CoDiS is a mathematical model able to simulate the spread of a human disease. It is based on the
combination of an Individual-Based model (where countries are the individuals) simulating the between-country
interactions (here, people movement) and disease spread, with a compartmental model (ODEs) simulating the
within-country disease spread. The model coefficients are calibrated according to some country indicators (e.g.,
economic situation). The principal characteristic of our approach is the consideration of the following effects at
the same time: people movement between countries, control measure effects and dynamic coefficients fitted to
each country.
Agriculture, soil, forest microbiology
At the end of a simulation, both models returns outputs referring to outbreaks characteristics (e.g., epidemic
magnitude, risk areas, etc.).
We will show some results obtained with these models, when applying them to some real cases: classical swine
fever epidemics and foot and mouth disease real cases will be simulated with Be-FAST and the 2014-15 ebola
epidemic will be simulated with Be-CoDiS.
XXXIII
1
1-Aminocyclopropane-1-carboxylate deaminase producing bacteria promote wheat
growth under water stress
Nazneen Bangash1, A. Khalid2 and T. Mahmood2
!
1
!""#"$*;<=#">
Department of Biosciences, COMSATS Institute of Information Technology, Islamabad 46000,Pakistan
2
Department of Environmental Sciences, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi 46300,Pakistan
>=@*@=\@!*^"{|@}*=
\"@\@""="
} " "{ \ @ @}@ \ { ~! \ *= =" < @@ "
<=@{!"
\<={@@
{{{\@@<"
\@{{{{@
@@""*@
" " " @ " "@
{ \ @ @=" \ *= {@
\@
@@{@"=@\@@@}@*=
<@"\@@=@\@{@\"@
<"<=@={
Water is an extremely important factor in Barani region where agriculture is merely dependent on rain water.
Water stress has been conceived to produce higher concentration of ethylene which results in root growth
inhibition dramatically. Plant growth promoting bacteria possessing an enzyme 1-aminocyclopropane-1carboxylic acid (ACC) deaminase could promote plant growth by regulating plant ethylene levels under stress
conditions. To isolate such bacteria, rhizopshere soil was collected from three different sites of rainfed region.
On the basis of ability to grow on ACC-containing medium, 100 isolates with most efficient growth
characteristics were selected. Results revealed that some of the rhizobacterial strains significantly increased root
and shoot growth of inoculated plants. The 100 strains selected were again tested to assess their potential to
improve growth under water deficit conditions. When plants were grown at 30 and 15% water holding capacity
(WHC), ACC deaminase producing bacteria significantly increased root length by (35%), shoot length (62%),
number of lateral roots (33%), dry root weight (93.8%), dry shoot weight (100%) and total biomass (96.7%)
compared to uninoculated control. These results indicate that rhizobacteria isolated from barani area had the
potential to improve growth of wheat under water stress conditions.
Keywords: 1-aminocyclopropane-1-carboxylic acid; ethylene; rhizobacteria; water stress; wheat
"#>
2
3
"
$%&$
Agronomic evaluation in a greenhouse and farm level using AMF bio-fertilizers in a
Colombian grooseberry crop (Physalis peruviana L.)
%'!
$
(')
*(+,
%
M. M. Ramírez-Gómez1, D. P. Serralde-Ordoñez, A. M. Peñaranda-Rolón1, U. A. Pérez-Moncada1 and G.
Roveda-Hoyos2

|#>@!""^=@|""!!
^"

\|"\@"@
\}
1
Corporación Colombiana de Investigación Agropecuaria – CORPOICA. Kilometro 14 Vía Mosquera. Colombia South
America
I.A. PhD.
2
@""@"@"*@\@@@*@"
="@"^"{=<"
@=*="~!
<" @ = =<{ @ * " @ <" @ " @
"=@=@"""""
@ ={ < "*= @< * " @\ @ *"{ | @ #@ ^" \ "\="{"=@>!@@\
=@@"*={\<@="@>@\
@\@@ "*={@"*=\<
"*=<<@"@"=""\@
<"*={
"#=<"
In few years Physalis peruviana L., went from being a wild specie with a local interest, to be the most promising
and successful fruit in international markets, achieved in recent years the second fruit exported from Colombia.
This commercial condition has increased the cultivated area and regions where this specie is planted, which is a
challenge for producers to reach competitive and sustainable crops. In that way, Corpoica has develop research
programs, focused on finding technologies that improve crop production maintaining the fruit quality. This
program had included the use of AMF bio-fertilizers as an alternative to improve plant develop using less
chemical fertilizers. Through strategies such AMF inoculation, plants have been able to increased nutrients
transport and absorption, reducing production costs and the risk of environmental pollution due to chemical
fertilizers waste.
Four inoculums with different AMF genera contents were evaluated in order to determinate, which is/are a
promissory inoculum to Physalis agronomical develop. One inoculum has a major spore content of Acaulospora,
two more has predominance of two different strains of Glomus and the last one has two genders, Glomus and
Acaulospora. Agronomical values of a greenhouse plant develop were determinate and compare the effect of
those inoculums with control plants. Finding that early inoculation allows a better root and foliar area develop.
Plant had better nutrient and water uptake beyond the plant rhizosphere exceeding the nutrients depletion zone.
Due to the symbiotic association with AMF, plant inoculated with AMF had about 25% more radical volume and
30% more foliar area than control plants, even more than plants treated with 100% of conventional fertilization.
It means that if results are similar or superior in terms of foliar and root development with AMF plus half of
chemical fertilization, the symbiotic association allow us to replace at least 50% chemical fertilization in
greenhouse stage.
Three of those inoculums were evaluated in a gooseberry producer farm, finding that plants inoculated with AMF
had the same development within them and with control (100% of chemical conventional fertilization). It suggest
that there is not specification in genera in terms of symbiotic establishment between Physalis peruviana and
Glomus and/or Acaulospora. In production terms is important to highlight that treatments inoculated and not
inoculated, had not significant differences, although production was almost 15% Kg/ha higher in AMF
inoculated plants. The fruits with quality for exportation were similar using AMF and 100% of chemical
fertilization, which is a condition to establish that AMF inoculation, allows 50% less chemical fertilization.
Keywords: Arbuscular Michorizal Fungi (AMF); Physalis peruviana, groosberry
4
5
Altruistic model of microbe-plant symbiosis: a conduit for constructing the highly
effective N2-fixers for crop inoculation
$0)%LR)HUWLOL]DWLRQLQJUHHQKRXVHVWDJHRQKLJKLQWHUHVWFRPPHUFLDOIRUHVW
VSHFLHVLQWKH&RORPELDQ&DULEEHDQUHJLRQ
N. A. Provorov, O. P. Onishchuk, O. N. Kurchak, E. P. Chizhevskaya and N. I. Vorobyov
'36HUUDOGH2UGRxH]005DPtUH]*yPH]$03HxDUDQGD5ROyQ8$3pUH]0RQFDGDDQG*
5RYHGD+R\RV
All-Russia Research Institute for Agricultural Microbiology. Podbelsky sh. 3, 196608 Saint-Petersburg, Russia
Mutualistic symbioses of plants with N2-fixing microbes often involve their differentiation into non-reproducible
cellular forms (bacteroids in Rhizobium/Sinorhizobium, multiple heterocysts in Nostoc, noncultivabe diazosomeharbouring cells in Azoarcus) which express the extremely high nitrogenase activities ensuring the effective N
supply for their hosts. In rhizobia, irreversible bacteroid differentiation occurs in the clonal endosymbiotic
populations after their releasing from extra-cellular compartments, Infection Threads (ITs) into intra-cellular
compartments, symbiosomes. Herein, bacteria are subjected to the attack by plant defence-like cysteine rich NCR
proteins which block the divisions of cells converted into N2-fixing bacteroids under control of BacA protein [1].
Using this genetically characterized symbiosis, we suggest the mathematical model of partners’ interaction
simulating the “altruistic” microbial impacts on the host fitness which are not compatible with the Darwiniantype natural selection models. Under the symbiotrophic conditions, microbeplant altruism may evolve in hostassociated rhizobial populations under the control of kin selection operating within the intra-nodular bacterial
clones functionally integrated with the plant signalling and metabolic systems.
&RUSRUDFLyQ&RORPELDQDGH,QYHVWLJDFLyQ$JURSHFXDULD±&2532,&$.LORPHWUR9tD0RVTXHUD&RORPELD6RXWK
$PHULFD
,$3K'
*PHOLQD DUEyUHD 5RE[ DQG 3DFKLUD TXLQDWD -DT DUH WKH PRVW VSUHDG VSHFLHV WR HVWDEOLVK FRPPHUFLDO
SODQWDWLRQV LQWKH&RORPELDQ&DULEEHDQUHJLRQEHFDXVHWKHILUVWRQH KDVDIDVWJURZWKDQG PXOWLSOH FUDIWXVHV
DQGWKHVHFRQGRQHKDVDKLJKTXDOLW\ZRRGWKHKLJKHVWYDOXHLQQDWLRQDOPDUNHW 5HVHDUFKEHWZHHQ&RUSRLFD
DQG3L]DQRDOORZVHOHFWDQGGHWHUPLQDWH$0)HIIHFWLYHVWUDLQVLQJUHHQKRXVHDQGWUDQVSODQWDWLRQVWDJHIRUWZR
IRUHVW VSHFLHV RI KLJK LQWHUHVW LQ WKUHH FRPPHUFLDO LPSRUWDQW ]RQHV RI WKH &RORPELDQ &DULEEHDQ 5HJLRQ
DSSUR[LPDWHO\RIFRVWSURGXFWLRQZHUHUHGXFHXVLQJ$UEXVFXODU0LFRUKL]DO)XQJL$0)ELRIHUWLOL]DWLRQ
$0)KDVWKHDELOLW\WRHVWDEOLVKDV\PELRWLFDVVRFLDWLRQZLWKDOPRVWRIWKHWHUUHVWULDOSODQWVWKH\DUHQRW
VSHFLILFLW\ZLWKDGHWHUPLQDWHKRVWZKDWHYHUQDWXUDODVVRFLDWLRQZLWKQDWLYH$0)LVDQDOWHUQDWLYHWRPDNHVXUH
RI WKH DVVRFLDWLRQ HIIHFWLYHQHVV ,Q WKDW ZD\ VRLO VDPSOHV LQ *PHOLQD DQG 3DFKLUD IRUHVW SODQWDWLRQ ZHUH
FROOHFWHG DQG DQDO\]HG LQ WHUPV RI V\PELRWLF YDULDEOHV QXPEHU RI VSRUHV SHU JUDP DQG SHUFHQWDJH RI URRWV
FRORQL]DWLRQ ILQGLQJ WKDW DOO VDPSOHV VKRZ URRW FRORQL]DWLRQ E\ WKH $0) DQG ILYH JHQHUD ZHUH WKH PRVW
FRPPRQ*ORPXVVSDVWKHRQHZLWKDPRUHGLYHUVLW\PRUSKRW\SHV7KRVHVDPSOHVZHUHPL[HGLQRUGHUWR
VWDEOLVKIRXUGLIIHUHQW$0)LQRFXOXPVDQGHYDOXDWLQJWKHPLQWZRVWDJHVJUHHQKRXVHDQGWUDQVSODQWDWLRQ7KH
UHVXOWVRIWKHELRORJLFDOWHVWZHUHVWUHQJWKHQHGZLWKDQHFRQRPLFDQDO\VLV
For simulating kin selection operating in microbe-plant systems we proceeded from the Hamilton inequality
kB>C where C is the reproductive Cost paid by the donors of altruism (in legume-rhizobia symbiosis, they are
represented by non-reproducible bacteroids fixing N2 within symbiosomes), B – reproductive Benefit obtained by
recipients of altruism (non-differentiated reproducible bacteria in ITs), 0<k1 – kin relatedness between donors
and recipients of altruism. We suggest that in the system composed of microsymbionts (m) and hosts (h), interspecies altruism is to be evolved if:
7KLVVWXG\DFTXLUHVLPSRUWDQFHQRWRQO\IRUHFRQRPLFDQGHQYLURQPHQWDOFRQWH[WIRUFRVWUHGXFWLRQKD
DQGSDUWLDOVXEVWLWXWLRQRIFKHPLFDO IHUWLOL]DWLRQ OHVVWKDQFRQYHQWLRQDOFKHPLFDO IHUWLOL]DWLRQ7KH $0)
LQRFXODWLRQSURGXFHQRXULVKSODQWVWKDWZHUHDEOHWRVXSSRUWVWUHVVVLWXDWLRQVW\SLFDORIWKH&DULEEHDQUHJLRQVXFK
KLJKOHYHOVRIKXPLGLW\DQGGURXJKWUHGXFLQJPRUWDOLW\SHUFHQWDJHLQDSSUR[LPDWHO\LQWKHILUVWVWDJHDOVR
LQRFXODWHGSODQWVZHUHDEOHWREHUHDG\WRILHOGWUDQVSODQW5RRWFROODUGLDPHWHU!FPDOPRVWDPRQWKEHIRUH
WKDQFRQWUROWUHDWPHQWV
rBm>Cm
rBh>Ch
where 0<r1 is the Pearsons’ correlation between the benefits Bm and Bh obtained by microsymbionts and hosts
(r characterizes the functional integrity in symbiotic system and is equivalent to k which characterizes the kin
integrity in population systems). Based on these dependencies, kin selection for altruistic traits in the
endosymbiotic rhizobia populations may be implemented due to: (i) preferential supply of N2-fixing bacterial
clones with the host-provided photosynthesis products which are partly used for reproduction of nondifferentiated bacteria within ITs (due to metabolic feedbacks represented by partners’ exchange with C and N
compounds); (ii) operation of plant signals eliciting the N2-fixing bacteroid differentiation (including BacA-NCR
interaction). We suggest that in symbiotic system, host is transmitting the altruistic impacts from nonreproducible bacteroids (fixing N2 in symbiosomes) to non-differentiated bacteria (reproducing in ITs without N2
fixation); the products of nitrogenase reaction compensate fitness costs for the hosts serving as the intermediates
in the altruistic interaction within the bacterial clones.
5HVXOWVREWDLQHGZLWKWKLVVWXG\RSHQDZLQGRZWRQHZUHVHDUFKHVWKDWDOORZWKHSURGXFHUWRXVH$0)LQRFXOXPV
WR PD[LPL]H IRUHVW VHFWRU ,Q WKDW ZD\ &RUSRLFD3L]DQR DOOLDQFH LV QRZ GHYHORSLQJ D SURMHFW WR HYDOXDWH LQ
DGGLWLRQ WR 3 TXLQDWD DQG * DUERUHD WZR PRUH IRUHVW VSHFLHV (XFDO\SWXV VS DQG $FDFLD PDQJLXP 5HVXOWV
REWDLQHG DUH VWLOO LQ DQDO\VLV EXW SDUWLDO FRQFOXVLRQV ZRXOG VXJJHVW WKDW UHVXOWV DUH VLPLODU LQ (XFDO\SWXV DQG
$FDFLD LQ WHUPV RI FRVW UHGXFH ,Q DGGLWLRQ ZLWKLQ WKH IUDPH ZRUN RI WKLV SURMHFW D VSRUH '1$ H[WUDFWLRQ
SURWRFRO ZDVVWDEOLVKHG7KHIRXULQRFXOXPV ZLWK QDWLYHVSRUHVDVVRFLDWHGDIRUHVWSODQWDWLRQVDUH JRLQJWR EH
LGHQWLILHGXVLQJPROHFXODUWHFKQRORJLHV
.H\ZRUGV$UEXVFXODU0LFKRUL]DO)XQJL$0)*DUERUHD3TXLQDWD
In order to assess the agronomic potential of altruistic rhizobia-legume interactions, we developed the model eff
gene system which is involved into the negative regulation of the effective symbiosis development [2]. Some eff
genes described in alfalfa rhizobia, Sinorhizobium meliloti are involved in conversion of the host-provided C
compounds into the storage (poly--hydroxybutyrate) or surface (exo- and lipo-polysaccharides) polymers which
are important for bacteria survival in soil, but restrict the symbiotic activity (due to a decreased energy flow to
nitrogenase). This system suggests two approaches in constructing the highly effective strains: (i) knockout of eff
genes by transposon/insertional mutagenesis; (ii) search in natural populations of strains devoid of the functional
eff alleles. The obtained strains may be further improved by introducing the cmp genes responsible for high
nodulation competitiveness, and some of the resulted commercially attractive S. meliloti recombinants improve
the alfalfa productivity under the greenhouse and field conditions.
Keywords: N2-fixing bacteria; inter- and intra-species altruism; kin selection; genetic construction; microbial preparations
References
[1] Terpolilli et al. (2012) Adv. Microb. Physiol. 60: 325-389.
[2] Provorov et al. (2014) Russian J. Genetics. 50: 1125-1136.
6
3L]DQR6$0RVWLPSRUWDQW&RORPELDQZRRGHQVODWVSURGXFHU
7
-
&
./).!. ! /0
"$
,%1%'( ,2

!@=;<^¡"=<
¢

@"=;<="";<= *
^{>{{$""{

!#@;<^¡"=<¢

| = ~ = < ># \@@ } *= " ~£ \@@ \ * " *= < ~>{@~>**=>#@"\"
" ~> ~ \@ @ ¤ {@ " ~> \" @" @ @ ¥¦{ @ @
=""**<*
~> ¥¦{ @ @ \¤ @ <"* >#
|~||#>#~¥¦\@@@""@@
= > @ * * "{ | @ @ <"@<"<<"\@@"@*"¤
="{@<"@@*"*="{
@<"^*=="\{@\^§=\@
"@@<"^!\@^!¨^^{@">>
^!@@>"*©{|@@<"
@=@\=>{>>*>@"">{|
@ < |~||#>#~ ¥¦ @ > @ * @ @@"*@\={@<">"¤
@ " >{ @ * \ @= @ @ > @
*" < * @\= @< * ={ @ <"
*=@"\"\@"<©©©©
©"<"<""=@@<*=><@
<**<="@ª~}~>**{{
@*="**\\@<
*|~||#>#~¥¦{
3
%ª<"~>*~>*><""
\@"<^<"@"{
"#=**"
"
*
¥¦ @={=~~ª#<"{
ª«
¢{
¥¦ ! <#^¬<=^|<"#*~=
{ª¢«{
¥¦^¤*!@{
ª«{
¥¦} ! <#|<"*~ª"
={
ª«{
8
9
&4*5),,&
'
6
"$
&
$
*
4*
0 3
!3%'7!
8&(' !
('3,!%'4%'0!
%
^^ *#*{;~||~>{!<;ª®
}{
9 "^!""|""@= °{
^¢¢ }{
µ==;<=# "*¶# }{
^""@=*"@="@<{
|@<@"{<"@<@
" < = *" \@ @ @ @ *
"=@<@=@"=¯@*§<
@ "= \ <" @ @ @ * " " @ "@}{\\\"
@""={~!\\@^\~!|°#*
^\@@¢ ¢~!{\<"*=
@"\@@"\\@¢©==
" " \@ ¢©{# ¢@ ¢± {@
\<"\@|$"\ @{\
<"@"{@@*"*=*
@\<"@@<=|@<=\
""{@!~>!\"*\{
\@\<ª*}*"}#@=#""
^"{@\"@¨{¨{²
{{@"@@<=|@\*\¨
{ ¨ ¢¢ ¨ {{ != = " @ *
<=*=@""¨{¨¢{¢¨{{@"
@ " @ " @ "* @
{==@<<=@@=<@<
< \@ @ "= @@ * = ¥¦{ \<
""@"=""@**@¤\
""""""¥¦\@@*"=@"="
@<\"¥¦{>@"@<"*<=
"@¥¢¦{@<=@@=@@
"\@*@<@<{"@}@@
" @ "* @ @ @ ¥¦{ @
@\="*=!^ | !{
^ =* @ \@ = \@ <{ @
@<@<*@{}}
= ¤\ ·§"¶<¸ @\ @ @ =
! < @ #\ }{ @ *§< @ "= \ @} @
""*@=""="\@@{
@\""@@={@
"@\@"@@"@*
|{ @ @= \ @ =@ |!! @@
"*}@"@@@{@\"
{ "" @ =@} @= \ " @
=}{ ! ¢ " \ ª !
! " ! " #! " $$!
! " #! " ! # {! {!
" ! @ " @< * @
" @= { | * " @ \@
=@}@="{\<@=\<
\@@@<@@"*}|!!=@{
"#=*<=·§"¶<¸"{
"#¢~!!=
*
¥¦| {""{{#"@*"ª!<\{
"{{{«{
¥¦ ¤ ^{{ § {{ ¢{ } >=} < = \
@@=}{^{@{^@={«{
¥¦^"\#{{ { {#{{*{{"{{*"=""
*""""{=¢«{
¥¦³ {{{{¤{**^{{\^{{^{{{"*<=
@@"<{{!{{«{
¥¦{#{#{~">{{{<=*"\=
@@@*{«¢{
¥¢¦{{{*"={<{{@ª{
¥¦° !{@{#"¤@§!{°{{^ *" }=<"
<""\{<{{{
¥¦ <{°{{°{{{""ª<\{<{^"{ª{
10
11
6
&
:
;6
'<&''4&
Bacterial endophytes as biocontrol agents against root knot nematode
*&
0=$
%'!6
%'0>
%'33
8
('<2' *
<&
%
*
%
Department of Biotechnology, College of Applied Arts and Sciences, National Formosa University, No.64, Wunhua Rd.,
Huwei Township, Yunlin 632, Taiwan
L.S. Young and H.C. Yuan

;<~*#!~¢#¹*
~"|";<~*¶~±¢; "º}
¶{{*

*""@>^>|!°{^*

¤\ *= @ * @* @ = \@ @= »¥¦"=<@<*{@""\@
{ @ \ @ " @ » ¤*@
" » { { | ! @ ;* *= <
%& #' @* = \@@ < \@@=*@""\@@{!\
"<}*@\@<\@@@*
"@"{|\"=\@"
\ @@ " "= * { @ \ " " "*"= @ \ " #* | ={
@""\=ª\@@
{ @ \ ^" ª ^"
$ { ª { " # \ "<= \@ "@ " "= = = @ \
"@"#\@\@@@{>
@ @ @ $ { \ { ! @@ <= * \
*{\<@\#¢{@\"{@
@*@=@¸*=
* < @ " @ * " <<@\@{
There are around 2000 different crops worldwide that are susceptible to root-infesting nematodes, which in turn
results in enormous agricultural losses. Incidents of plant parasitic nematodes are common in tropical and shortwinter regions. Infestation of nematodes results in the formation of root knots and affects the utilization
efficiency of plant to soil nutrients and water, alter plant growth and development, reduction in chlorophyll
content and even death. The normal practice to prevent infestation or soil management against nematode is to use
chemicals. However, these nemacides is prone to reside on plant products and in turn affect human health and the
environment. Although many countries have banned the use of nemacides, yet environmental friendly methods to
manage nematode issues such as biocontrol agents remains very rare. We have screened bacterial endophytes
(BE) from our established BE stocks collected from various rice, maize and Crucifer cultivars that could inhibit
the hatching of nematode eggs. Among those BEs, strain LS012 could significantly inhibit over 95% of the
hatching of nematode eggs. Inoculation of LS012 on water spinach did not affect plant growth and when
challenged with nematodes, inoculated plants resulted in 50% reduction in root knot numbers as well as better
growth performance. Overall, this finding could allow us to further test the efficacy of LS012 as a biocontrol
agent against nematode in the field.
Keywords: endophyte; nematode; biocontrol; root knot
"##<*""
*
¥¦ {»#{{({{{{{~\³¤ª*;<=^
¥¦{{{{»¤*@{{{=""*
"¯
#)*«{ª{§{¢¬{{{
12
13
Biodiversity of indigenous alfalfa rhizobia isolated from soils in central Croatia
S. Sikora, S.Kaji, S. Deži and M. Blažinkov
Biological activity of essential oils on the mycelial growth of the entompathogenic
fungi Beauveria bassiana, Metarhizium anisopliae and Isaria sp.
Department of Microbiology, University of Zagreb Faculty of Agriculture, Svetošimunska 25, 10000 Zagreb, Croatia
M. Mireles-Martínez, J. E. Navarro-Sáenz, J. M. Villegas-Mendoza, A. D. Paz-González, G. Rivera, N. M.
Rosas-García*
In agricultural production, nitrogen is one of the most common limiting factors for growth and development of
plants and also for achieving optimum yield. The largest stock of nitrogen is in the atmosphere, where it is in a
molecular form which plants are not able to uptake or use. The process of nitrogen fixation is defined as process
in which unavailable nitrogen from the atmosphere is transformed into new compounds, and thereby becomes
available to microorganisms and plants to use it for their own metabolic needs. Symbiotic nitrogen fixation has a
unique role in agriculture because the utilization of this natural process enables significant reduction of mineral
nitrogen fertilization. Selection of highly efficient symbiotic nitrogen fixators is of great importance for
successful legume inoculation due to the fact that the strains of nodule bacteria strongly differ in their symbiotic
efficiency, competitiveness and compatibility. The aim of this study was the isolation of indigenous alfalfa
rhizobia from the region of central Croatia, determination of their phenotypic characteristics and evaluation of
genetic variability within natural populations of these soil bacteria. The study also included reference strain of
Sinorhizobium meliloti 2011 and type strain Sinorhizobium medicae 18864T. Two biochemical tests, lactose agar
test and mobility of phosphate were used. For the purpose of phenotypic characterization, indigenous strains
were tested for the growth at elevated temperatures, the pH values different from the optimal ones, and at
elevated concentrations of NaCl. The identification of strains was performed by using three molecular methods
based on PCR amplification: 16S rDNA PCR - RFLP, RAPD and ERIC - PCR. Lactose - agar test showed that
six isolates belonging to genus Agrobacterium. The results of phenotypic characterization showed that the strains
differ in their ability to grow at high temperatures, at different pH values, at different concentrations of NaCl and
in phosphate mobility. The results of 16S rDNA PCR – RFLP method showed that nine strains could be regarded
as S. meliloti while RAPD and ERIC - PCR revealed the presence of significant genetic diversity between the
indigenous alfalfa rhizobia.
Laboratorio de Biotecnología Ambiental, Centro de Biotecnología Genómica, Instituto Politécnico Nacional, Blvd. Del
Maestro, s/n, Col. Narciso Mendoza, Reynosa, 88710, México.
Keywords: nitrogen fixation; Sinorhizobium meliloti; indigenous strains; phenotypic characterization; 16S rDNA PCRRFLP; RAPD; ERIC-PCR
14
In this work, the biological activity of eleven essential oils was tested on the mycelial growth of three
entomopathogenic fungi Beauveria bassiana Bb119, Metarhizium anisopliae Ma57, and Isaria sp. Pf17. A
preliminary bioassay was conducted with the Bb119 strain and the essential oils at the concentrations of 0.5 and
0.05% by agar well technique reported by Ríos et al., (1988)1. 2 x 106 conidia/ml were inoculated and incubated
at 28 ± 1ºC and 80% RH. Radial mycelial growth was measured and the bioassay was stopped when negative
control reached 50 mm diameter. Essential oils that caused total inhibition in mycelial growth were tested again
at 0.25% y 0.025%, on the strains Bb119, Ma57 y Pf17 as previously described. In the preliminary bioassay
mycelial growth was allowed by 0.5% cypress, tangerine, garlic, and eucalyptus, as well as with 0.05% mint,
lavender, geranium, orange, lime, cypress, tangerine, garlic and eucalyptus. Clove and cinnamon essential oils
only allowed mycelial growth in the Ma57 strain at a concentration of 0.025% and inhibited totally the growth of
Bb119 and Pf17 at the other concentrations. The rest of the oils at a concentration of 0.25% allowed mycelial
growth ranging from 32-100%. Essential oils can cause diverse effects in mycelial growth, which can be
considered in the development of bioinsecticides to control insect pests.
Keywords: Actividad biológica; hongos entomopatógenos; aceites esenciales; Beauveria bassiana; Metarhizium anisopliae;
Isaria sp.
References
[1] Ríos, J., Recio, M.C., & Villar A. (1988). Screening methods for natural products with antimicrobial activity: a review of
the literature. Journal Ethnopharmacol, 23(2-3), 127-149.
15
64!
,
<"/
!$
4
)
4&
&,*&
"$'/
"4
$$
74
9'73!
9'*&/
9'0!
9' !
?'43!?
9 "^!""|""@= °{
^¢¢ }{
µ==;<=# "*¶# }{
@!,
*|""<¸<|;<º~"<º^
~"º~\{
@"=*@=@@*
\@"*"@*="*"*{@@\¤
\ª"=@ <=@}@@=*
* @ *" { @ = *\ @ < \ @ "{@"*=@=@"@
@ @ < <" @ ¢
" " \@ "{ @ * !¢ @\ * = " @ \@ \ "{ @ \@ @
" # # !¢ \ *= @ { !¢ !{ | @ *} \@*@"\@@=@}@{@\
" { @ \ *= " *="<=@"*={
;<@@~\{|@
\@ @@ < @ << *" @ *= @ " "= ¤
{^\@@"*=\<\@
\#@@<@<=~#¥¦{
| @ *"" =@} " !# @< * @\ = \@ ¥¦{ ^ ^ @}* @< * < ~\ *" <<¥¦{
|@<!#^ ^"\<
@*!#^ ^#=
{ @ \ @" \@ } " { @
"@!#"\@"@*""=@
@<={<=@^ ^<@\@*""
@<={@*!#^ ^@\*\@"@<=
=~#{""<\"*^ ^
<@*!#*"\@"{
"#**}@=@=={
A#!*""=@}^ ^"~\{
*
¥¦¤{{<ª"=@{^>{
¥¦ ! { ~{ !{ !*"" =@} " ~\ " <¤{
&ª{
¥¦ #{ "{!{""#{!{"^{@}@*
"~\ª<=@\@
"{+
#ª¢{
16
17
4&
"
"$&
&
4$
0"/
$
"
!
&&
*&
/
'0!
'.4 47B&0!
6% C(
|" ¼"{^{¢¢{" °" >
}

=<<\¤
@ <{ @ " "" < * }
@@ " *} " \@{ ! @ *
"@}@*@@^"*}"@<{@
""@@"<<""=
@ { \< @ < @ @ } ^
"*} " * " = @ " @ \@ = ^
"*} "{ * " # { < "< @ "
" § " @ =* " *" @""{\"@<*"@*=@^"*}
"{@@"=<"=
"^"*}"*\@}@*"*<@@
} " @ " ¤ * "
"*{!\@*<=^\" ¶}½
¾ ¿ ½ ¾{ ¿ " @ "" = " @ \ *"="=<"@=^"*}"}@*"
*{@\=}*¤@"
~^°ª¢©@@"ª^"*}""
{ @ @}@ * @ " }@ *
& !* !*¢ @}@* #
@@}@*{@"@*\@}@
*&\@@^"*}"=¢¤@{@
} } * \@ * " \@ @
}@*&^"*}"
#=#=="==}@
@|!};<=@|

°@|@@|!};<=|@|
&==@*@"¤{@==*@"
\@""="^=<
**@{
#
@"\@@
@{@@"=\@"

#
\@~={
@¤\""#»~!""*
± ={ # ^^ @ \ @
{"@"*@\@¤\@
"@*=#|<={
@#|@
\{"@#|
~=\{¢;*@{
|@
~=@<@*=\&
@@@{
"#
&#!&!^=<**@

~=
"#}"
18
19
Comparison of commercial DNA isolation kits using two different hands and their
impact on microbial community of forest soils
4$&:02%D;&$
"
&B&
$
Taha Soliman1, 2, Sung-yin Yang1, Tomoko Yamazaki1 and Holger Jenke-Kodama1
0>&
,+
'4 E
'03E*
1
*!""@>^>|!¤#"¶*
Microbiology and Biochemistry of Secondary Metabolites Unit, Okinawa Institute of Science and Technology Graduate
University, 1919-1 Tancha, Onna, Okinawa 904-0495, Japan
2
Aquaculture Department, National Institute of Oceanography and Fisheries, Kayet-Bay, El-Anfoushy, 21556 Alexandria,
Egypt
A soil microbial community is a key player for a wide range of biogeochemical processes of nutrient
mobilization, decomposition and gas fluxes. Determining microbial communities structure of soils through DNA
Next-Generation Sequencing (NGS) is an important aspect of many fields of research. The environmental soils
contain DNA for many different communities and organisms. Therefore, the DNA isolation is critical and
challenging part of microbial community analysis. The objective of this study was to evaluate two DNA isolation
kits and different technical hands to establish the most effective protocol for microbial community analysis in
soils. PowerSoil® DNA Isolation and NucleoSpin® Soil Kits were used to extract triplicate DNA for each
sample from forest soils of six different locations across Okinawa Island, Japan. Microbial community analysis
was studied using Illumina sequencing (Miseq) and PCR amplifications were done for four microbial
communities using 16S rRNA for archaea and bacteria, 18S rRNA for eukaryotes and ITS region for fungi. DNA
extracts from NucleoSpin yielded a higher and significant (ANOVA; P = 0.0118) amount of DNA compared to
PowerSoil using technical hand T. While, the amount of DNA isolated by technical hand R showed insignificant
(ANOVA; P = 0.1922) difference between two kits. However, the DNA purities 260/280 were relatively similar
in both technical hands and kits. PowerSoil DNA Kit showed increase of Actinobacteria, Bacteroidetes,
Chloroflexi, Planctomycetes, Proteobacteria and Verrucomicrobia while NucleoSpin kit showed Acidobacteria
and Gemmatimonadetes. Phylum Armatimonadetes showed 13 Operational Taxonomic Units (OTUs) using
PowerSoil DNA kit and 0 NucleoSpin kit. The present study recommended that the most sensitive method for
DNA isolation from soils is using two different technical hands (duplicate from each sample) using PowerSoil
DNA kit.
Keywords: forest soils; archaea; bacteria; eukaryotes; fungi; DNA isolation
¤*==*""@"
"{ \< *¤*= "= \ @ " ¥¦{@¤""@@<"@=
"*=@""^{|*@*¤*=<=
"* @< = < @"@ @ " =@
@"\@@@"<*=@@{@*
@ = " * @@ "= " * * *
@=%#<¢"\<<
= \@@ @\ = @@ @ ¢© @ { | < = *¤*= " * = <"@ = \@ @ =@@ "{@@ @
"=\@*=@*\@@""*¤*=
"@@}*}"=\=
\@@#!}=*\@@=@<@@
""{*=<"\"!*¤*=\
{©©©©©
\ { = " = @ \ { < @
*"\\@@*\@©{>@@@
@ *= \ @ %
#<¢={
%#<¢\*\@@<*}@@#
!}=*{ | < "@ } " = <{"{;}"=
# !}=* " " = ² © "
@ @ < ={ ~<@ @ * * \@ !}=*
"@@"¢©@{
" @ @ * " " {¢© @@ @ @
* *= @ " ={ = " \ " @ @ *
"@"^}="*"
\@*"=*\@!}=*\=
\=*¤*={
"#=*==*¤*={
*
¥¦<{{#§"<%#*@#<{
^"{*{
¥¦"{{^{"}{#{¢{^"¹~^~{#!"" =
"~"¹"!@"! {{
20
21
4$!"
:;"
$
$$
'
4$
-
:!"
;"
./<>/'%'./<>/'('!@' *%F6)'6%
./<>/%./<>/(

\ @ "= \ \ "{ @ \ \ " \ ª ! @ \ \ " { @ @ \ "
@ \ @ { @ @ " \ "=
"¢=@=@{@@=@
=@\"""{@@
*\{¢{{@@@""\@=*"@
@<=\@={@"@@@\<*\
{{ "* " *\ @ = ¤ *\ {¢{{ !
<@@<@{@*"
@"\\!²²²
@"=\"<"@=\"
{\*=<=<\"
\@{@*@=@=@\"
"{@@*=<@@ \{
@*"{«{À"{«¢{À"{«
{À"<={@@=@@ ""=
{ |@*= < @ = \@ = { @ @@ } @* \ *= ¢==\*="\
"{~"<=\"@@{@"=@
< @ \ " @ ={
#*=;<=!""!*¤"~{
^^@==^";<=!""!*¤"~{
^^@==^";<=!""!*¤"~{
#*=;<=!""!*¤"~{
A#\\"
"#! @*=<=
22
23
4
&
$'
$
)
&
&
$
!! !

6%'6%'47('40
%
*|<"|;#¢~;<º¢
"<~=
#< @=;<@=!<""
"¢>º
!""#"$*;<=#">

@"=\"<<="}"
""* =" @"{ " <= \ <" " ""*
" * @ \ " " @ |
~!{ @" \ " * @ " @ "*{
=" " ^# } > >{<""@;!"!"<@
@=@<<\@@@="{,!#
"\@"{!!!
{ \ < " {
{ \ < @@ " }
{ @ " "" ¤\@@{
@<<<<@@{|@
"= @ \ @ & ""@"<~=@
^=!^{^
\"<@}<@{#*@"
&¤ " < \@ @ ~ " =
< *{ ^@= = " < @ \ ~! @
= @ @ *= = \ <= {
= ^ = \ " @ *" & <{@\*<*\
* < " @ @ = *" @ *
"@"{><"*¤
@*"{
"#"<=
"#""~^=!^<=G@}G^
24
25
)
&
#-$&
$
0
Diversity of acidophilic actinobacteria in mine area soils
Min-Kyeong Kim, Ji-Hye Han, YuRi Kim, Joong-Hyeon Ahn, and Seung Bum Kim
6
Department of Microbiology and Molecular Biology, Chungnam National University
#*=#" ;<=@^"§*@^¤{
Actinobacteria, one of the biggest phylum among taxa that are composed domain of bacteria, have performed
crucial role of maintaining ecosystem by contributing turnover of both carbon and nitrogen. Acidophilic
actinobacteria that are found in acidic environment are also powerful producer of antimicrobial compounds. In
this study, soil sample was collected from abandoned mine located in Chungcheongbuk-do, Republic of Korea,
where soil pH was about 4.7. The number of actinobacteria growing in acidic media of pH 5.0 were between
3.9×103 CFU/g and 1.7×105 CFU/g soil, and ninety-seven isolates were recovered. Results of 16S rRNA gene
analysis, these strains showed that all strains belonged to Streptomyces; The dominant species were S. mirabilis
NBRC 13450T (21.6%), S. panaciradicis 1MR-8T (15.5%). Antimicrobial activities were observed in these
isolates. Some strains had both antifungal and antibacterial activities, and almost half of isolates inhibited
Candida albicans KCTC 7270T.
# "&\@@}@{\@@
@*{ @}* \ <" @ *= < @ @
\@ \@ , { { ( < @ @}* @*
* \@ * " " " =
*=!<={!<="&#¢
\¢@|<={#"<"\\@
" & Á | Á | " {#~<=*@"\@Á|=@{!"
*= @}* \ *= = = @ "< ªª ; { <{ #{ | @ =
*\@@=<{<=\@

#~#~<{!@<"
"* " © \@ " © \ \@ # { = " @\ " ¢©
"#{|"\=

"&@@\@,*=@{
Keywords: Acidophilic actinobacteria, Streptomyces, Culture-dependent approach
References
[1] Pyiradharsini P. & Dhanasekaran, D. (2015). Diversity of soil allelopathic actinobacteria in Tiruchirappalli district,
Tamilnadu, India. Journal of the Saudi Society of Agricultural Sciences 14(1), 54-60.
[2] Zakalyukina, Y. V. & Zenova, G. M. (2007). Antagonistic activity of soil acidophilic actinomycetes. Biology Bulletin
34(4). 329-332.
"#@}*!*""<^\@
@}*
26
27
Effect of bacterial polysaccharide on the soil permeability
Smail L., Bennadji H., Djebbara M. and Y. Kaci
Effect of six (6) rhizosphere bacteria (Bacillus subtilis) dissolving the Natural
Phosphate on the growth and yield of maize (Zea mays L.) in Mali
Lamine TRAORÉ1, Hamadoun BABANA2, Hani ANTOUN3, Messaoud LAHBIB2, Cindy H. Nakatsu4,
Diane STOTT4
Biology Team soil-LBPO-FSB-USTHB
In this work, we propose to test the effect of a bacterial polysaccharide on the permeability of the Algerian soil
from Biskra. For this, we have chosen a bacterium (Burkholderia fungorum, strain BF01), producing
exopolysaccharide.
Polysaccharide lyophilisate is mixed with soil sieved to 2 mm, first dry, with 0.5% and 1%. These soils are
submitted for the Henin test permeability
Soils treated with bacterial polysaccharides are subsequently rewetted to 80% of field capacity and homogenized.
So we get the aggregates we called “artificial aggregates”, (reconstructed from the soil sieved to 2 mm). They
have also tested for the Henin-K permeability.
The best permeability is obtained with soil mixed with 0.5% of EPS which is about five times greater than that of
the “control” and the “original” soil. However, the soil with 1% EPS has a permeability 1.6 times less than 0.5%
of EPS. It therefore appears that the increase in the concentration of EPS 1% does not induce systematically
improved soil permeability. At a concentration of 1%, the EPS Bf01entraine clogging of soil pores, which
reduces the structuring effect of the EPS and decrease of soil permeability.
We also observed that the "artificial aggregates" have a much greater structural stability than "soil control".
Indeed, the aggregates obtained after addition of 0.5 % and 1 % polysaccharide (BF01) clearly show a resistance
to the percolation of respective volumes of water to 8 L and 8.5 L. These aggregates have retained their
difference to the structure aggregate of "soil control", which are completely unstructured.
The addition of bacterial polysaccharide allowed aggregates formed there by acquiring a stabilization of the soil
structure and water resistance.
Keywords: Bacteria, Burkholderia fungorum, polysaccharide, soil permeability
28
1
Institut d’Economie Rurale, Mali; 2University de Bamako, Mali; 3Centre Sève et Centre de recherche en horticulture,
Université Laval, Québec Canada; 4Department of Agronomy, Purdue University, West Lafayette, IN, USA.
Mali has an area of 1,241,238 km2 and a population of 15.5 million inhabitants (RGP 2007), with a population
growth of 2.9%. Soils are sandy, poor in nitrogen (0.04%) and in available phosphorus (14 ppm). Agricultural
production is mainly based on the use of imported mineral fertilizers, especially nitrogen (Urea) and phosphorus
(P). Cereals are the staple food among which maize is prominently important. The national production is about
1 300 000 T with an average yield of 2.2 T/ha for a potential 5 to 6 T/ha. This production is unfortunately
confronted with soil phosphorus deficiency that remains one of the major factors limiting crop production. In
Mali, crops respond well to phosphate fertilization, but the high price of the imported phosphate fertilizers is an
obstacle to their use by the producers, because of their low purchasing power. However, Mali has phosphate
deposits in the Tilemsi Valley, estimated at 50 million tones and containing 24.3% P2O5. The effect of the direct
application of the Tilemsi Natural Phosphate (TNP) was observed on the crops after two (2) years because of its
low solubility. This has discouraged farmers from using it in agriculture. With the idea of improving biologically
the absorption of (P) by maize fertilized with the TNP, the effect of the inoculation with the phosphate dissolving
bacteria strains (Bacillus subtilis) and isolated from Malian soils was investigated. These include associating the
microorganisms naturally present in the soil and capable of dissolving the natural phosphate (NP) for the benefit
of crops. The project objective was to contribute to a wider use of the TNP of Mali using 6 Bacillus
subtilis.subsp. Subtilis (T); DSM10 as bio-fertilizers to improve maize production and food security in the
country.
Keywords: population growth, soil poverty, maize production, natural phosphate, bio-fertilizers, food security, Bacillus
subtilis.
29
Effect on Metaresistome and metabolic profile (CLPP) soil bacterial communities of
different agricultural management in Vitis vinifera plots
Effects of Inorganic Fertilizers and Organic Manure on Cyanobacteria of Paddy
Fields
C. Valbuena Iglesias1, P.A. Jiménez Gómez1, A. Probanza1 and M. Robas Mora1
C.R.Sen
1
Department of Botany, Charuchandra College, 22 Lake Road, Kolkata-700029, West Bengal, India
Departamento de Ciencias Farmacéuticas y de la Salud, Facultad de Farmacia. Universidad San Pablo CEU. Urbanización
Montepríncipe. Carretera Boadilla del Monte, Km 5,300 28668 Boadilla del Monte, Madrid
Soil microorganisms play an essential role in maintaining soil quality, and are extremely sensible to
environmental disturbances (Kennedy et al., 1995), in a particular way, bacterial communities. Thus, bacterial
diversity has been proposed as a soil quality indicator and its analysis is essential to study environmental and
anthropological effects in soil quality (Hartmann y Widmer, 2006). Soil bacteria represent one of the oldest
evolutionary origins of antibiotic resistance, thereby forming one of the most important gene resistance
reservoirs, not only coming from human activity (but also from livestock and crops), as far as for being the
natural habitat of a plethora of species naturally producers of antibiotics. In this way, the 30/04/2014 WHO
Report about antibiotic resistance, reveals de serious threat this fact means for public health in the entire world
and suggests a broader understanding of genes responsible for such resistance, its selection and spread
throughout the environment (Petrovic et al., 2003).
The present work is focused on the study of soil bacterial communities in eight soils under different agricultural
managements in grapevines exploitations. In addition, bacteria from river Tajuña waters used to wet some of the
sampled soils are also studied. The Metaresistome, defined by us as the overall performance/ behaviour of a
bacterial community when tested against different antibiotics, has been also analyzed (Martín Rocha et al., 2014).
We also study the Physiological Profile (CLPP: Community Level Physiological Profile) of the soil bacterial
communities and the river´ water by using Biolog ECO ®.
Metaresistome analyses carried out with the soils under different management uses, show different antibiotic
resistance levels. In all cases, soil exploitation results on a higher antibiotic resistance level against abandoned
lands or those occupied by natural vegetation. In this way, it’s been found that agricultural management of soils
increases bacterial community’s persistence with a higher level of antibiotic resistance. The results obtained for
Nalidixic Acid, suggest that, although human pressure disappears, resistance persists for a long time, leaving an
ecological fingerprint in edaphic communities. However, the cessation of human pressure, involves the reduction
of ecological niche of strains that are resistant to tetraciclynes, sulfonamides, aminoglycosides and beta-lactams.
The modern day intensive crop cultivation requires the use of chemical fertilizers, but fertilizers are not only in
short supply but they are expensive in developing countries like India. Therefore, the current trend is to explore
the possibility of supplementing chemical fertilizers with organic one, more particularly biofertilizers of
microbial origin. It has been well established that cyanobacterial inoculation can replace the use of inorganic
fertilizers in case of different high yielding varieties of rice. Besides the nitrogen fixing ones, other cyanobacteria
in the rice fields are also important because of their effects through the addition of different organic compounds
to the soil by their death and decay , by extracellular secretions, by adding certain substances which are
stimulatory or inhibitory to the coexisting algae, fungi and other microorganisms. The regular use of inorganic
fertilizers in agriculture posed the problem of their effect on microorganisms. The consumption of fertilizers has
increased with the development of intensive agriculture. It was considered important to evaluate their effect in
field conditions rather than evaluation in the laboratory on pure cultures.
In the present study an attempt has been made to know the effects of inorganic fertilizers like ammonium
sulphate, urea, potash and superphosphate and organic manure specially farmyard manure on cyanobacteria of
paddy fields. In some selected paddy fields of Bardhaman district, the appearance and decline of cyanobacteria
during the different periods of growth of the rice plants have been observed. Tolerance of different heterocystous
and non-heterocystous species was studied in presence of inorganic fertilizers, organic manure, 1;2 ratio of
inorganic fertilizers and organic manure were studied. Altogether 29 species of cyanobacteria were recorded
from field collections as well as in soil culture. A correlation could be established between such observation,
which indicates cyanobacteria as a biofertilizer actually come into benefit of the rice plants in different growth
periods and its role suffers from the application of inorganic fertilizers but not so from organic manure. In the
present observation healthy growth of cyanobacteria was observed in the control field and in the field where 1;2
ratio of inorganic fertilizers and organic manure were given.
Key Words: Inorganic Fertilizers, Organic Manure, Cyanobacteria, Paddy Fields.
As regard to functional analysis of communities (CLPP), metabolic diversity is lower in those samples which
didn’t have any agricultural management. This is probably due to the addition of organic matter to the rest of the
plots sampled by the composting process. The ACP carried out with CLPP results, showed a clear segregation
between those communities corresponding to unmanaged soils and that one’s belonging to lands in use; in this
second statement, those samples under composting processes seem to be more similar. While considering load
factors, its noticeable a higher weigh of those N and C compounds coming from exudates in unused soil samples
(mainly organic acids), while the other samples (probably because of the composition of the organic matter from
composting) has a greater load in sugars and, above all, amino-acids.
Keywords: Bacterial soils communities; Antibiotic resistance; Metaresistome; CLPP; Biolog ECO®; Vitek ®.
References
[1] Hartmann A, Widmer F. (2006). Community Structure Analyses Are More Sensitive to differences in Soil Bacterial
Communities than Anonymous Diversity Indices. Appl.Environ. Microbiol. 72(12):7804-7812.
[2] Petrovic M., Gonzalez S., Barceló D. (2003). Analysis and removal of emergingcontaminants in wastewater and
drinking water. Trends Anal Chem 22: 685-696.
[3] Martín Rocha J.M. (2014). Efecto del tipo de manejo agrario en Olaea europea sobre el metaresistoma y perfil
metabolico (CLPP) de las comunidades bacterianas filosféricas y edaficas. Trabajo de fin de Grado, Universidad San
Pablo C.E.U. 21pp.
30
31
$&
"
6
Evaluation of the biological activity of extracts obtained from bacteria associated
with nematodes against Leaf Cutting Ants Atta cephalotes Linnaeus (Hymenoptera
Formicidae)
0 3%'('<HE,%')
0
6
('/
B%'(
M. Uribe-Londoño1; M. Romero-Tabarez1, and A. Ortiz-Reyes1

*=#*==^^ =!<";®}{
Â!Â@;{

1
#<\@@"\@""<*@
¤\@={@@=*\@<"\=ª*=
\@ " *= @@ "*} @{ | "" <= "*
""*@*<@*{@"@
@ "= \ <" *= "" @ @ " @= * << <={
\<\@ |"!| !
}@""={^@\"*"
\ *= "< @= * "" ª ~*
& ~* - - |^ . &{ ! " \ " \@
"< ^! ^;~{ ! \ " @=
#=^{@^"\<"*=@©
*~!{@\"*"@!|^|# !=}
!={@"\\@ *¤!\@@
!~|{!@@"*\*\@@\"
@ @= @ @={ @ @ *" @=@\*=!=!{@\
!{©@<@{©=*={|
^ != ^! \ *@ \@@ @= *
@ *< *\ @ { @" @ @ ^! @ "" {¢© * @ * {© @{ =
@ "* * *= @= " @ @< <= ¸
\"\@@@@<@=@
"={ @ \ *= * " @ * {@"=<"¾*=@*"
* @ "" < <= <"= @{ @ @= = " < @ @ *" "# { @ * \@ "" " @ @
"*={
"ª={#{@={=@={#"={
Faculty of Sciences, Active substances and Biotechnology Research Group. Universidad Nacional de Colombia Sede
Medellín. Calle 59 A N 63-20, Medellín, Colombia. 050034 Medellín, Colombia.
Nematodes are the most abundant multicellular animals on earth. They occupy a wide range of habitats, utilize a
wide range of resources, are extremely diverse and achieve large populations 1. Some nematodes associate with
insects, many as parasites, either phoretic or necromenic. Nematodes also associate with bacteria, which role may
be to protect them from necromenic insects and inhibit the growth of various fungal competitors 2,3. Thus
microorganisms associated with nematodes can be a source of active antimicrobial substances from secondary
metabolic pathways. These properties can be used against one of the major pests in the Neotropical America,
Leaf Cutting Ants (Atta cephalotes). These ants exhibit a unique trait among ants – the cultivation of fungi as a
food source (Leucoagaricus gongylophorus) 4. Therefore integrated pest management for ants requires
insecticidal activity and fungicidal activity. The aim of the present study was to test the action of several bacteria
extracts for their insecticidal properties on adult major workers of A. cephalotes and against L.
gongylophorus.The nematodes were isolated in different regions of Antioquia, Colombia using an insect trap
with Galleria mellonella larvae. Bacteria associated with each nematode were then isolated by plating in
commercial culture media. From isolated bacteria, microbial extracts were prepared to test their activity by way
of insecticidal activity and repellent tests on workers ants and growth inhibition assays on L. gongylophorus. A
total of 25 nematodes and 115 bacterial strains were isolated. The same number of extracts was prepared from
isolated strains. 50 extracts showed biological activity against fungus and 12 killed the ants in less than 48 hours.
Nematodes were shown to be an important source of bacteria producing active secondary metabolites. More than
50 % of isolate strains were shown to control leaf-cutting ants, one of the major pests in more than 47 different
crops in Colombia.
Keywords: Nematodes, active substances, inhibition; bacterial extracts, Leaf cutting ants.
References
[1] Yeates G, Ferris H, Moens T. The Role of Nematodes in Ecosystems. In: Wilson MJ, Kakouli-Duarte T, eds. Nematodes
as environmental indicators. CABI Pub.; 2009:352.
[2] Gulcu B, Hazir S, Kaya HK. Scavenger deterrent factor (SDF) from symbiotic bacteria of entomopathogenic nematodes.
J Invertebr Pathol. 2012;110(3):326–33.
[3] Murfin KE, Dillman AR, Foster JM, et al. Nematode-Bacterium Symbioses--Cooperation and Conflict Revealed in the
“Omics” Age. Biol Bull. 2012;223(1):85–102.
[4] Fernandez F, Castro-Huertas V, Serna F. Hormigas cortadoras de hojas de Colombia: Acromyrmex & Atta
(Hymenoptera: Formicidae). Bogotá, Colombia: Universiad Nacional de Colombia Sede Bogotá; 2015.
32
33
-$
"
'
&
$
&
Functional traits of endophytic and rhizosphere fungi and bacteria of Butia archeri
Glassman roots
/,' *
<&
'0@41'7'E6
3
8
*
A. Rubio Neto1, L. C. Pinheiro², J. F. Sales¹, E. L. Souchie¹, M. A. Soares³ and C. F. Silva²
;<~*#¹{!~¢#¹*{#¹*{
2
1
Professores Dsc., Instituto Federal Goiano, Rod. Sul Goiana, km 01, Zona Rural, s/n Rio Verde, GO. Brazil
Mestre em Ciências Agrárias pelo Instituto Federal Goiano, Câmpus Rio Verde, Brazil
Professor Dsc. Universidade Federal do Mato Grosso, Brazil
3
@=@ § @ @ "" \\{
"= "@ = " <" @ @ =
@ < @" @@ ¥¦ ¥¦ » ¥¦{ @ < @@<\<"""{@*\
< "@ @ *\ @< * @
"= *" @ * @ \@@ "
<"*@=*@\=\@@@**¥¦{"
@ * *< <" * *< "*@
=@<@={<
@ "= ¤@ * \ \ { \@ @
\*=""{**\
<@<=*=\@@*=
/! !
{%!\"<
*¢©@@\*<=@{
! " \ < = @ \ <=@\<"=@\<=
@ " { @* * " * " <
= *{ | @ "= ¢© @ @\ * < @
"*{
"#@=@<"*@**{
*
¥¦{>}{}{» "^{{ =@"*
{%#,{ª¢¢{
¥¦!³{{@<|@|"=ª!"={""
(
¥¦ @ { = !{ { @ { #{ < { < { » { ^{ { @ <
""*{",%0
#¢¢ª{
¥¦#{{{{"!{{{^{{"#{{{»^{{{
!^;"@=!*!\@@==!{%
(
The soil has a large variety of compounds and benefic substances to plants and microorganisms that can use them
to keep themselves alive and develop. Additionally, some microorganisms stand out because they have
functional traits and/or characteristics that help in the availability of certain compounds to plants. With this work,
we aimed to test rhizosphere and endophytic microorganisms of Butia archeri roots for their ability to solubilize
calcium and iron phosphates, synthesize indol acetic acid (IAA) and for antibiosis against seed deteriorative
fungi. To determine the phosphate solubilization, bacteria and fungi isolates were incubated in nutrient broth and
GL broth, respectively, enriched separately with the sources CaHPO4 and FePO4. After 72h, were centrifuged
(8,000 rpm) for 10 min at 10° C and 1 mL of the supernatant of each isolate was transferred for tubes. Each tube
was added 9 mL for work reagent (colorimetric method for determination of vitamin C) and the quantification
was done in spectrophotometer (725 nm). For IAA determination, 1 mL of each standardized bacteria culture
was inoculated in nutrient broth supplemented with tryptophan. After 72h at 30° C, under constant agitation (90
rpm), in the dark, 2 mL of each culture were aseptically collected and centrifuged (10,000 rpm), for 10 min, at 4°
C. After, 1 mL of the supernatant of each isolate was transferred to tubes and added 1 mL of Salkowski reagent.
The tubes were kept in the dark for 20 min and evaluated in spectrophotometer (530 nm). All the 10 bacteria
tested were able to solubilize CaHPO4, standing out two of them (BA81RAR and BA123RAR) with the highest
rates of solubilization 570.4 and 591.1 mg L-1, respectively. All the bacteria were also able to solubilize FePO4,
especially BA81R and BA105R, that solubilized 750.2 and 732.9 mg L-1, respectively. The pH of the isolates
tested, for both phosphate sources, was neutral. For fungi, the highest CaHPO4 solubilization rates was achieved
by the isolates BA367E and BA99R (798.85 and 493.21 mg L-1, respectively), noting that the pH of the broth
was acidified. For FePO4 solubilization, only one isolate showed such ability, BA367EF, with 383.83 mg L-1 and
pH acidification of the broth. Comparing the sources, the fungi isolates showed higher ability to solubilize
CaHPO4 than FePO4. The bacteria tested for IAA production were positive, and only one was not able to
synthesize it. The highest rates were met by BA119R and BA144R (85.9 and 97.0 g mL-1, respectivelly) and the
majority of the isolates produced in media that same rate of IAA. In the evaluation of the antagonist activity of
bacteria to the seed deteriorative fungi Aspergillus niger, two isolates were tested (one endophyte and one
rhizosphere) but there was no significant difference in inhibition zone size in comparison to the control.
Keywords: phosphate solubilizaton, phytohormones, antibiosis.
34
35
,
$
"
$
'$&
.
<
B$$
:<*;
!I71= '4 7+
' 0JE8
',,=
E8
'
6
6&
*H
!4
%'/&&('!//6&2'6(! 6
*
<(
*|^|<#*º;<
!"^"*{{{#"{^{^"*^"{#º{

#*=*="=@;<=@@
¤¤#^{¢{
"@=*=;!¤ºº

#*=*=#||!;!¤ºº

@ \@ @}*" & @ *<\@=\\{"@}*=
< < @ \ " @ <"} " }{
!""=~@@"^{^\@@<
""=""=="@"@"{@
¤@@!"{!@¤@@^#
@ <{ ;"= "" *" \ "*} "*
@@"@"@@^\@@<{#=@}"
\@\*"@\"*=@@"{@*§<
@"=\<@^@<\@"\""
."\@=@}"".###
@@<*@^""{@"*""~
{ " @\ @ ^ @ ^{¤ \ * "} *= { \@
"@@@**§~^°\<"=
\@ \ " *= . ###{ | @"@ " \ @\ @ ^
@ <= " @}* ~ { " @ * "} ^ @*\=@}@}*{
@ *§< @ \¤ \ " \ < @ @
@= " @ @ { > @ < !^@ ;^<< < \@@ @ " @ ^"\"@=@@\*@
¤= \ *= @"@ "* @" *
< \@" " = @ { !^@ \ " *=
@" * < \ " \@ @@ * "={ @
" < \ *< ¢ @ \@ @ @ =\""{
@<#@*"¤¤""*=@
\@ "" \@ { | @ < ¤=0 ¤ *= ""
\@ " \ @ \ { @
"= @ \ *= " @ * #{|;¢@"
<*=@\"#{@Ã*@" ^
#\=}@*=}\@="{
=@\@@"
" }{ ! } " \ @ ""*@"""{
"ª¤@@=@}"""
@<@"==*"=""@@}\<<
@ } *= \ " @ *
"}{
"#@=""&
*
#
{{^;{^Ä@!{{!*@*}=<<ª
"<*{@=ª«{
{ °"¤ { #"@ {{ !{ ^ ^{{ { ! = * < "" @ "= < *{
#*=ª¢{
{Å}{¶@}!{!{@{{{{{@}\
@@&{!@{#*{ª
36
37
Isolation and genetic characterization of bacteria and endophytic and rhizosphere
fungi of Butia archeri Glassman
Isolation and genetic characterization of endophytic and rhizospheric
microorganisms from Butia purpurascens Glassman
A. Rubio Neto1, L. C. Pinheiro², J. F. Sales¹, E. L. Souchie¹, M. A. Soares³ and C. F. Silva²
E. L. Souchie1; C. F. Silva1; J. A. Senabio2; L. C. Pinheiro1 and M. A. Soares2
1
1
Professores Dsc., Instituto Federal Goiano, Rod. Sul Goiana, km 01, Zona Rural, s/n Rio Verde, GO. Brazil
Mestre em Ciências Agrárias, Instituto Federal Goiano, Câmpus Rio Verde, Brazil
3
Professor Dsc. Universidade Federal do Mato Grosso, Brazil
2
The diversity and activity of soil and plant microorganisms are not sufficiently know yet. Thus, the
characterization and knowledge of rhizosphere and endophytic microbial diversity is relevant to evaluate their
ability to enhance the growth of Butia archeri palm. We aimed to isolate and identify the genetic diversity of
culturable endophytic and rhizosphere microorganisms of Butia archeri. Rhizosphere microorganisms were
isolated in GELP culture medium with CaHPO4, selecting those able to solubilize phosphate in vitro and
endophytes were isolated from roots in PDA. The evaluation of colonization frequency of endophytic in roots
was of 100%, in 10 days of incubation. The number of endophytes was of 88 bacteria and 15 fungi, and for
rhizosphere, 25 bacteria and 2 fungi. After isolation and purification, microorganisms were submitted to DNA
extraction, amplification of 16S region for bacteria and ITS for fungi, and sequencing. The sequences were
analised using BLASTn and compared in GenBank database for similarity search. Fungi and bacteria are present
in endophytic and rhizosphere environments, with higher frequence and diversity of endophytic species. Eight
genres of endophitic bacteria and three of rhizospheric belong to three phyla: Proteobacteria, Actinobacteria and
Firmicutes, and five genres of endophytic fungi and two of rhizosphere belong to only one phyla, Ascomycota.
Keywords: rhizosphere; Cerrado; microbial diversity; Arecaceae.
Laboratório de Microbiologia Agrícola, Instituto Federal de Educação, Ciência e Tecnologia Goiano – Câmpus Rio Verde,
Rod. Sul Goiana, Km 01, Cx. P. 66, 75901-970, Rio Verde, Goiás, Brasil.
Laboratório de Biotecnologia e Ecologia Microbiana, Universidade Federal de Mato Grosso, Av. Fernando Corrêa da
Costa, 2367, Boa Esperança, 78060-900, Mato Grosso, Brasil
2
Interactions between plants and microorganism are complex and can affect the establishment of plant
communities and change ecosystem properties. These interactions are of interest for researchers and have many
ecological and biotechnological applications. The purple yatay palm (Butia purpurascens Glassman) is a
native species from the Brazilian Cerrado. This species presents pronouncedly arched leaves, is used as
an ornamental plant, and has a great potential for use in landscaping and urban afforestation in tropical
regions. The present study is the first report on the microbial diversity associated with B. purpurascens
Glassman, and the goal was to isolate and identify the genetic diversity of endophytic and rhizospheric growable
microorganisms from B. purpurascens using molecular biology techniques. Endophytic and rhizospheric
microorganisms were isolated from the roots and rhizospheric soil of the purple yatay palm. DNA was extracted,
and the 16S region for bacteria and internal transcribed spacer (ITS) region for fungi were amplified and
sequenced. The resulting sequences were compared with known sequences from GenBank by similarity search
using BLASTn. The rhizosphere and roots of B. purpurascens harbor a diverse set of microorganism groups.
Fourteen genera of endophytic and 12 genera of rhizospheric bacteria were identified that belonged to three phyla
(Proteobacteria, Firmicutes and Actinobacteria), and 11 endophytic and six rhizospheric genera of fungi were
identified that belonged to the phylum Ascomycota. The most frequent isolated genera were Enterobacter and
Pseudomonas for endophytic bacteria, Gibberella and Codinaeopsis for endophytic fungi, Bacillus and
Enterobacter for rhizospheric bacteria, and Ceratocystis for rhizospheric fungi. Differences were observed
between the endophytic and rhizospheric microbial communities of B. purpurascens, with some microorganisms
only detected in one environment. Further studies with a higher number of individuals are needed to
confirm these results.
Keywords: microbial ecology; Brazilian savanna
38
39
Isolation, identification and characterization as PGPR of rizosphere mercurytolerant bacterial strains, associated with plants grown in mercury contaminated
soils (Almadén mining district, Ciudad Real)
D. González Reguero1, A. Probanza Lobo1, P.A. Jiménez Gómez1 and M. Robas Mora1
1
Departamento de Ciencias Farmacéuticas y de la Salud, Facultad de Farmacia. Universidad San Pablo CEU. Urbanización
Montepríncipe. carretera Boadilla del Monte, Km 5,300 28668 Boadilla del Monte, Madrid
In the mining district of Almadén (Ciudad Real), soils have been mercury contaminated for centuries, not only
coming from natural sources, but also anthropological. Due to end of mining activity in 2002, it’s been necessary
to raise these soils recuperation, in order to give them a new land use. Biotechnological approaches
(phytorhizoremediation and biosorption) for that purpose seem to be an adequate alternative. The main objective
of this project is the isolation of mercury-tolerant rhizobacteria strains (as well as bulk soil bacteria) in the
mining district of Almadén. Those isolates are identified by sequencing of gen ssrRNA. Their PGPR (Plant
Growth Promoting Rhizobacteria) activities are characterized, as a requirement for its subsequent
biotechnological use.
Five plant rhizosphere samples (and bulk soil) were collected in a high mercury concentration plot (Millán et al.,
2007). Once bacterial communities associated to plant roots were processed and extracted, selection and isolation
of resistant strains was performed, by growing them into increasing mercury concentrations (HgCl2). Those
strains that were able to grow in greater than 80μg/ml of HgCl2 were considered mercury resistant. Finally, 200
strains were isolated in pure culture, from which 34 where sub-sampled for the development of this experiment.
Its characteristics are given in Figure 1.
PGPR Activities
Figure 1 (left). a) Percentage of resistance to μg/ml of HgCl2. b) Strains pecentage according to their origin: Rumex
induratus (A), Rumex bucephalaphorus (B), Avena stevilis (C), Medicago sativa (D), Vicia bengalensis (E) for rhizospheric
soil (RF) and root free soil samples (SL). c) Percentage of bacteria according to Gram staining.
Figure 2 (right) Isolates PGPR activities descriptive. AIA: Auxin production. ACC: ACC desaminase production. SID:
Siderophore production. FN: Nitrogen fixers.
The 34 strains studied showed PGPR activities (Figure 2). Fifteen of them produce AIA as well as were able to
degrade ACC, and 4 showed triple activity (siderophore production in addition to the two previous).
Furthermore, all the strains were able to tolerate, at least, concentrations of 80g/ml Hg, and 5 of them supported
up to 160g/ml Hg. Despite 5 different plant rhizosphere and bulk soil were sampled, 90% of the isolates had
their origin in this last one, followed by the rhizosphere of metal-resistant plants R. induratus and V. bengalensis,
in equal proportions. The isolates identification was carried out by sequencing of gen 16S rRNA (ssrRNA).
Nineteen strains were identified at species level (mainly belonging to the genus Bacillus), six at genus level and
one strain, due to its low homology rate, could be considered as new species. Reviewing the literature, we´ve
find out in this work, strains belonging to species that either they were never isolated in rhizosphere before, or
they had never been described as PGPRs or their mercury-tolerant capacity was never reported.
Keywords: PGPR; phytoremediaton; ssrRNA gen; rhizosphere; Mercury
References
[1] Millan R, CarpenaRO,SchmidT,SierraM.J.,MorenoE.,PeñalosaJ.,GamarraR.,Esteban E, (2007). Rehabilitacion de suelos
contaminados con mercurio:estrategias aplicables en el área de A Almadén .Ecosistemas 16:56-6.
40
0
&B
$
*=!*<@@¢@|
¤@*@@=}"@@
<""@"@{!=@}#""\=*
\@@<"""@*=*"@
@@{@#<*@"\@@@
#"\¤==¥¦{#=\@
< = **@= " @ " < *= "¤="*=@*=""
¥¦{@¤**=*=#""@
<= " }= @ { ! @ *}ª =
" {{{ @ * } \ "* \@ "
"=\@<*={"*"
#""@""@<{@
" < " }= " @ = =
\@ < " *= " @ @< *
{@"@"@@\"=<=*¤@"@{
\¥¦{="@@}@@*"{#
{\@@*\"@@"
\"{<=\@=*=\**
¢ \@ <= ¸}*@=*}@}¢" !
ª # =} ª ¢ # \ " "*{
>";\@"}=@}Æ"*{
@* <= \@ ! \@ =} "*{ <=
!<©<={©{©{©{©{
© { © { © { <= {{ =} @ <=
<¢©<={©{©{©{©{©
{<={{!=@\{;
{\@!{;{\@=}¤\{#!{#
=} = = \ { ; # ! { ; # =}{@<=*{\@!\<=@**=}\@
|{Æ#\@**=~\@|{#{@@\"*
"<=\"<@=@©"*
"±@<==@*"*=<=©©©
"* ± ± ±{ ~" @ \ *= <= <**"\@¤{
@ }= \ { ! =
= \ "@ @@ ! @ =} { \< "@ *¤ "@ \@ \ @* \@*@ "* *=
@{\@!{@"""="*\!
*\=}{@\<"@=@"@¸"
@**=*<{<{@*=\
{|@}="=**@{
"#*¤@!=}=
*
¥¦!|= {
#%ª¢{
¥¦~@;{+ ª{
¥¦°=@°=@{|ª#}!{(!#{
!ª{
41
.6
#6$& &"
$
"
&
@
.%'('@
>&%*%

B&
&&6
<"==;;<=~*=<¢;\
=^"§*;<=@^¤

@~@@@|!};<=^>¢@|{
@ @"@" " @ @< <"} @ " = @ " "
¤ * = " @ \ <" "= " " @ {>""""@@\@*"
" @ " " " { @ @ @ *
= \ @< = " @= "
{@\¤*@""=""@=
@^¤<*=|"{@*§<@"=\@
"""=""
=*"{!=*"\<@<==*
@="@@@@}@@=
{ @ " = @ = @ \@@ @**<=@{
|@"=\*\@<"{\<¤*{|@
=\\\¤{@"@\
"<"{@*@\"
@ ** ** " { = @ @<= \ < @ " @ @"@ @
* ={ ! ** \ " = *
# "" @\ < { "
{ <={ #" * = " © © \ @< ¤*¢"±\@**{
@¤\*=""*""**
\\@@""*«"@¤<@@{@"@=
@\@**@"="{
"ª=@}"|*|
*
¥¦ " "= = *= @@@"@" " ¤ "¸ " § @ {
¤ ~ @ °= !*¤< ~\ ^@= ª « ª
{@{
¥¦ *<=@="#@^È;°È§~³"§"
¢{
3
%#@@**
42
43
={{{É* {É"#5{
ª{
~@\{{É @{É#¢{ª
{
}} !{ { É@ *= = ~! @ ª @} @*= #>{É{ª
¢{
{{É@<@=<=
#{É, #{ª¢{
{ { ª \ " { < @ª\{{<\\\*{
&
$#
$$
&
4 ,
4,
<<"¤;<="@~
!*@<=*@<*"
<@<@<=**"@\"*
""~"@"{ {°@@"{
\ < " " * * < * "ª "
< * @ @"@ " @}
*"\@@<*\@@<"
* @ * ! { "" @ "* *@@<""=*\#""#*@
*\=<"@\"*^"{¢
° { # { ! { { !* "@ ((
@<*="¤@@<*"@
@ #@<@={{
@"<=@"@""@{@*"@
@\"" #@<@*=@"@@<=
" ~@\ { }} { < { { @ \"
< <= " @ " \\ ^ * #>< ! { # ^ \ ¤= * < @"@ " " ¤{ != © " * \@@ @
""}{"""=@<! * @ \ * < @ <" \@@ #<
! \@ *{ \@@ \\
<""\*¢^@;{
~!\@@\"
^ "< ^ ^ª 12 (({ # * \ @
<@@<={!^\@
@ §= " " @ (( * { = "* \\\\{@\=
"* @ = @ @ " # @@"<@<"=^"{"
@ " * ^ = @ = < " * = *
"¤"@ #<! @*=@*^{
"ª!* =#\=
*
~"@"##{{É!*<*;<"ª
"""{É+{ª{
{ É>" * " " \@ ª *
"={É,3¢{ª{
{É#"*"""{É{ª¢{
°@@" { É!"" " * @ <" *
*{É
+{ª¢{
^" !{ { É!* ª " @ {É
4,#{¢ª{
° { { { É< * *" @< {É4#{ª{
# { { { É!* * * "= ª < "= ¢
{É/{ª{
!{°{{É@\ª*"<{É5%
#{
ª{
44
45
Microbial Community Assessment in a Pilot Scale Constructed Wetlands for
Treating Horticultural Leachates
Keywords: constructed wetland, nitrate, leachates, nursery crops, brewery waste, microbial community assessment.
Miriam Guivernau1, Marc Viñas1, Francesc X. Prenafeta1, Oriol Marfà2 and Rafaela Cáceres2
References
1
GIRO Joint Research Unit IRTA-UPC. Torre Marimon. Caldes de Montbui 08140. Barcelona, Spain
2
GIRO Joint Research Unit IRTA-UPC. Carretera de Cabrils, km2, Cabrils 08348. Barcelona, Spain.
Leachates of container-grown nursery crops are agricultural pollutant effluents rich in nitrates and phosphates.
Commonly, an excessive addition of fertilizers to crops is applied for obtaining a maximum yield, but 10-60% of
N could not be uptaken by the crop (Cregg et al. 2004) [1]. Nitrates (NO3-) are the major form of N spread in
groundwater and subsurface water causing damage to humans and aquatic ecosystems. Because N leaching is not
always controlled, the problem must be solved by treating these leachates (in or ex-situ) to minimize the
environmental impact.
[1] Fate of nitrates in field Nursery Production Systems. B. Cregg, C. Rios, J. Hart & D. Briggs. USDA Forest Service Proceedings
RMRS-P-33. 2004.
[2] Narváez, L., Cunill, C., Cáceres, R., Marfà, O. 2011. Design and monitoring of horizontal subsurface-flow constructed wetlands for
treating nursery leachates. Bioresource Technology 102(11):6414-6420.
[3] Narváez, L., Cáceres, R., Marfà, O. 2014. Depuración de lixiviados procedentes de viveros de ornamentales mediante humedales
artificiales. Eficacia del metanol como fuente carbonada. VI. Jornadas Ibéricas de Horticultura Ornamental. Valencia 1-3 Octubre 2014
“Las buenas prácticas en la Horticultura Ornamental”. Actas de Horticultura nº 68 239-244. ISBN 978846173029-9.
With this regard, an in situ wastewater treatment pilot plant was established in Cabrils (IRTA) [2]. It consisted of a
horizontal subsurface flow constructed wetland (HSSFCW) vegetated with Iris pseudacorus, using gravel as a
substrate with 5 days as a hydraulic retention time (HRT). Because of leachates of nursery crops have a very low
chemical oxygen demand (COD), an extra carbon source were required for enhancing the natural denitrifying
process that take place in the HSSFCW. Previous trials were performed by Narváez et al. 2011[2] & 2014 [3],
applying synthetic carbon sources as sodium acetate and methanol, respectively. In the framework of the
CLEANLEACH project (Eco-Innovation Program, European Commission, Grant Agreement ECO/12/332862)
several environmental improvements of such pilot plant are being carried out. The aim of this work was to
characterize the microbial community present at the influents, effluents and gravel-associated samples at three
depths, in different feeding conditions; their denitrifying potential linked with greenhouse gas (GHG) emissions
were studied. An alternative carbon source, brewery waste (featured by high simple sugar content and with over
40.000 ppm of COD), was added to nutrient solution used as influent.
Sampling were performed when HSSFCW was fed with i) water (w/o fertilizers) in winter-January (2014); ii)
nutrient solution-NS (w/o carbon source) in spring-May (2014); iii) NS and brewery effluent (BE) amendment in
autum-Sept.-2014 and iv) NS with BE in winter-Feb.2015. The GHG emissions were measured after every
feeding with a Linvall Hood. Microbial community assessment of influent, effluent and substrate gravel were
performed by Next Generation Sequencing Techniques (454 and MiSeq); and Quantitative PCR (qPCR) of
different targets genes (16S rRNA and ITS rRNA genes, for total eubacterial and fungal population, respectively;
nosZ gene for denitrifying eubacterial population; and mcrA for methanogenic archaeal population).
Results showed that denitrification process was improved and well reached. While CH4 was emitted at a low rate
or in the normal range, emission of CO2 was comparatively higher, whereas N2O was in the range in relation to
bibliographic data. Concerning the analysis of the microbial community structure, NS feeding promotes a shift in
the eubacterial community in the CW upper gravels and the effluents. BE addition was related with an increase
of microbial populations as well as in denitrifying communities. Microbial population harboured in CW gravels
were stable and non affected by inflow biomass. Microbial community composition at CW effluent were
conditioned by microbial composition of the influent at higher COD dosages.
Figure 1. HSSFCW with Linvall Hood for gas emission control. On the right side, a gravel biofilm sampling (u: upper,
m:middle & b: bottom parts)
46
47
$-)
!>04 !
PLFAs as bioindicators of the structural biodiversity of microorganisms in soil
under aided phytostabilization
/3%'('.%'('E
%'(

=@= "= @= = @= ;<= ¢
^}}

!< @ < * #"= @ ^ Ê~@ "¿
>"}¢
}"="*@"<"*{!
"@"\
" @" * "= ¥ ¦{ " @@= = \@ " \@ #
@ = @"{ @ @" = "" \@ "= @
*}@"<"=@=\@@*{@
@=""
@\*}*=@{
* \ " <" = <{ @ = \
" !"= ;^# = = < # ¬< $ " \@ = } # ;! " ^@= Á " {
@ { ! @ ;^# @ \ " = <" @ @
@@@"\=""
©@\@{©{@@"¤\"\@¬<$#
" \@ ;^ < | " ## @ #= {
#;!{
@}@\}*"
#* \{ @ @ @ @ \ \@ <ª
*{{\@=@*=@
< @ \@ ^ ¨ { @ \@ ^ ¨ <" @ < " @ *\ @ @ @ < " <={ @
"@<<@@*\@<"@<@@
*"@*\@@{\*<
*\@<"@<"@@{
@ " = " @ @ * <"=*""±"@<
\*="@@;^#{
"#};^#
*
¥¦ " { { " } !}=* \ !
@{"<={¢ª{{
¥¦{{@}"}ª*"@= <*<="
=<*@<<*{<@{ª{¢{
D. Wasilkowski1*, J. Chojniak2, G. Paza2, A. Mrozik1
1
Department of Biochemistry, Faculty of Biology and Environmental Protection, University of Silesia, 40-032, Jagielloska
28, Katowice, Poland
Department of Environmental Microbiology, Institute for Ecology of Industrial Areas, 40-844 Katowice, Kossutha 6,
Poland
2
Aided phytostabilization can be used in remediation of areas with long term exposure to heavy metals. Because
microorganisms respond quickly to the presence of pollutants in the environment, the changes in their
community structure can be used as a good indicator of ecosystem quality [1, 2]. Therefore, the aim of this study
was to investigate the structural diversity of soil microorganisms in response to heavy metal exposure using
phospholipid fatty acid (PLFAs) analysis.
Materials and methods
The study was carried out in lab-scale experiment. The green waste compost (provided by MPGK Sp. z o.o. in
Katowice), pulp from the processing of grain (provided by GRANA Sp. z o.o. in Skawina) and sodium bentonite
(commercial product) were introduced at a dose 10% into soil highly contaminated with Zn (4506±66 mg kg-1
dw-1), Pb (1291±66 mg kg-1 dw-1) and Cd (85±2.5 mg kg-1 dw-1) as the stabilizers of the bioavailable fraction of
heavy metals. As a phytostabilizer grass Festuca arundinacea was used. At the beginning and after 18 weeks of
the experiment, lipids were directly isolated from the tested soil and separated phospholipid fatty acids (PLFAs)
were methylated to methyl esters. Next, they were identified using gas chromatography. Peaks from
chromatograms were identified using MIDI software (The Sherlock aerobe method and TSBA library). PLFAs
typical for bacteria and fungi were used to calculate bacterial and fungal biomass according to the internal
standard of 19:0 fatty acid [3].
Results
Among all studied materials, bentonite was able to bind the most bioavailable form of Zn (95%) Cd (80%) and
Pb (34%) during 18 weeks of soil treatment. The compost and pulp associated Zn (83%) and Cd (60%) at a
similar level, however it was not able to immobilize the bioavailable fraction of Pb. The highest increase of the
microbial biomass was determined in soil supplemented with grain, whereas it was the smallest in soil amended
with bentonite. It suggests, that Gram-negative bacteria and fungi, Gram-negative and Gram-positive bacteria
and Gram-positive bacteria dominated in the soil amended with grain, compost and bentonite, respectively.
Conclusions
Our results indicated that the amendment of heavy metal contaminated soil with green compost, grain and
bentonite influenced the microbial biomass and community structure under aided phytostabilization. PLFA
method seems to be useful for monitoring the changes in the structural biodiversity of microorganisms under
heavy metals exposure.
Keywords: aided phytostabilization, PLFA, soil, microorganisms
Acknowledgment The project was funded by Rector subvention in year 2014. I would like to thank Institute for Ecology of
Industrial Areas in Katowice (dr. Marta Pogrzeba and dr. Jacek Krzyak) for sharing the soil used in this study.
References
[1] Lopareva-Pohu A., Pourrut B., Waterlot C., Garçon G., Bidar G., Pruvot C., Shirali P., Douay F. (2011). Assessment of
fly ashaided phytostabilisation of highly contaminated soils after an 8-year field trial. Part 1. Influence on soil
parameters and metal extractability. Sci. Total Environ., 409, 647-654.
[2] Alvarenga P., Palma P., de Varennes A., Cunha-Queda A.C. (2012). A contribution towards the risk assessment of soils
from the São Domingos Mine (Portugal): chemical, microbial and ecotoxicological indicators. Environ. Pollut., 161, 5056.
[3] Kozdrój J., Microflora of technogenous wastes characterised by fatty acid profiling, Microbiol. Res. 2000, 155, 149–156.
48
49
$
!$K
"
:;
*&
4
*
,"$
$
!%' !&%'!F&%',,%' !@('L
%
.&%!@(

#*=#" @;<=#"^¤

!""#"$*;<=#">

!*"@*!"@=^>!*"@*;!
@}@*= "<= *= < @ \@@ "
" \ " @ @ @{ @}* \
@}@ @} *@= "@ *= |¢ ~! "{@\<"@""*=*=¤\¤¸@"@
*=@@"@@=^#=#{@
" " @" \ <" *= " *=
= *< @ @" " = < \@@ \ * ={ !" " @}*"@ ^Ë{ @= @
@ @ = *= @ "* @ " { | " " \ *= ª ; * @*"{=@\"@@¤
\@ \@ " *= @ \ <" *= @ } *= *=
" #={ ! \ " < @ \@ @
\@ = ^Ë{ @ " " *= { "
@"@@\@<*"{|@"=@
=\"=@"<@¤@@"@
\@"@@=*@"@*= \@@
*@@\@""={#<""<@@
=@"@*^ ^"""\@
"{
6^@="¸@
@\{|"@¸*\@@@}*=@"
"<{""=\@=={@
=<>@;!|<@\"<
" "{ @ < @ = @< " @} <= ^@=<=^@=@\@<
@@{@}^@=>@;!|
"¢~!!@\<=^@=@"
@@\@={="<^@=@
" < { !^ = @\ <= \ < <=\@@\"**@"*={
@ = @\ < " @ = " <
< @ < @ * <={ @ \¤\"}<=@@#{"
@{
"#^@=
"#!*@""\@
50
51
Presence and survival of Escherichia coli during cow manure composting at
different sampling locations in a compost barn
Reduction of foliar diseases caused by Exserohilum turcicum and Puccinia sorghi
using biological control agents at field level in Argentina
D. Hanajima
Melina Sartori1, Andrea Nesci1, Julián Garcia2 and Miriam Etcheverry 1
Dairy Research Division, Hokkaido Agricultural Research Center, National Agricultural and Food Research Organization
(NARO), 1 Hitsujigaoka, Toyohira, Sapporo, Hokkaido, Japan.
1
Pathogenic Escherichia coli outbreaks associated with fresh vegetable consumption have brought attention to
contaminated compost manure as potential sources of pathogens. E. coli is found in all mammal faces and it has
been identified as an indicator bacteria for the fecal contamination of compost [1, 2]. To survey the presence and
survival of E. coli during cow manure composting in a compost barn, a batch composting trial was performed for
3 months. A total of 26.8 ton of cow manure was piled in a size of 8.3×3.7×2.5 m (W×D×H) and the composting
trial carried out in a compost barn with a roof. Three locations of compost temperatures inside the pile were
monitored by thermocouples at both ends and the center of the pile at a height of 1m from the bottom. Turning of
the compost was carried out every two weeks using a wheel loader. Compost samples were collected from both
ends and the center of the pile at a height of 1m from the bottom (nearby thermocouples), top surface and bottom
of the compost pile every 2 weeks just before turning. Turned compost just after turning were also collected.
Swabbed samples were collected from the surface of the bucket of a wheel loader every 2 weeks by using
Raspercheck (Becton, Dickinson and Company, NJ, USA). E. coli was quantified by plating ten-fold serial
dilutions of slurry vortexed in 9 sterilized saline on XM-G (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan), and
these plates were incubated at 37°C for 24 h; this procedure was performed in duplicate. Lower densities of E.
coli (<103 CFU/g) were enumerated by the most probable number (MPN) method using a Colisure (IDEXX
Laboratories, Inc., Westbrook, ME, USA) in addition to plating. Temperatures inside the compost pile increased
above 70°C, and the number of E. coli nearby the thermocouples were below detection limit (<10 cells/gcompost) during the entire composting process. On the other hand, E. coli in the top surface compost samples
were detected until 12 weeks and the number of them were within a range of 10~300 cells/g-compost. E. coli in
the samples of bottom compost samples were detected until 4 weeks from the start, thereafter the number of E.
coli decreased below detection limit. These data indicates E. coli survive longer time on the surface of compost
(especially on the top surface of compost pile) rather than inside the pile. The surface of bucket of a wheel loader
was often contaminated with E. coli within a range of 10~100 cells/100cm2. Wheel loader is used for the turning
of other compost piles (including fresh piles) in the compost barn; therefore, the use of the bucket might be a risk
of cross contamination of aged compost with immature compost.
Keywords: cow manure compost; Escherichia coli; temperature
References
[1] British Standards Institution. PAS 100: 2011 Specification for composted materials. 2011.
[2] United States Environmental Protection Agency. A Plain English Guide to the EPA Part 503 Biosolids Rule.
EPA/832/R-93/003. Washington, DC, 1994.
Laboratorio de Ecología Microbiana. Departamento de Microbiología e Inmunología. Universidad Nacional de Río Cuarto.
Ruta 36 km 601. Río Cuarto, Córdoba, Argentina. Consejo Nacional de Investigaciones Científicas y Tecnicas
(CONICET).
2
Oro Verde servicios fitosanitarios. Garibaldi 388. Río Cuarto, Córdoba, Argentina.
In recent seasons the hybrids of temperate and tropical maize have been significantly affected by the diseases
northerm leaf blight caused by Exserohilum turcicum (Pass.) and common rust caused by Puccinia sorghi
(Schwein). Both diseases are characterized for its high prevalence and incidence and severity progression [2].
Disease control usually consists in the use of resistant cultivars and chemical control [3]. The aim of this field
study was to evaluate the natural incidence of foliar diseases northerm leaf blight and common rust in maize after
application of two bacterial antagonists. Bacterial survival in maize phyllosphere and control effect on grain
yield at harvest were evaluated.
Antagonistic strains were isolated from maize leaves with disease lesions. Antagonistic ability was evaluated in
vitro and potential control agents were selected [5]. Two antagonists, Pantoea spp and Bacillus spp, were
selected to assess under field conditions. Treatments were planted in three randomized blocks with three
replications for each treatment. Design was performed twice. Treatments were: 1. Control; 2. Pantoea spp; 3.
Bacillus spp. Plants in phenological stage VT [4] were inoculated by foliar spray with antagonists using an
atomiser. Inoculum levels of 1.8 x 109 CFU ml-1 for treatment 2 and 1 x 107 CFU ml-1 for treatment 3 were used.
The monitoring of antagonists was performed at different times. After 27 days, a second application of
antagonists was performed. Natural incidences of diseases were evaluated in phenological stages R2, R3 and R4.
To estimate the level of common rust rule spaces was used [6]. Leaf blight was determined by the percentage of
leaf tissue infected using the scale developed by Bleicher [1]. Influence of treatments on grain yield was
determined in physiological maturity (R6).
BCAs showed a significant reduction of common rust and northerm leaf blight incidences in the first and second
evaluation (R2 and R3). After 27 days post-application (R3) plants treated with Bacillus spp showed a disease
reduction higher than 65% and negative correlation. Treatment 2 showed a lower reduction effect (-50%). After
20 days under field conditions the population of both BCA were maintained above 104 CFU ml-1.
Harvested grain yield was significantly higher in treatments with both BCA (F: 35.7; P: 0.0001) according to
DGC test. The control treatment showed an average yield of 8001+ 134 Kg ha-1. Treatment 2 and 3 showed 9155
+ 104 Kg ha-1 and 9140 + 105 Kg ha-1, respectively. Between treatments with BCA there were no significant
differences (F: 9.18; P: 0.0143). The BCA treatments were more effective with a single application.
Considering the incidence data obtained for both diseases, we suggest that a single foliar application of Bacillus
spp and Pantoea spp in the critical period of the crop, 15 days before to flowering (VT), could reduce the
incidence of foliar lesions caused by E. turcicum and P. sorghi increasing grain yield.
Keywords: Maize; Foliar diseases.
References
[1] Bleicher, J. 1988. Tesis doctorado. Piracicaba. 130p. - ESALQ – SP, Brasil.
[2] Couretot, L. 2011. Principales enfermedades del cultivo de maíz. VI Jornada de Actualización Técnica de Maíz.
Pergamino.
[3] Formento, A. 2010. INTA Paraná. http://www.inta.gov.ar/parana/info/documentos/producciónvegetal/maiz/enfermedad
[4] Ritchie, S., Hanway, J. 1982. How a corn plant develops. Iowa State University. Special report N°48.
[5] Sartori, M., Nesci, A., Formento, A., Etcheverry, M. 2015. Revista Argentina de Microbiología 47(1), 62-71.
[6] Sillon, M., Berardo, M., Mandrile, M., Albrecht, J., Fontanetto, H., Marinone, D. 2009. Agromercado Clásico Nº 157.
52
53
Rhamnolipid biosurfactant to control anthracnose disease in chilli caused by
Colletotrichum capsici
!
"
B
6
&$
Jiumoni Lahkar1, Suresh Deka1, Giasuddin Ahmed1
3 %'!/7%'7!%'. %JC0(
Environmental Biotechnology Laboratory, Institute of Advanced Study in Science and Technology, Paschim Boragaon,
Gorchuk, Guwahati 781035, India;
Department of Biotechnology, Gauhati University, Guwahati 781014, India

^^@="=!""@!"";<=@~
@¤@
°=*=#==|"#*=@!=~{@
@=§^¸"*@

The anthracnose disease caused by Colletotrichum capsici is a major fungal disease in chilli which affects the
fruit in its matured stage and leads to serious economic loss due to both pre and post harvest fruit decay. The
current agricultural practice to control the disease relies on the use of partial resistant variety and chemicals only.
Pseudomonas aeruginosa strain JS29 isolated from hydrocarbon contaminated soil produce a biosurfactant that
can reduce the surface tension of the medium to 25.70 mN m-1. Liquid chromatography mass spectrometry
(LCMS) performed on column purified biosurfactant confirmed the presence of seven different rhamnolipidic
congeners in the compound. The crude and column purified biosurfactant produced by the strain JS29 showed
effective antagonism against the phytopathogen C. capsici in vitro and found to inhibit the germination of fungal
spore (75.48 and 82.76 %) and mycelia (71.17 and 77.91 %) at a concentration of 500 mg l-1. Treatment of chilli
plant with 500 mg l-1 of biosurfactant 24 h prior to inoculation of C. capcisi spore provided 78.38 % of disease
inhibition in field condition. The rhamnolipid biosurfactant produced by JS29 exhibited significant inhibition
against the fungus and has tremendous potential to become a cost effective environment friendly way to combat
anthracnose in chilli.
¤
#{"<*""@{!
\@¤\"""
{"\@
#{\{©@{!
" \ { @= \ @=
{@\{©@
#¢{©"¢{©\"{©
,{©"{¢©@{@\"""
@" \ " @= # @@ §"<
={"@\@@<©"@@
§"< = \ { ¢{© { {© { {© <={ @ @\ª""#
, { @ <= §"< " \
@<\@"^!;"{¢©©"@@©
§"< ={ "@ <" @ * = # ""*@"\"{@="«
¤@@{¢{©{\"^!;
^!; " ^!; " @ ¢© " @ @ " * "" ¤ <*{ @ @ < " \@ ¤ @ * {
Keywords: Colletotrichum capsici; rhamnolipid; antifungal; pot trial
"#~@""
##¤"
"
54
55
!&
-
MB
&
Seasonal changes in the functioning of fungal community in the coniferous forest
soil and litter
!*
%'(' )
02'3 0
2'46
&'734$
('44(
06
&%
Lucia Žifáková, Tomáš Vtrovský, Petr Baldrian

"!=<!;<{^¢¢¢^{
|>;~^;^;<{^¢¢¢^{
|~!;#!º^¢¢§{

Seasonal changes affect all natural processes as well as carbon cycling where fungi play an important role as
decomposers and plant root symbionts. In forest ecosystems of the temperate and boreal zones, primary
production is high in summers but low or none in winter. These changes are likely reflected by the activity of
root-associated fungi, while the effects of seasonality on saprotrophic taxa are unknown. Here we have compared
enzymatic activities, community composition and transcription of microorganisms from spruce forest soils. Litter
and organic soil horizon samples were collected from six study sites in winter and summer season. Community
composition was analysed by ITS2 sequencing and transcription was followed by shotgun mRNA sequencing.
Higher fungal biomass and activity of decomposition-related enzymes was detected in litter and in summer. Most
fungi were present in both DNA and RNA pools, but differed in their abundance. Microorganisms responded to
seasonality by changing expression rates of some functional genes. The share of fungal mRNA production was
higher in summer (30 - 41% of all transcripts) compared to winter, where they produced 24% in litter and only
10% in the soil. Bacteria and Archaea were less affected by seasonality. There was a steep decline in sucrose and
starch metabolism of fungi in the humic horizon in the winter season (9%) when compared with the summer
season (33%). This may indicate reduced activity of mycorrhizal fungi in winter.

<""=@}"=@"@
\{\<@*""*=@"*@"@@
={|@@"<@
<=<=@{
|<=@"@"@"@<@@=@
@ |>¬ § " *= @ @ ~ @ != "= @ * = =@ " " ¤
@*{|>¬*@@¤
@@@@¤*<={@
*§< |>¬ @ "" "= =@
¤&{**"{
@\=\@*<<@=¤\*#!!#!#~!
\ @=="{ # @ @* @==@=="<
=^^}="@¤@¤=\=
""{!2"@\"&{
@"*==2"\@@"
*=\{"""=*
{
@*§<|>¬@@}@"
¤ { " @ \ À
ÀÀ\@\""
@\@=@{¤\*=^
= @} @ <" @ " { @
*"=\<=~!
" " "@ ^ ¢ ~! " @
*" * @=" " ¢ ~!
" ~ @ <= @ * "={ @ = @\ @
\=@\"{!=
@ *" <= @ * "= \ *< @ * { > @ = @ \ @ \@ ¤ \
{
"ª*=*"=¤@*{
56
57
<
,&
#/
$$
4
<
&
V$
&
/%
4
B)!E
.!
%'*
,
@~@#@@;<=#|

('WB<8( B/
%
"@ "É=#*^=É*}|"~"^"@
|=°Ð|" =

@ "ÉÉ|"#*=@@;<= =
6B# < = * = @"@ * !"""*@@{<\@§@
{ #* @§ @{ "
* " \@ < \ "{ \< @ "*<»<@=*=<{
"*""<"<@"{
^ " <"= @ @ *
*<==*"@<" <
< * ¥¦{ |= *@ <= \@ @
= *" # { ; @ \ " \@@ @ *" @ ¤ " ¥¦{ *" @
@ *= \@@ = @ * @\< ¤\{ @ \ " "<@\@@"=*@<{;\=<*=¥¦\
@ @ = \@ < @ @ ¤ @ * @"@ " { "@ = < @ =*"@""<{
&1
#<<=*="*{
#\"@"=<
=*" { | " \ " \@ * { @ "
" <¸ #=*" \ *< "*={ \ *< "=\"<\@\"*=
#
4#*<@"*""<#=*"*"*
<{\"\<<=*=
"*{
°=\ª""*"<=*"
*ª*<=|@<
04PNO!
$
<
04NO!
PQ
PQ
$
:%; 3 :%;
3

%RON(2P %R2
%ONSDR 2%2
FT%2U%PDJ
(D
SNP
#"
FT%R2U2RJ
%P%RON%S %D%
ND2ON%N NNN
*£ (2R
NR%D

FTN(NNU
(SSS
22%
%2(
%R%N
#"
S NN(D%
OPN
(NP
O%R%
*
@" 3
%{|\@@*
"##*=
*
¥¦#¤¤~{(+%PRS¢
¥¦{
%PRS
¥¦|°~#{
(N%
58
59
<
&&
""
#
$$B
"
Tolerance to UV radiation, osmotic stress and temperature of epiphytic bacterial
biocontrol agents against Exserohilum turcicum
<B"' 'E
!B)
"6
Laboratorio de Ecología Microbiana. Departamento de Microbiología e Inmunología. Universidad Nacional de Río Cuarto.
Ruta 36 km 601. Río Cuarto, Córdoba, Argentina. Consejo Nacional de Investigaciones Científicas y Tecnicas
(CONICET).
Melina Sartori, Andrea Nesci and Miriam Etcheverry
{^^"=!""";<=#¤|
@"¤§\@*"@}{
{@"*"@{\@{¢¢
={\<={\@@<*"{=*"=*
@ = \ = " * "@ < " "
@ > ~> = @ ^ ^ > "@ "
<¤{#@@"@\
"@@"@\@@{
* @ = , & " , { < < * " @ @"¤ " "
<@{ *"*
@*"@{@"@\@@<~^
°@"¤**@@@{
~@*\\\@{
@ *= " @* " \@ @\ @ , & @ @ *
@*¢©{\*="©{,{©{"\
* @ @* 3 { , & < @*3\@¢¢{©\*="¢©#¤*{©{
"<*\"\@"\
@\""*¤{@<*=
@ " @ @ @\ @ \@ @ " *<{
"ª"\@@*^{^<{@*
The northern leaf blight caused by Exserohilum turcicum is an endemic foliar disease of the central area of
Argentina [1]. Biological control is an alternative to chemical methods of control of plant pathogens. The leaf
surface is exposed to rapidly fluctuating temperature and relative humidity [4]. The aim of this study was to
determine the sensitivity and tolerance to temperature, osmotic stress and UV radiation, of eight epiphytic
antagonists bacteria of E. turcicum.
Bacterial strains were isolated from maize leaves with disease lesions [5]. Potential control agents selected were
three strains belonging to genus Bacillus spp; two Pantoea spp; two Corynebacterium spp and one Enterococcus
spp.
Heat treatments were carried out in water baths at 45°C [6]. Osmotic stress was determined with medium
osmotically modified to -1.38, -2.78, -4.19 and -5.62 MPa [= 0.99; 0.98; 0.97 and 0.96 water activity (aw),
respectively] by adding different amount of ionic and non-ionic solutes [2]. UV sensitivity of each biological
control agent (BCA) was determined as the minimal inhibitory dose of UV-C (MIDc) that result in an inhibition
of growth compared to the growth of non-irradiated control [3].
For all BCAs NaCl treatment (ionic osmotic stress) was more stressful in all osmotic potential evaluated and
glycerol treatments (non-ionic osmotic stress) favoured growth at all MPa. Strains of Pantoea spp. and Bacillus
spp. were the most resistant to UV radiation, heat shock and osmotic stress with different solutes. All strains of
Pantoea spp. and Bacillus spp. showed resistance to UV radiation with MIDc > than 400 J m-2 and after heat
shock the CFU count was higher than initial count. Corynebacterium spp. was the most sensitive strain, showed
MIDc < than 100 J m-2 and after heat shock a significant decreased of cells viability was observed. Enterococcus
spp. showed an intermediate performance. Therefore the antagonists Pantoea spp. and Bacillus spp. showed
greater ability to survive and adapt to stressful conditions of phyllosphere.
The information obtained about sensitivity to different stressful conditions, will facilitate BCAs selection for
future trials. Moreover, this information must be taken into account to develop the formulation process in order
to obtain an effective product for control of disease caused by E. turcicum.
Keywords: Biological control agents; Maize.
References:
[1] Carmona, M., Reis, E., Gally, M. 2006. Revista maíz en siembra directa AAPRESID. P: 86-89.
[2] Dally, H., Fox, A. 1980. Society of Applied Bacteriology Technical. Academic press UK. P.219-239.
[3] Jacobs, J., Sundin, G. 2001. Appl. Environ. Microbiol. 67:5488–5496.
[4] Lindow, S., Brandl, M. 2003. Appl Environ Microbiol. 69: 1875-1883.
[5] Sartori, M., Nesci, A., Formento, A., Etcheverry, M. 2015. Revista Argentina de Microbiología 47(1), 62-71.
[6] Sartori, M., Nesci, A., Etcheverry, M. 2010. Res. Microbiol. 161: 681–686.
60
61
Utilization of ACC-demainase containing rhizobacteria to alleviate tissue ACC
concentration and promote growth and physiology of velvet bean under water
stress
A. Rukya Saleem1, T. Mahmood1, M. Centritto2, A. Khalid1, G. D. Rocca2, C. Brunetti2
1
Department of Environmental Sciences, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi 46300, Pakistan
National Research Council, Via Madonna del Piano 10, 50019 Sesto Fiorentino (FI), Italy
2
In response to water stress, the ACC (1-Amino Cyclopropane 1- Carboxylate) concentration increased inside the
plant tissue which results into ethylene synthesis and inhibition of plant growth. However, certain rhizobacteria
have intrinsic ability to cleave ACC in rhizosphere with ACCd enzyme. This study was conducted with the aim
to analyze the rhizobacterial effect on ACC concentration inside the plant tissue, ethylene emission,
physiological effects and plant growth of Mucuna pruriens under drought stress conditions. Results indicated that
water stress increased the ACC concentration (nmol g-1) inside the leaves and roots, however inoculation with
rhizobacterial isolates significantly reduced the stress effect and decreased the ACC concentration more than
50% inside plant tissues. Substantial decline was observed in ethylene release (nl h-1 g-1) in response to
inoculation from stressed leaves and more profoundly in roots (<50%). As a result of low ACC concentration and
ET emission, enhanced growth was observed in all inoculated plants. Rhizobacterial isolates improved the root
and shoot growth and biomass upto 70% than un-inoculated plants. Inoculation support the plant physiology but
could not significantly improved the physiological stress effects. The water stress increased the isoprene
emission, while both isolates affected isoprene kinetics. Isolate “H” significantly reduced the isoprene release
with increase in stress. The results concluded that rhizobacterial inoculation could be a successful approach to
reduce ACC and ET concentration attributed to increased plant growth under drought.
Environmental, marine, aquatic
microbiology. Geomicrobiology
Keywords: ACC deaminase, Ethylene, Isoprene, Velvet bean.
62
63
$
&
.$*
*
"C/$
B
&$
&
@@&'0B
!
&',!<-
!
*!'*3$
|"\@="*;<=@=#""^>
"*"@!{
==;<=*"@"¢#=
>#!
@|<^<\<°\""~^<"@!
"*§""@"{@@¤\@@"
*= < \ @\ @@ ¤ @ "" "=
*"@@{
*" ¤ > *" @ * < *= " "
< @ ¸{ " @@" " = @ ¸ @" *!¸""<="{^<=**\"
@!"{°\@*"=
*""**"@*"""
@"\{"*@^=@^
~ " " @ * "= *" @"@" @
" { \ *\¤= \ { != * "*" * ; =" @ @
* @" * "= < { @ = "@ @
* "= * @ = =* "
"$ !"" \@ @= @ © @ ¤= "{ @
"\=<="
*" = @ =* " \ <= \{ != "¤=;@\@\="*"=
@=**{!=<="¤\@""¤
%& , \ = * @ = "²©@ "¤=
"\@!""{@""@=¤\{
@@\¤\*"=""\*"{
|@"=\@@<@¢¢@"@
* ; <" * @ #"= @¤\ \@*"="\"@|¬¬
$"= #@@" @ " @ @ = @ ; <"
\=*=@\=
" @^ \{ ^@=@ " " "<= < = < = \ " @ ³| ¢ #^ " \@
"¢#^{
@"@\";"\{«{¢{«
{ { { Ë { | < \@@"
|<"{{{{{{
{{@""\^<{«{¢Ë«{
{¢ { { \@ @ " ^ < { «
{{«{{¢{Ë{{
@^<"\\*<@\@@@@
{¢;\*={¢;{
;{;\@@\
{ ! \ *< *" \@ @ \ \
"\*<@"\{
"#@"*"@*""*=
@@@;\*<"
\\@\<"@\@@\
\ *< "" *= @ { @ " \ * "@ "<
" @@ { ! " \ *@<{
|@*@@^|<@\"=
"{@*<**@<
"<""*=@@>}>¢*=
! = ! ¢{ @ > @¤\ »
* " @ @ | < <= @ "= @ @
^<{
"#"=¤^
*
¥¦!=@¢.-%
7 8 | \ "= !=@|"\$"="^{
¥¦ > ¢ ¢ " ¤ \ "=ª @ @ " {
@} <{
64
65
@$
'$
04 !5 !
4&B
$$&
&
&&
&"
$
77+3
E+ =E8
.&.@
%'(
^;<@!@

#*= *;<=^{#{{ *~{
@$"¸;<=~@|~~;°{

=* @=@ @ * =@} *=
<=**=~*^=@~^@\=@@@=
{@"=*"$!*
" <= " ¤ @ " ¬ " =
³ @ @< @ { \< @ @}
" ~^ " \@ @ =@ " !
<"= * @ =*" - { @ @\ =*
{ @ @ @} \ ~^ *=@ " @
" "" @ " \ * = @}
@="@ª\\\{{{¤{@~^*=
$¢{
< @ "" " *" \@ " \@{ "@ ##
= @ @ ! <{ @ \¤ *@ @@}*=@@\=""<
=*=*§"""@=@{
"=@"=*@"@"*=
<"*<*{#**@=@@*=
<*@=*<*{
ª@@"=\"@ ¤**"
"\{ @ @ * " ° # "!@*" !""*=@=*{
#@*\}"@<={
@ @ <" \@ @ @ @=* {
\@@¢¢{¢=*}
""""**<*@=*
"\={
4# @ * *@ @ "*= " <
< { !@"@ @ * < @=* *" @
=\@"<"{|=*"@*
@@"{
!
$ # ! " * *@ @ *<*@=*@<"*= @@
"={
"#* !*<*=@@"=*}"\
@=*{
66
67
6
&
"
'.
'
/
Bacterial biosensors for diagnostic determination of hydrocarbon in refined
product contaminated water samples
1
1
Ibrahim I. Hussein , Abdulrasheed Mansur , and Moshood A. Yusuf
)B
/'7/%X')B
')('>B'.2'&')%'&&'*4%'B
'@
4%'/"1'@>%'/""
'@4 ."
2
%
'/"')

#*=|;<=>\|~{
@=#>\|~{
~"!<|¤¤"">\|~

@=;<=@=>\|~{
1
Department of Microbiology, Gombe State University, P.M.B. 127, Gombe, Nigeria.
Department of Biotechnology, Kulliyyah of Science, International Islamic University Malaysia, Bandar InderaMahkota,
Jalan Istana, 25200 Kuantan, Malaysia.

2

Application of biosensor has resolved the limitations of conventional analytical methods of analysing
environmental samples in terms of sample throughput, speed of application and offers consistent method in
bioavailable perspective.
>\ @ "= * \ "= | ~ = @ < < \ ¤ "{ @ @ " @
"" <@ \ ¤ < \ " \
= " *= \ ¤{ ! \ *@ " @ "= ""\{"<"@\<@*<@*@\
\@@@§"*\""=""*
@@¤"{@"="@*@=@"
"*@@*@\"|~@@@@*@
\=@@<**\@@"@
~={=\*@\\"=*@
@}|>\>">¤\{@\"*§*@=
@ ={ #* @" \ " @@ * " " = <={ @¸ ! !* @ !!
@" \ " @=@ { != < !~>! @ \ \
* @ @ ^¨ {{ @ " \ @ # Ñ <{ @ @ } @@ {Ñ{* {Ñ{*
{Ñ{*{Ñ{*{Ñ{*{Ñ{* <={@
< @ { | * "ª " #! ! !
! ! 9 #! ! { @ @=@ @ \ = \@ @ * "
\@\{!@@=@\*@@@
}={\<£ {¢Ñ{¢#£ Ñ¢¢{@
>¤\ } = @ >\ } {Ñ{* >"
}Ñ{* <={ @ @@ £ < {¢Ñ{* \ @ >\ }
@"@<==@@}\@}<"{Ñ{*{^*
! \ @ { @ " @ @ *@ \
= \@ *@ \@ \ { | *
" @ " "*} " "= @" < "
\@"<@@*"*@\"|
=@{"=\^"*"=@"@""*
\"="@"{
This study evaluates the suitability of bacterial biosensor for rapid analysis of kerosene, diesel and motor oil
contaminated water samples. The characterization and bioluminescence responses of bacterial biosensors to
genuine contaminated water sample were described thus enabled an appraisal of pollutant loading in the water
sample.
This study aimed at using two lux-marked bacterial biosensors for Pollution detection and diagnosis of
hydrocarbon in refined products contaminated water samples. The two biosensors Pseudomonas fluorescences
HK44 and Pseudomonas putida TVA8 harbours luxCDABE reporter genes coupled to induction by specific
target hydrocarbons.
These catabolic biosensors were optimized and applied using the most sensitive assay conditions. Individual
growth characteristics of these biosensors were determined and response to the doses of target hydrocarbon
tested.
Induction response of P. fluorescences HK44 predicted soluble bioavailable fraction of naphthalene
concentration of 0.04 mg l-1 and 0.2 mg l-1 in kerosene and diesel contaminated water sample respectively; also
no naphthalene detected in motor oil contaminated water. Induction response of P. putida TVA8 predicted 0.22
mg l-1 of toluene in kerosene contaminated water sample while insignificant in diesel and motor oil contaminated
water.
The two biosensors used for this study were highly responsive and sensitive to the contaminated water especially
Pseudomonas fluorescences HK44 thus responses of bioreporters established their suitability for function under
environmental relevant conditions however other factors could influence the performance of these biosensors.
Keywords: Biosensors, luxCDABE, bioavailability, naphthalene, toluene, kerosene, diesel, moto oil.
"#;*}<@<=~{
68
69
Biodiversity of radioactive environment adapted bacterial communities constituting
the biofilms of a hydrothermal spring cave (Gellért Hill, Budapest, Hungary)
4&
$
$&
&
"$
&
$$
J. Makk1, S. Pál1, D. Anda1, G. Büki1, K. Márialigeti1, J. Mádl-Sznyi2, A. K. Borsodi1
! Y!%'270 (366Z2
1

2

Department of Microbiology, Eötvös Loránd University, Budapest, Hungary
Department of Physical and Applied Geology, Eötvös Loránd University, Budapest, Hungary
The Buda Thermal Karst System (BTK) is an active hypogenic karst area where microbes may participate in
mineral precipitation and in hydrothermal cave forming processes as well. Microbial communities form red ironrich biofilm layers and inhabit the partially water-filled caves at the discharge zone of the BTK. The red iron
hydroxide precipitates can be characterized by a strong adsorption capacity of trace elements. The source of
elevated radon content (up to 963 Bq/l) of waters at Gellért Hill area can be explained by highly efficient
radium absorption of the iron-hydroxide precipitates, from which radon is formed by alpha decay. The aim of
this study was to examine the radioactive environment adapted biofilm microbial communities developed on
the Török hydrothermal spring cave walls by molecular cloning and cultivation-based methods. For the isolation
of the radiation resistant bacterial strains, the biofilm samples were irradiated by gamma radiation at various
doses (5, 10, 15 kGy) using NORATOM equipment with a 60Co source. Based on the 16S rRNA gene sequences
of the non-irradiated biofilm samples, the clone libraries showed high genetic diversity, the representative clones
belonged to 14 major taxa and showed the closest relation to uncultured clones from different environmental
sources. Taxa belonging to Chloroflexi, Nitrospira, Alpha- and Betaproteobacteria proved to be dominant by
cloning, while Firmicutes, Proteobacteria, Deinococcus-Thermus and Actinobacteria by cultivation. The
members of the Deinococcus-Thermus group and Alphaproteobacteria could be detected only in the irradiated
biofilm sample. Only six species was found to be common among the cultivated strains from the non-irradiated
and the irradiated biofilm samples. From the highest dose (15 kGy) irradiated biofilm samples members of the
genera Bacillus, Micrococcus, Paracoccus, Deinococcus, Brevibacterium were identified. Among the
isolated strains of the examined biofilm samples several so far unidentified species can be found.
This research was supported by the Hungarian Scientific Research Fund (OTKA NK101356).
="=;<~**{
"|<!¶Å=#« |""*=<!""
"=;<~**{

""=#|~<!*« #|~!!
<#*=*=@="=;<~*
!<±*{
@ * " * \= @@= " "*§ " "@ @ " "= \ * @>"*<\@*@¥¦{|@
\¤<*"\<
¤ *" @ ~ ;<= * { <
* = \ < " ; { @ = @ ¢
~!@\@@%{>
= @\ @ @ = @ " @ \@ * \@
" @ < } @ { #= # =
=@="@=*<@@"
{ ! @*@ = { { @ " " @ = @ @ * <"= @ ¤ ¥¦{ | |
= ¬= ¬ = @ @ = \ "
*{ @ *= " \ *< %
:## @ <"= @ \ { = \@ "*@\<@*=@=*=
{ @ \¤ * @ ¤\ @ < <= * @ " *
*{ @ @ " @ < \@ *} = \
\<"*@@*{
"#*}*<=*{
3
% # @ = *= <
* @ " " * ;
{ @ @" = ª
% :# # ! \ @@ @\ = {
@*@ = ª #
\@@
##{#@¤
\@ !~ ! #{ {
B"
# @ |< ¶ | ;< ~ * @¤ " { #{ #Å} § { { @ #*= * @ = ^@=@#*=@^@=@;<~*@¤
= " { ^ ³" @ @ ~" °="¤
~;<="°@¤<°~;{
*
¥¦ @ ~{ °{ = #{ { » #"¤@§ !{ { } " * @ ª<\{
#ª!{{
¥¦ ^¤ { { ^¤ ³{ #{ @" { ³{ ° { { » @ { ³{ { * <
@<{+
##ª{
¥¦ § { » @ { { { ;"" = = *= * *
\@<@{+
;ª
70
71
4
&
'3'<
Cross-species comparative analyses of secondary metabolite profiles and microbial
communities associated with different sponges from Okinawa, Japan
1%'.
0
%')
!
('2'0 %
T. Yamazaki, S. Aratake and H. Jenke-Kodama

=;<=||=

@;<=#^}}}¢#|=
2
##@@"#@|"!"*#<
Microbiology and Biochemistry of Secondary Metabolites Unit, Okinawa Institute of Science and Technology Graduate
University, 1919-1 Tancha, Onna-son, Okinawa 904-0495, Japan
¤\@**@@=<*"\@@=@@
=@<{@"=@*@"@
@}*"=@"@*"¤*\
@*\@@@@<=·@*¸{|@¤$
@*@@<@""@*"
@ @ < <* @ ·¸ * "= @ @@=¤*\@@*¥¦{
! \ @ , \ @ #@ |
" #< \@ < @" =@ { @ * \ @ < *<" *\" , @@=!¨=¨^¤=¨=\"\@
:#@¢~!{
#*"=<=""\<"=
@ = \@@ = " ¥¦{ @ " = @ " @ *"\@"*=<@=
-¥¦{
*
¥¦ #} {#{ * !{{ { { < \ @ *
""@@={<{#*{>|ª{¢{
¥¦!{!{|{#@{^!{{>{<{#{<
="@"\"{{
"@ª«{>|ª{¢§{{{¢{
¥¦ #§ !{ !{ { ¤ { @ #{{ @< { { # {
#@= *@ * "= =ª @ @
"{!"=@"@{{|{{
Sponges (Phylum: Porifera) belong to the oldest multicellular organisms
and form an animal phylum with more than 5,000 species. They are a rich
source of structurally diverse natural products (secondary metabolites),
many of which are of pharmaceutical interest and promising lead
compounds due to them exhibiting bioactivities like antibacterial,
antifungal and cytotoxic activities. Probably most of these secondary
metabolites are not produced by the sponge itself but by microorganisms
that live in close association with the animal.
Despite the fact that the last decade has seen many research activities on
natural products isolated from sponges, there is still a lack of systematic
studies that target three important questions: (1) What factors determine the microbial community structure
inside sponges? (2) What macro- and micro-environmental factors stimulate or inhibit the production of
secondary metabolites? And (3) What ecological functions provide those compounds to the sponge and to other
microorganisms living in close association?
To approach these questions, we have initiated a systematic study on sponges found in the marine environment
of Okinawa prefecture, Japan. The study design comprises the following steps: (a) Identify sponge species that
are widely distributed so that they can be
sampled on different locations and in various
seasons, (b) analyse their microbial
communities, including bacteria, archaea,
fungi and other eukaryotes, (c) analyse their
metabolic fingerprints (metabolic profiles)
by means of Nano-liquid chromatography
coupled to mass spectrometry (NanoLCMS), UV spectroscopy and light scattering
detection, and (d) compare community
structures and metabolic fingerprints across
the same sponge species from different
locations and from different seasons as well
as across samples of different sponge species
from the same location.
Around 300 sponge samples were collected and classified according to the nucleotide sequences of the
cytochrome c oxidase subunit I (COI) of their mitochondrial DNA. We have identified three suitable sequence
clades classified as members of the genera Theonella, Cribrochalina and Petrosia, all of which belong to the
class Demospongiae. The microbial communities were analysed by means of high-throughput amplicon
sequencing (Illumina MiSeq platform) targeting the 16S rDNA of bacteria and archaea, the 18S rDNA of
eukaryotes and an ITS region of fungi.
Preliminary results show that each sponge genus seems to have a core set of microorganisms that is relatively
independent from environmental conditions. Principal Component Analysis of the metabolite profile data
revealed a clear consensus profile (clustering of profiles) for extracts obtained from the same sponge genus. The
profile differences observed within the same genus are apparently caused by environmental factors.
Keywords: sponge; natural products; secondary metabolites; microbial community; metabolic profiling
72
73
Cultivation of microalgae species in mixed wastewater for biodiesel and ß-carotene
production
)
$
B
Young-Tae Park1, Hyun Shik Yun2, Min-Kyu Ji2, Taejung Kim1, Jaeyoung Choi2 and Jungyeob Ham1
1
*X' !
&'/ '@!$A
&
'/
6<$
2
Korea Institute of Science and Technology- Gangneung Institute, 679 Saimdang-ro, Gangneung 210-340, South Korea
Korea Institute of Science and Technology, 5 Hwarang-ro 14-gil, Seongbuk-gu, Seoul 136-791, South Korea
;<="@¤
;<=¤=
@}<
*
In this study, the microalgae culture medium to combined pretreated manure and AMD was investigated.
Pretreated manure in anaerobic digestion and membrane bioreactor treatment system and AMD used not only
harvest biomass but also produce lipid and ß-carotene. In experiment, effect of iron and ammonium on growth
and lipid and ß-carotene accumulation in microalgae were inspected. The pretreated manure 1: AMD 9 was
economic feasibility of microalgae culture and lipid and ß-carotene accumulation. The 10 mg·L-1 iron suitable
amount of cell growth increasing but more than 50 mg·L-1 iron could be inhibit the cell growth. Over 10 mg·L-1
ammonium affect to decreased cell growth. The more concentration iron and ammonium added, the more lipid
and ß-carotene was produced. Moreover, the pretreated manure and AMD mix medium could be used for pilot
scale bioreactor (PIMR) instead of BBM.
0.25
40
0.20
30
0.15
20
0.10
10
0.05
0
0.00
1
2
3
4
5
6
7
8
KGE3
KGE25
KGE 3 Productivity
(b)
10
2.5
8
2.0
6
1.5
4
1.0
2
0.5
0
9
0.0
1
Sample Number
3.0
KGE 25 Productivity
The productivity of Ecarotene(mg/L)
Lipid content (%)
KGE 25 productivity
@"\"@@}¤"}@
" \ *" *@ <{ ^<"= " @\ @ =
"< ¤ "< " < * ! @=@"{|@"=\
@"¤"¤\@"<{
|" * * . % @ * @*@@"{;@
"<* @" @ = "<< = =@
\@ { "= \ < @ * @"<={=@""
"*\@ * *"<{<@*
\ *\ . % =@
\ * <"} *= ~|#{ @ " @" < " \@ *
"*@<¤{
3.5
12
-1
(a)
50
0.30
Lipid productivity (g/L)
KGE3
KGE25
KGE 3 Productivity
The Concentration of Ecarotene(mg L )
60
>"<""@\@@@"=@".
" *@ "" \@ @ @ ¤ ${@=¤\|{
| "< \ . = "*= @ "<{@<|"@\=
< * { | = "¤\ \@@ | @ @
<"¤¤{
2
3
4
5
6
7
8
9
Sample Number
*
Fig. The measurement of lipid contents and productivity (a) and ß-carotene contents and productivity (b) of microalgae in
different medium after 10 days. (1) P.M.+DW (1:1), (2) P.M.+AMD(1:1), (3) P.M. +DW(1:9) , (4) P.M. +AMD(1:9), (5)
P.M. +DW(1:19), (6) P.M. +AMD(1:19), (7) P.M., (8) DW+N,P , (9) AMD+N,P
{ " ! @@ ^# " #¤< @ ~< °^ <= { { *\ . ${ ! < #*=
ª¢{
{ "!@@^#"@@#@@*#°~<°^<={
{!\\"*ª
@"*@{=»<ª{
{ @@^#"!{{^" ª|{
#*=ª{
{ " " ! @@ ^# ~< ° <= { { ^ \@
<*{=»<ª{
{ ""!@@^##<¤~~<°^<={{#@¤
^!==@"@{<#*={
Keywords: Manure; Acid mine drainage; Microalgae culture; Lipid; ß-carotene; Pipes inserted microalgae reactor
References
[1] Benmalek, Y., Halouane, A., Hacene, H., Fardeau, M.L. 2014. Resistance to heavy metals and bioaccumulation of lead
and zinc by Chryseobacterium solincola strain 1YB–R12T isolated from soil. International Journal of Environmental
Engineering, 6(1), 68-77.
[2] Das, B.K., Roy, A., Koschorreck, M., Mandal, S.M., Wendt-Potthoff, K., Bhattacharya, J. 2009. Occurrence and role of
algae and fungi in acid mine drainage environment with special reference to metals and sulfate immobilization. Water
research, 43(4), 883-894.
74
75
Diversity and activity of microbial communities in the Gulf of Naples (Italy)
Casotti R., Balestra C., Kumari R., Thiele S., Sanges R., Pepi M.
Diversity and potential applications of metal reducing bacteria from Australian
thermal environments
A. C. Greene, M. H. Wright and H. Aldosary
Stazione Zoologica A. Dohrn, Napoli, Italy
The Gulf of Naples is a dynamic area with intense exchanges between offshore oligotrophic waters, coastal
eutrophic, and river fresh waters from the intensively urbanized area. The Sarno River, one of the most polluted
rivers in Europe, strongly contributes to the pollution in terms of heavy metals and organic wastes. We present
here results from several sampings in the Gulf aimed at investigating the taxonomic and functional diversity and
the activity of the bacterial communities of the Gulf of Naples, using next generation sequencing supported by
flow cytometry and catalysed reporter deposition fluorescence in situ hybridization. Usually, the bacterial
community is dominated by Alphaproteobacteria, with mainly the SAR11 clade, followed by
Gammaproteobacteria, and Bacteroidetes. In the river area only marginal differences in the diversity could be
attributed to fresh water influences from the Sarno River and attributed mainly to Nitrosopumilales and
Alteromonadales. Lead-resistant strains were isolated from sediments near the river, which present interesting
features for biotechnological applications.
School of Natural Sciences, Griffith University, Kessels Road , Nathan 4111, Queensland, Australia
Bacteria are known to play an important role in metal biogeochemistry in many environments. Paralana Hot
Springs (PHS) in South Australia represents a unique environment for the study of microbial activity. The
surrounding regions have some of the world’s largest mineral deposits, particularly uranium. The springs are
radioactively-heated to around 60-70°C through the decay of radium and uranium, and source water is believed
to emanate from the nearby Great Artesian Basin (GAB). The GAB is the largest artesian groundwater system in
the world occupying over 1.7 million km2 and underlying approximately 20% of the Australian continent. It also
provides water for much of rural Australia and contains substantial reserves of coal seam gas and oil. Studies in
our laboratory have revealed a wide diversity of microbes that possess a range of metabolic characteristics in
water from both the GAB and PHS. Metal reducing bacteria are readily isolated from these waters and include
both thermophiles and mesophiles along with facultative and strict anaerobes. Phylogenetic analyses revealed
representatives of genera such as Bacillus, Caloramator, Thermovorax, Clostridium, Anoxybacillus, Alkaliphilus
and Thermobrachium. Metals reduced include iron, manganese, selenium, vanadium, arsenic, cobalt and
uranium. The widespread use of GAB waters for industrial activities such as mining, petroleum and coal seam
gas extraction has increased the risk of metal and hydrocarbon contamination. The bioremediation potential of
isolates from both the GAB and PHS was investigated. Bacteria were able to remove soluble toxic metals from
solution by both reduction and adsorption processes. In addition, isolates were able to use a variety of organic
compounds, including hydrocarbons, linked to the reduction of metals.
Keywords: Great Artesian Basin; Paralana Hot Springs; metal-reducing bacteria; bioremediation
76
77
-<
*
!$@
4$&
/
-6
3
&
&
%'@
..&%'('
3>2
)
$
'0
$B'3++
4
'!
6
'7
*B'
4
!'CB"B'4
)
&
0''!4
7'3[
0

*;<=^{#{{ *~

!*"*¤\\;<="@~
|#*=##"@=!"'"¸|¸³"^
~º
~ @ * ~> < ~> < @
#<@<\"""*=*@
*"@@@{¸@#*=@*"
\\ @ * @=@ < " "" @= ¤{ # @ \ *=
*@@¢~!"@@
< = "{ @ " = "
!#<<*"*!{
*@ = *= \ " "
*!>@!>!
*{!"@"<@"@*=""
*\*\"{^"*@"<@
§<@*"*"!>!>!{\@@
" * \@ @ 5 5 "*<@"=""5¤
5¤~>\{«{*=="
¢ ~! \ *= " @ { @ "=
""*@55@\@\@"*<
"{@*"5¤¢~!5¤ @ { 5¤ *" \@ \@
5¤¢~!*"\@{@*"
*"~>"*={
@@\@<=@@}\<"{>
@ " @ " @ * " @" @ @ \ *{"@!\*"@
@ @ " *< "\ " @ < = "={ > @ @ @ =@
"= "@ "@ @ == ! " @}{@*@==@<<<=<<
@""""@@{
"ª55~}*~'
78
79
3@
3
&3
.
$
4R
&4
3
"&
"$
!
!"B'FF'@,@
4/F
@< \§"|"@= \§""*
°
<@ "@^"*@"~;<="
"@°
!<=@<*"@}==
@= " = "@ @ @ {""@*
"{\@{!\@@\
@ " " \ * @ = = @= @
@=@@<}"Ò"""{
"@@=<={
°¬!@\@<@*"""@\
@ @ * ¤ @ "" @ < £ £{
" @ "= < @ @ " * } @
""@"\@=@\
*{
| \@ " "* @@ *{ *= ©© <*=*""" ¥¦{"
@}"*"@@" ¥¦ ¥¦ ¥¦{~""
" @< * *" @ *\ *" @" @@ ¥¦ ¥¦ ¥¢¦ ¥¦ ¥¦{
\< " < " \ *"{@
"="@@@"@"~!""<<*
*"@"!"@°{
\*\"@\<*\@<@"
! @ " ! "@ ° " @ \ @ *"={!=\\**@
¤@¤*@**=**<{~!\
@ * | @@@"@" ~! " \ *= @
À*"|"#|"|{!;!{
@ " " @\ \ < \@ @ @ { {¢
¨ {{ | @ =" < @ \ \@ \@ < *"
{©{©{@¤**{
"@@\<*"@*"{\*"
% \ @ @ *" <={ % =*@\@@¤*
*{ < = \ @ " \@ @ *"
\@<*"©\"\@*"#{©
% ¢{© {© {© ¢©{ @ <= =
@\@""*\*@Ë
{!~>|#@}"\@
<*\@{
@"=@"<<**\@*"
"@°"@@@"@"~!"{@@¤\<*\@
\@ = @\< ¤\ *" @
"<{;@@@"@"~!"@"=""
< <* \@{ ;"= @ " " @\ \ < \@ < = @ "{ @@"@"
" \" @} "< "@ < "
"{ | = * "" " @ *\
<<*@@"=
{
"#@@@"@"~!"<"<
*
¥¦@>""=ª"{
¥¦"{~~{!*¢¢{
¥¦~°{" {
¥¦#¤{|!{
¥¦ {!=¢{
¥¢¦#{<@^¢{
¥¦~*Ó¤{|"*"¢¢{
¥¦{!¢{
80
81
¥¦#=@#{°{{"@*"{¤¤°{³{*!{#="@°{ {¤{
@"{ª!**="&@@""
\\{!{<{#*{¢¢«¢{
@"$
$
&
$
$
,%'A.B
&%'( %

<<@¤" ¤";<=§#=
<@=""" "@!""@¤"
;<=!=@#=

} @ = " * *= "= "¤= @
@ " *" ¥¦{ @< *< @
= " = " & "
\@@ = @< " *= *"= " @ "" <
" { "<< \ @@= < \@ \ *= @
"\@@¤\"@¤{
!@"@ " @= "
*"¥¦@"@@<*"@}{@
\@=@}@@@@"@*<<"<<
@="*"*=<}{<=@@=@\<
@\@"¤="@@@"@*""={
\*"\""=@"*
=*""&\@@@"={@
"\"=@*=={@
" \ " = " " @ ¤ \ =
"@"@@@¤\@@\@±"=*@
@¤{
@"<<*=@¤\=*="<^
¢ ~! { @ = "* ¢ ~! * " @ Ë
\@ ¢ = @ " @ @ \ * "<< @
¤{|@"<<@¤\=<
@ *" \@ ¢ ~! \ < = @
{
|@*"@~!*\=¢@
@"¤="@¤"¤=@
{|@"\@@@\@"¤=~!
\*\{À{ÀÁ"~!@
¤<={@"@@<@
"¤="@"@*"{
@<@*\@"*"&"¤="@
@@\@@@¤«±@
@"*={
|<\"@"=**@@="
@ * "@ " & < @ <@"*""*="¤="*\\
={
"#"=*"<<}
*
¥¦"@}{^""{*^{"@¤{º{¡^{#{#{ª
"=*""{<{#*{«{
¥¦#=@#{°{{@"{"@*"{³{|¤>@"*{*!{#="@°{
{ ¤ { @" {ª "<< @ * " & " ""
\@<""={{@{@{¢«{
82
83
Identification of heavy metal resistance genes in Streptomyces strains from a former
uranium mining site
Identification of multi-drug resistant bacteria isolated from industrial sources
H. Brangsch and E. Kothe
1
J. Campos-Guillén1 and I. Arvizu-Hernández2
Facultad de Química, Universidad Autónoma de Querétaro, Cerro de las Campanas s/n, Querétaro, Qro., 76010, México.
Facultad de Ciencias Naturales, Universidad Autónoma de Querétaro, Avenida de las Ciencias s/n, Querétaro, Qro., 76230,
México
2
Microbial Communication, Institute of Microbiology, Friedrich Schiller University, Neugasse 25, 07743 Jena, Germany
Rapidly growing industrial production poses challenges for maintaining the integrity of natural resources, such as
groundwater and soil. Major environmental pollutants are heavy metals. They are released by anthropogenic
activities, e.g. the mining industry and waste disposal. Although some heavy metals play an important role in
biological processes, all of them are toxic in higher concentrations interfering with important cellular processes
and generating reactive oxygen species. In contrast to organic compounds, heavy metals cannot be degraded. The
main goal for the remediation of heavy metal contaminated sites therefore has to be the reduction of the
bioavailability of these metals to prevent their dispersal in the environment. Microbially enhanced
bioremediation is a promising way to approach this task.
Streptomycetes are widely distributed soil bacteria which are well adapted to varying environmental conditions.
They can be found in highly heavy metal contaminated soil where they have developed different resistance
mechanisms, such as metal efflux pumps, intracellular sequestration and biomineralization.
The Streptomyces strains investigated in this study were isolated from a former uranium mining site (Ronneburg,
Germany) and show high heavy metal resistance, tolerating up to 130 mM nickel. This high resistance is a first
prerequisite for application to bioremediation. In this project, the resistance mechanisms of these isolates have
been investigated using an in vivo manipulation approach. The aim was the identification of genes controlling
heavy metal resistance. In order to study resistance mechanisms, knock-out mutants were to be created using
transposon mutagenesis based on a Tn5 transposon randomly integrating into the genome. Since the transposon
is delivered via a plasmid, the first step of this project was to establish a shuttle vector system for E. coliStreptomyces conjugation which needs to avoid methylation-dependent DNA restriction often found with the
streptomycetes.
After transforming Streptomyces, initiation of transposition should result in transformants which need to be
screened for their heavy metal resistance. Sensitive mutants are to be selected and the transposon integration site
is identified using plasmid rescue. Thus identified candidate genes will be further investigated to determine their
regulatory role in the metal resistome and involvement in the heavy metal resistance machinery of the
investigated strains.
In this study, the implementation of an environmental monitoring program was evaluated in a multinational
manufacturer of personal care products. From twenty nine sample sites, a total of 85% of bacteria genera were
identified by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry and
15% of bacteria genera by 16S ribosomal deoxyribonucleic acid (rDNA) sequences. Microbial genera isolated
were Agrococcus, Arthrobacter, Bacillus, Chryseomicrobium, Citricoccus, Corynebacterium, Exiguobacterium,
Kocuria, Kytococcus, Microbacterium, Micrococcus, Planococcus, Planomicrobium, Pantoea, Pointibacter,
Pseudomonas, Psychrobacter, Sanguibacter, Skermanella and Staphylococcus.
In order to know the frequent association between bacteria genus and antibiotic resistance determinants, three
different concentrations for nine antibiotics with different bacterial affectations were used. Five antibiotics with
affectation in protein synthesis (kanamycin, chloramphenicol, spectinomycin, streptomycin and tetracycline),
two antibiotics with affectation in wall synthesis (ampicillin and carbenicillin), one antibiotic with affectation in
RNA synthesis (rifampicin) and one antibiotic with affectation in membrane disruption (polymyxin). We
obtained a total of 837 antibiotic profiles that show different patter for each bacteria genus. The results show that
Bacillus, Staphylococcus, Planomicrobium, Pseudomonas and Skermanella are the microbial genera with major
multi-drug resistance.
In conclusion, a formal program of environmental monitoring should be maintained for assessing and managing
the risk from exposure to biological agents.
References
[1] Mellmann, J. Cloud, T. Maier, U. Keckevoet, I. Ramminger, P. Iwen, J. Dunn, G. Hall, D. Wilson, P. LaSala, M.
Kostrzewa, D. Harmsen (2008). Evaluation of Matrix-Assisted laser Desorption/Ionization Time-of-Flight Mass
Spectrometry (MALDI-TOF MS) in Comparison to 16S rRNA Gene Sequencing for Species Identification of
Nonfermenting Bacteria. J. Clin. Microbiol. 46:1946-54.
[2] Tan T.Y., Tan J.S., Tay H., Chua G.H., Ng L.S, Syahidah N. (2013). Multidrug-resistant organisms in a routine ward
environment: differential propensity for environmental dissemination and implications for infection control. J Med
Microbiol. 62:766-72.
Keywords: heavy metal resistance; Streptomyces
84
85
.&
'
-
&
&
$
"
"
.
$
E&&
$
!%!%6.
(.
%

,
F\\\%',]B4%' /^\4('\_
`
B2'a/
F\
@=#;<=#"¤=
"="#;<=¢#"¤=
=#;<=#"¤=

=*=="=##;<=¢#"¤=

<|*"@;<=#¤¢|*""¤=

|"<};<=*¤|*""¤=

^@" @ = \@ * "= "" " <
¥ ¦{ ! * "* @ @"
\\ \@@ @ @@ { " <= * "@}
=@= = @ = " @"{ @ @
@\"@"@}=@=="@}
==@="@}=@==*@
**@"{@"<*!
\=@@"\\"*"
={@**\"@<=#!{#!
\""<"**@=@*@
@!\<"{<"\"{{
{{{{{{<={@\
\@{*"@@
@*=@*<"\\{@
"= @ @ * " \ * * @ @@*"@@
@{ @\ * \@@ " * " = *= "@}{ #! = @ * * \ =
\@@*@@{@*"=@\
@\@!{#!="*""*
=<"@@<"@={
!"""<@\"\\{"@
*@@@@={!*"
< * *" " * * * \@ { \< *
* = <{ " < " * "
< @ < @ * ¥¦{ ^@ @= *
""="""{><@@"*@@*"
<"@=*@"{* {
@"""@"¤@\{|<=<*
*" * " @@ <" @ "< @ { @
@}**@"*{
|@"="\¤¤=@<@*"
= = @ \@ {© " @ ¥¦{ \= * \ = = !
! { \ " *= @ ¤ @" " !
{\@=*=!^|¤¢~!=\{
¢ ~! = * \ "<= Ô < #
~| ! ={ @ \ \ { ^ *@\*=@"*=@{¥¦<*@<@\"
{^@"*="@@@"={^@~!\
@@@¥¦{~!\*=|@@@"@{©
}@~!{@"@\@@}@\*@
¤*¤*<={
"#!**"@*@*
^@\@"<=\@{©
"={ \@\@#=#{\@\
"@@@=\@#{#"@\@@*@
@=@<@@{
*
¥¦ != { " { !¤ >{ | { >}*= { { | >{ { |@*= *
*=@*@@{@@{
¥¦!={|{»|>{{<**""
*@@"\\{8{
"#*@*@@="""
*
¥¦ ~ ^ ^ !< * * ª
"<*"""{@=ª{
¥¦# @<"##;@°{§<{°@ °"|°"||*@<=
*@\@*""<*@@=<{!"""ª
¢{
¥¦ °" |{ #{#{ @<" {°{ @ { °@ °" |{ { @ @
@@"*@{!"""{¢ª
¥¦ *¤ @ \ { @ #{ #" { { { ~\ ³¤ª @*
*={{{
86
87
Lectin histochemistry of germ-free fish generated from the ovoviviparous Guppy
Poecilia reticulata
Main factors contributing to outbreaks of Edwardsiella ictaluri infection among
riverine ayu in Japan
Takanori Hiyama1, Taiga Murakami1, Eri Shimodaira1 and Nobuhiro Mano1
Hisato Takeuchi1, Motoyuki Hiratsuka1, Hiroki Oinuma1, Yoshiyuki Umino1,2, Daiki Nakano1,
Ryuji Tomono1, Mayu Iwadare1, Kazutomo Hori1, Toshihiro Imai1, Ataru Sawamura1,
Hiroaki Izumi1,Takanori Ishikawa3, Tomohiro Takase4 and Nobuhiro Mano1
1
Department of Marine Science and Resources, College of Bioresource Sciences, Nihon University, 1866 Kameino,
Fujisawa, Kanagawa, 252-0880 Japan.
1
Germ-free (GF) animals are general as the research tools of host-microbe interactions. Lots of species were
generated as GF animals (e.g.; mouse, pig and broiler). However, since there has not been GF fish which is able to
survive for a long period time [1] and the interactions between fish and microorganism are unclear ever. Therefore
we generated new GF fish by guppy P. reticulata and provided methods of rearing for a long period time. Using
these methods, we obtained GF fish survives over 100dph (days post hatching).
In this present study, we investigated differences of sugar chain between GF fish and conventionalized (CONV)
fish by LECTIN histochemistry. Sugar chain is complex macromolecules present in all tissues throughout the body
and plalys an important key role in host metabolism. We compared the metabolism between GF fish and CONV
fish by observing the binding pattern of seven lectins with different sugar chain.
According to previous study (Submitting), we obtained some GF fish, and half of them were conventionalized
(CONV) at 3dph. At 21dph, test fish were fixed in Bouin’s solution overnight, rinsed in 70% ethanol, dehydrated in
a graded ethanol series, immersed in Toluene and embedded in Paraffin. 4m sections were cut and mounted on
glass slides already coated by poly-L-Lysine for histochemistry (AB-PAS and LECTIN) and observed by light
microscopy. In LECTIN histochemistry, seven different biotinylated lectins were used as probes and treated by
avidin-biotin-peroxidase complex (ABC).
In AB-PAS histochemistry, when we counted AB-PAS positive mucous cells on the skin between the head and
the body parts, mucous cells of GF fish are significantly lower than ones of CONV fish in both parts (P<0.01,
Student’s-t test). We then observed different binding patterns of GF fish and CONV fish in LECTIN
histochemistry. When we used DBA lectin, it was binding strongly skin mucous cells of CONV fish but almost
disappeared in ones of GF fish (Fig. 1). And also in ventral aorta, RCAೢೣೡ lectin is same connectivity such as like
skin mucous cells (Fig. 2).
Department of Marine Science and Resource, College of Bioresource, Nihon University, 1866 Kameino, Fujisawa
Kanagawa 252-0880, Japan
Graduate School of Biosphere Science, Hiroshima University, 4-4 Kagamiyama 1-chome, Higashihiroshima, 739-8528
Japan
3
Tochigi Prefectural Experimental Station, 2599 Sarado, Ohtawara, Tochigi, 324-0404, Japan
4
Tokyo Metropolitan Islands Area Research and Development Center of Agriculture, Forestry and Fisheries, 7-104 Kaigan
2-chome, Minato, Tokyo, 105-0022, Japan
2
Edwardsiella ictaluri in the family Enterobacteriaceae is one of the most famous bacterial fish pathogen. This
bacteria has been recognised as the causative agent of enteric septicaemia of catfish (ESC) in various cultured
and wild catfish species, causing heavy economic losses in worldwide [1]. In Japan, outbreak of infection with E.
ictaluri was recorded for some river in the summer 2007, causing mass mortality of ayu, which is representative
freshwater fish species in Japan [2]. This report represents the first records of E. ictaluri infection of fish in
Japan, and this disease has been spread in throughout 10 or more prefectures by 2011. However, because
outbreak status has been variable in recently years, little is known about outbreak mechanism of E. ictalluri
infection in natural river. In this study, we compared survey results in Tama river system of the Tokyo
metropolis, Japan during outbreak years and non-outbreak years to determine the driving factor of E. ictaluri
infection in natural river.
The survey was carried out at tributary of Tama river during July and August in 2011-2014. Ayu was collected
by angling, and examined for E. ictaluri by cultivation and selective enrichment cultivation using trunk kidney.
On the other hand, water temperature of each year was recorded for four times a day by temperature logger, and
calculated diurnal water temperature range in each day. Water level data of each year was also obtained from the
web site of Ministry of Land, Infrastructure, and Transport, Japan.
The prevalence of E. ictaluri among ayu in 2011 was generally low rate, while the prevalence at August in 20122014 were high rate (37.5-86.4%). However, it was only in 2012 and 2013 that outbreak of E. ictaluri infection
with mortality of ayu at August, although the prevalence in 2014 was high rate (53.2%). Then, we compared
environmental factor in each year. In August, average water temperature and diurnal water temperature range at
of outbreak years (2012-2013) were higher 2-6 °C and 1-2 °C than non-outbreak years (2011, 2014),
respectively. Additionally, flooding (rising water level over 0.5m) occurred several times in non-outbreak years,
while no flooding was observed in outbreak years. These results suggested that outbreaks of E. ictaluri infection
among ayu is associated with environmental change in natural river caused by summer heat wave, such as high
water temperature and water shortage.
Our studies used GF fish suggest that microbes affect the localization of sugar chain, in other words, host
metabolism is particularly modulated by them. We confirmed these phenomenons were improved since microbes
were administrated to GF fish. Therefore GF fish can be attractive models for analysing beneficial or pathogenic
relationships between microorganisms and fish host.
Keywords: Germ-Free, Metabolism, LECTIN histochemistry, Sugar chain
References
[1] John F. Rawls, Buck S. Samuel, and Jeffrey I. Gordon (2004)᧶Gnotobiotic zebrafish reveal evolutionarily conserved
responses to the gut microbiota. PNAS, 101(13), 4596-4601.
88
89
$
&
"
$
"
-$
The first observation
of E. ictaluri infection
Average water temp. (Υ)
2013
2012
7
4
%'E
!1(' (3[0
%
28.0

^@"|"~"<@>;<=!
!\}"^"=\}
@{!{>*\}

23.0
"""\"@
" * *{ " © " \\@§"=<{!*@
= " @ " @ " " * *
"{@@"<**=}
@ < * @{ @ \ @ @
" @ *= @@ " "{ | * " " *
* * " =
*=@*{@\"
< < \ " * = "{ | < { \" @"
*"==<"{
18.0
13.0
Water level (m)
0.4
0.2
0
2011
2012
2013
2014
-0.2
-0.4
-0.6
-0.8
@"@ @@= " \ \ " "
" \@@ @@ { ! < @" @ " " \
< * *" " @@ \@@ " @* @
"@@*@<=@{
-1
August
July
Fig. Changes of average water Temperature and water level in tributary of Tama river during July and August in 2011-2014.
>" § < < * " * " < @@
@\"{@\\"@§\*¤
@"@ª<=*=<=={|
@<=<<@@\=@@="<
@"<*@@=*\"
<"@*"<"¤@="
\{|*@<*=@@<
* <" << * " < " <= \ @ @ "@ " { =
=\"@*
@} @ <" < * " "" \
==\@"<{
Keywords: Epidemiology; Bacterial disease; Edwardsiella ictaluri; Environmental factor; Water temperature; Natural river
References
[1] Evance et al. (2011), CABI, pp. 512-569.
[2] Sakai et al. (2008), Fish Pathology, 43, 152-157.
@=@\@*"@\"*=<\
* @ *= " * < \ " @ = " \ { @ "=
**"=""
! @ @ = @ \@ "@ " @ { {¢ *
{ * ³" @¸ "= { @ "= @ < @
*"<<<=
" " ! @ *
90
91
&
B
'$
'
Microalgae as a model for metal risk analyses
A. Fargašová
"|B%'<3
]('!&=(')
1!B%'&B2' AB%'6B"B6'
!"
B6
B
Department of Environmental Ecology, Faculty of Natural Science, Comenius University in Bratislava, Mlynská dolina,
IlkoviÕova 6, SK-842 15 Bratislava, Slovakia

<#*=@=~"";<=\\¤
"Ú^
#*=Ð<Ð¶;<=""=

@<@==~"";<="Ú^
Microalgae may be useful in at least three ways to deal with potentially toxic release. First, they are well suited
to be used as test organisms in short-term laboratory tests for rapid screening of chemical pollution in waters;
secondary, under natural conditions they may be useful in pollution studies, since their analysis will be indicative
of the water environment chemical status; finally, moreover the metal concentration in the algal material
sometimes becoming larger than those in the bathing water and so algae may be used for bioremediations.
Additionally their biomass may also be utilized for biogas production.

!<Ê\@¿=¤\@@*="
" *= <= @ \ *= < " "<* ""
@{ !* ¤@ * \ @ " = @ @ *@ @< { @ "* * ""* * @ \
= ; = @ "* * \ ¢ = {
< ~! \ = *@ ¢ ~! ="\@*"{@
*\ @ " ¤ @ \ < *" @=
" ¢{© {© \@ @ {© {© <={ @ "
= ¤ \ @* \@ @ * " $!
$ \@ @ @ @ *" " \ @ { !
""**\@{
The study was focused on Cd, Pb, Cu, Zn and Fe toxicity expressed as EC50 concentrations (concentration with
50% inhibition of observed parameter) and their 95% confidence intervals (CI) for microalgae Desmodesmus
quadricauda, D. subspicatus, Chlorella vulgaris and Raphidocelis subcapitata. The tests lasted 14 days and
observed parameters were growth inhibition, chlorophyll a production (Chla) (Pastierová et al. 2009) and metal
bioaccumulation expressed as bioconcentration factors (BCF) (Arunakumara, Xuecheng 2008). For BCF
determination metals were used in concentrations corresponding with calculated EC50 values. Metals were used
in analytical grade quality as CdCl2.2.5H2O, (CH3COO)2Pb.3H2O, CuCl2.2H2O, ZnCl2 and FeSO4.7H2O. For
metal determination the AAS analysis with flame and electrothermic atomization was used. Conclusions related
to the sensitivity of tested algae were done on the bases of obtained results.
From results obtained for growth and production of Chla the inhibitory rank orders for each alga species were
established. These rank orders were based on EC50 values calculated by using probit analysis and statistically
evaluated though CI. The inhibitory rank order for algal growth was for all tested algae, except D. subcapitatus,
as followed: Cd > Cu >> Zn >> Pb > Fe. For D. subcapitatus was Pb more toxic that Zn and the rank order was
Cd > Cu >> Pb > Zn > Fe. Nearly the same sequence was observed for Chla production. In this case for all tested
algae was again as the most toxic determined Cd and as less toxic Fe. The rank order for this parameter was Cd >
Cu >> Zn Ø Pb >> Fe. Equality of rank orders for algal growth and Chla production indicate suitability of both
observed parameters for metals unfavorable effects determination on algae production. Chlorophylls content is
responsible parameter for algal biomass determination and is often used for water quality valuation. Chla is the
dominant pigment in algae.
"#*<=¢~!="¤@@@
Algae, primary producers and essential constituents of setting materials in aquatic ecosystems, are often the
dominant vectors for heavy metals. Plankton species play an important role as biosorbents influencing the
environmental fate of metals. Algae as primary producers can introduce heavy metals into the aquatic foot chain
and this phenomenon may have important consequences for ecosystem structure and function. Algae possess the
capacity for taking up heavy metals from the water, producing an internal concentration greater than that of their
surroundings. The metal bioaccumulation ability of algae can reflect to some extent a bioconcentration factor
(BCF), i.e. the ratio between metal concentration in the cells and that in the surrounding water. BCF in our
experiments moved in intervals (in %) 360-450 for Cd, 920-1300 for Zn, 470-620 for Cu, 590-830 for Pb and
1520-4560 for Fe depending on alga species. BCF factor is highly depending on many environmental variables
and observed species. The highest BCF factors were for Cd and Pb determined for alga R. subcapitata and for
Cu, Zn and Fe for D. qaudricauda. The most sensitive to Cd and Pb was determined D. quadricauda and to Cu,
Zn and Fe C. vulgaris. The less sensitive to Cd and Cu was R. subcapitata and to Zn D. subspicatus which
sensitivity to Zn was 3.8-8.8 times lower than that of other tested algae.
Keywords: algae growth and chlorophyll a production; Cd, Pb, Cu, Zn and Fe toxicity; bioaccumulation factor;
References
[1] Pastierová, J., Kramárová, Z., Molnárová, M., Fargašová, A.: Fresenius Environ. Bull., 18:2029-2033, 2009
[2] Arunakumara, K.K.I.U., Xuecheng, Z.: J. Ocean Univ. Chin., 7:60-64, 2008
Acknowledgement: The work was supported by Grant Agency VEGA 1/0098/14.
92
93
&&
&
$
$
:!B;
&
&
"
-}~8%'!H
B('82H
B8
4E
%'('40
('4E2E04$(

"=~"";<=<|¤<Õ<¢#=¤¶
<<¤

<="=~"";<=<|¤<Õ<¢
#=¤¶<<¤

="=~"";<=<|¤<Õ<¢#=¤¶
<<¤

@="=~"";<=<|¤<Õ<¢#=¤¶
<<¤

|"@=#*="=;<!"@
<#*=*=#*="=;<=
^{>{¢@

;<=~@;;

@ @ < @ @ *" <= *
"{ ! @@= = < @ ! @
@¥¦"@<"@@*@"{"<
@<*"<=*=@=
¥¦{ @ *§< @ \¤ \ = @ * "
\@ @@ @ "= \@
{
| @ < = <¤ \ {@ = *\
<{@@^Õ"@"@
@Û¤ ¤º"@@^Õ{@\@
="*"{=\}@
@ ¢{ ! \ "¤ "^Õ{
@@<\@|||
|||\*{@@\"*=^ !{
<= \ " *= = *={ " = \
" * { @ * \ @} " " *@{
~\=@^Õ="<*"\@"<
@" @@{ * " @ < \
<@^Õ{{\"\
" \@ \ @ "<"§"@@^""¤<Õ{"¹¤{{
! {{¢ ¤ = ¤ \@
<"}{
"@\@||||||@\{{{
<={ ^ = ^! @ * * @ @\
@ "{ " \ * *
=*=@\@@*"=|@<
\={#"=@\@{>@
@@@\"=|{"=**=
@ @\ @ 0 0¤ * "<={
|@=@<@""@
@"<"=<"<¤{
^>^^>^"^>^^>^@=^Õ
\ =} * "{ = ¤ \ > {{¢©{ | * ^>^ ^>^ " * ¢{{¢
; = {{¢ ; \ { |= " {¢ {{ @ " ^>^ ^>^ \ \¤= \@ <= \ " > {{©{ | * " " * ¢{¢{ ; { |= " \ \ {
{{!""##{!@
""5{
|*"@@@<"@*<=
<< <= \@ \ { != @ @@
**}@@
*=@{|@*"@
!{
"#!*<={
"#=<=<*"
*
¥¦!{{@{{^#{{{!<=@^*
=@{##*{{«¢{
¥¦ { ! { ^{ { " { { ° { @ |{ #{ {
! @ \ @ @{ !{ @{ !
@= @ @ ¤ | =" " |= "
«¢
*
¥¦ "¤<Õ Ü{ Ý¹¤ ^{ Þ¤<¶ { ¤"¶ #{ àÛ<¶ { "¹¤ #{ ª !* * ^Õª
""">Û<<@{#<{
¥¦ "¹¤ #{ "¤<Õ Ü{ #§¤<Õ ^{ #¶<¶ #{ " !{ ª ^ ¤ =
""*="=\{!»^"ª¢{
B"
@\¤\"*=§ != !<¤@<
!=!^{
94
95
$

$&
!D(
&
!"!
@
& $'!"
'/
E/<!4
6B
'31'&
'
16&
@=@"=#@@||"@=#
@¢¢|
#*=>*!\\;<=^{#{{||~{
^@=@ * \ \ @ >*\<{=\\@@=@ª
""<=<=*=@="
@ "*= \ " @{ ^" @" \ = @
" @ * { #" "* @" \ " @ * {\*=@*@\@
@ " \ *= @ *" @{ !* <= @
*\*="@{@@@*""
@ = = <= {" {" {" {" \@ " " {" {" {" {"{@"*\{"{""@=
{"{""@={""
9#"{
"\\{@="@©
=*@\{}=\@@@==}{@}=
ª " *= < @ "" " " < \ * "\@@*"@*@{
! * °¢ * \ = \ °< *@ @ |{ @ \ * *@@=@}¢~!"{""
\} " *= °¢{ " " " " "@ " @ " " *
=@*\"{\"*
"{ "" ¤ "* " ä @ \@
"¢@¤\}*=@{|"*
" ä " @¤ \ " "
"{;@ "" © "
\*{
@ " " # # # " & , { @ " # #
# { @ " { {
< = { { * = { {
{¢{¢"@{{{@\
*{
"@ < \@ " \ * = } " ^¤" {
"#}{
*
¥¦#@ {~=<^{*={}§}¤#{*{<\ª"
*{!#*=@=«¢{
¥¦ #" { ¬{ " { ! < @ *= }= "<={"!^@==«{
¥¦ °@*= ³{ #= °{ @ #{ { @= { # ^{ @*@ { \ °{ » @@ ^{ °{
°@="<}"*@{"@=«{
96
97
Plasticity in the gut microbial community and uptake of Enterobacteriaceae
(Gammaproteobacteria) in Bombus terrestris bumblebees nests when reared
indoors and moved to an outdoor environment
Laurian Parmentier1, Ivan Meeus1, Hadi Mosallanejad1, Dirk C. de Graaf2 and Guy Smagghe1
1
2
Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium
Laboratory of Molecular Entomology and Bee Pathology, Faculty of Sciences, Ghent University, Ghent, Belgium
Bombus nests consisting of one queen, brood and worker adults, are produced indoors for biological pollination
in agriculture. In this study, we investigated on the gut microbial community in workers of B. terrestris when the
environment is stable (indoors) or variable (outdoors). When nests were reared indoors under standardized
conditions, we identified a small gut microbial community consisting of Neisseriaceae, Orbaceae,
Lactobacillaceae and Bifidobacteriaceae, and the age of bumblebee nests and workers did not affect the alpha
and beta diversity, confirming a stable microbiota. Secondly, when indoor-reared nests were moved to outdoors,
we observed a major shift in the microbial community, especially in the newborn workers fully developed in the
outdoor conditions, with a significant colonization of Enterobacteriaceae. Our new findings are discussed in
relation to host-associated core and non-core bacteria in bumblebees including possible important implications
for host functioning of reared bumblebees in the wild environment.
Predatory fungus (Zoophagus sp.) as a threat to rotifers inhabiting activated sludge
A. Pajdak-Stós and E.Fiakowska
Institute of Environmental Sciences, Jagiellonian University, Gronostajowa 7, 30-387 Kraków, Poland
One of the most promising biological tool to control bulking in wastewater treatment plants (WWTP) is the
usage of Lecane rotifers which are able to ingest most common types of filamentous bacteria occurring in
activated sludge [1]. Unfortunately the knowledge about factors limiting development of rotifers populations in
wastewater treatment plants is scant. One of the possible reason of the failure of rotifers application in WWTPs is
the presence of natural enemies, among them predatory fungi. Apart from the paper by Cooke and Ludzack [2]
describing rapid growth of Zoophagus insidians in their experiment on nitrile wastewater there are no studies
showing the influence of predatory fungi on the rotifers in activated sludge.
We investigated the influence of predatory fungus Zoophagus sp. and the temperature on the abundance of
metazoans originating from activated sludge. In the preliminary experiment with native fungus, well mixed
sample of activated sludge was evenly distributed into 24 wells tissue culture test plates and kept at: 8ºC, 15ºC
and 20ºC for three weeks. Then each well bottom was scanned under Olympus inverted microscope to check if
predatory fungus has developed. As there were no predatory fungi in the plates kept in 8ºC, for further analysis
we used only plates from 15ºC and 20ºC. In 6 out of 8 wells kept in 15ºC and in 4 out of 8 kept in 20ºC we
observed clearly visible fungus hyphae attached to the bottom creating evenly dispersed net. All the infected
wells are further referred to as fungi+, the others were treated as a control (fungi -). Then we counted
representatives of metazoans in subsamples.
In experiment on samples of activated sludge containing “native” Zoophagus sp., the growth of the fungus was
strongly inhibited in the lowest temperature of 8ºC, whereas in higher temperature the fungus negatively
influenced the abundance of all rotifers taxa except for Lecane hamata. The most affected were Lecane
closterocerca and Lecane inermis which number was drastically reduced at 15 ºC and 20ºC. The presence of
Zoophagus sp. did not affect the abundance of nematodes. The experiment with Zoophagus sp. introduced
artificially showed that the abundance of both L. inermis and Bdelloidea are strongly influenced by the fungus
and the temperature as well as the factors interaction.
The results showed that massive occurrence of predatory fungus can endanger the population of rotifers - the
organisms considered to be important component of activated sludge as they significantly improve the quality of
effluent from wastewater treatment plants.
This research was supported by The National Center for Research and Development Grant GEKON1/O3/214361/8/2014 and
Jagiellonian University Funds DS/WBiNoS/INoS/758.
Keywords: predatory fungus; rotifers
References
[1] Fiakowska, E. Pajdak-Stós, A., 2008. The role of Lecane rotifers in activated sludge bulking control. Water Research,
42(10): 2483-2490.
[2] Cooke, W.B., Ludzack, F.J., 1958. Predacious fungus behavior in activated sludge systems. Sewage and Industrial
Wastes, 1490-1495.
98
99
&
*
6
*
"
'
&
:!
'
;
&
$
&
1
&
&*
3<.*$
$
%', ('/ ('0,
('4J(
4E%
B

<@==";<=@=^{>{¢
="
#^{>{~="
= @=<^! ;<=@=!{
#¤\}\^

^}}<"@^@@=";=^
{^}}*"=""<\@@\*<^{
^}} \ *@ ^}} <{ ^}} = ^}} < <
"\}Ê"¤\¿¢@"=*""@
@@@"=¥¦{
@= ¥"¦ @ *" " @ @ < < *"
@ * < @ " * { @ <= = @ *@
@ @ * <= @ \ "{ #@ "" }
* @< * " *@ @={ | @ * " @ @ = " @= @ @
\@@"*"=}<{|@"=\@@<
@ " *@ @= @ °£ ~£ § " = "* ^ *= @ * "= !
3 ! 3 &! !
! @ @ " ="{ @< * | \
*@@@=*@@<*
¤*@<"<°£~£§@="{
@"="*^@*@"@={
" * ¤\ @ @ | = @ = @
*@*@@={
|@\=@*"=""
} \ *@ \@ ^}} ^}} <={
\ ¤ #@ #= "= * =} *
@=@=@=*"=""{#=*\*
@=<¢~!¥¦{
"= @= @\< @ \ª
^* © " © !* © ¢
©\@<@@=\<={@"ª
@""{@}*=*
"" <*= \@ \ @ @\< <*= \{ ^= = * "= """ < @ *@<=""=@\@{*\
"^*\@<*"{@
"@ " " @<= " * "= ª
, K @" #
$/%"*{
"#*@*|
"#^}}<}*"=@"
*
¥¦}\¤{ª@""@<=<*ª
"";^{.#¢
¥¦}\¤{ª@@<=\@@^}}<{
.#
¥¦ #}< >{ # #{!{ ª ! " @ " {
.¢
¥¦ { { "* @{{ {!{ = { "= { ~{ >\ {#{ = { {
"#{ =~{ *{!{@ {°@{ª;@@@"@"*"==
@|"#{,(
+¢¢¢
100
101
Prochlorococcus sp. of the Red Sea
A. Shibl1, M. F. Haroon1, D. K. Ngugi1, A. A. Talarmin1, L. R. Thompson2, U. Stingl1
1
Marine Microbial Ecology Lab, Red Sea Research Center, King Abdullah University of Science and Technology (KAUST), Saudi Arabia
Knight Lab, University of California, San Diego, USA
2
B
&
$
B
,
+@
:6$
'@;
6%')=%'6_B,&
%'7 BB%'8 8
%'7 8
!(

Aquatic primary productivity mainly depends on pelagic phytoplankton. The globally abundant marine
picocyanobacteria Prochlorococcus comprises a significant fraction of the photosynthetic biomass in most
tropical, oligotrophic oceans. The Red Sea is an enclosed narrow body of water characterized by continuous solar
irradiance, and negligible annual rainfall, in addition to elevated temperatures and salinity levels, which mimics a
global warming scenario. Analysis of 16S rRNA sequences of bacterioplankton communities indicated the
predominance of a high-light adapted ecotype (HL II) of Prochlorococcus at the surface of the Northern and
Central Red Sea. To this end, we analyzed the distribution of Prochlorococcus at multiple depths within and
below the euphotic zone in different regions of the Red Sea, using clone libraries of the 16S–23S rRNA internal
transcribed spacer (ITS) region. Results indicated a high diversity of Prochlorococcus ecotypes at the 100 m
depth in the water column and an unusual dominance of HL II-related sequences in deeper waters of the Red Sea.
To further investigate the microdiversity of Prochlorococcus over a wider biogeographical scope, we used a 454pyrosequencing approach to analyze rpoC1 gene pyrotags. Samples were collected from the surface of the water
column to up to 500 m at 45 stations that span the Red Sea’s main basin from north to south. Phylogenetic
analysis of abundant rpoC1 OTUs revealed potentially novel genotypes that belong to the high-light and lowlight clades. In addition, we used a rapid community-profiling tool (GraftM) and quantitatively analyzed rpoC1
gene abundance from 45 metagenomes to assess the Prochlorococcus community structure across vertical and
horizontal physicochemical gradients. Results revealed the clustering of samples according to their depth and a
strong influence on ecotypic distribution by temperature and oxygen levels. In efforts to better understand how
the cells survive the unusual features of the Red Sea, we isolated a Prochlorococcus strain from the euphotic
zone, enabling us to morphologically characterize and measure growth rates for the strain. In addition, we
successfully sequenced, assembled and annotated the genome of the cultured strain for genomic comparison
between other isolates from different oceans. To address adaptive mechanisms and metabolic reactions through
gene expression levels of the Red Sea strain, we mapped metatranscriptomic datasets from the water columns of
the Red Sea, Gulf of Aqaba and the Mediterranean Sea to the genome. Through this research, we intend to reveal
how the environmental parameters of the Red Sea affect the diversity and distribution patterns of
Prochlorococcus ecotypes.
#*=Ð<Ð¶;<=""=
^@=! =Ð<Ð¶;<=""=

@"@°=°*"@~@#«=*@
"* { @ @ ° < @= < *
" @ @ @ @ } "\ \
={@ º""@"@}@°\@<
" @ *@ \ *@{ @ @ @ \ @ * @
"=""*<@¤"@<="@*@ º
{ < @ ¤= <= ¢ ~! * " * \
"{ < @ @= \ \@ @ * *{
^@==*@^*\@*"{|<
~@*"!*\*{!@@
*" * \ \@ @== = 5 \@ @
@="@"@{>@@==\*"=@@{@§=
@*@"@\@@@""""
<{
@@\"*=@"@">°!~°¢{
Keywords: Prochlorococcus, Red Sea, ITS, rpoC1, cultivation, metagenomics, metatranscriptomics, microbial ecology
102
103
L&
$
$$'"
$$
4*
"
*
$&
A
&:%
*E;"
&
"
$"$&
$
,!%'<-
!
%*!B
(
|"\@=|"*;<=@=^>"*
"@!

|"@@=!@*;<=!@* "§|{
E %'/('0*%' +
%',8
('/A
'7!8
%'70*
,
2.
%
#*"<@"\@@@=<
\ * " ¤ \ "= < " *=
@*}<"{@<*"\
"= \\ " *" @" { @ " @" * @
" # = " { ~""
@""}*"""
\ * * @{ @ * *= " \@ =@@{^=<@
=\"={
(

|@"=^=*""=\§\*@
{"#"<"\<{^\"
< { ^ = \ "@ " ^" } ^#! = "<
"<*@\{^=<
"#\*=;^\¤\@
"##<={|\*<@@<
^=\*;^="
!»!<=<@
¢;*¤"-2L !{@<@<"
\ å {© å {© = <={ @ \ < @
"*<*{"#\*<"\
< @ \ @"@ § = @ | \= !~>! Ë{{
@ < = *= <* <* * ^#!
" ³ * ^ = { @ @ * "} "< *
"="\*¤{
"#^=^"}=*="#!{
*
¥¦@ §=^@~@@~#"^@¤{<*
*"\@"@^#!^{<
%
¹ "|;! ;< >< } "º} ¢ # !"
{
¹>=;<><¶;¹><
!"
2
=^#æ|;!;<>< } "º}¢
#!"{
<;<=!"*¤"
@@@<@"@@{|!"
@""@@<="=@
""\@<@"*={"@\@@
@ @ >}¾ { É@ @" @=É{ @
" "= * @ @ *" @ @¸ "{ @ " @
"= } "= 5 " " \@!@~"^*{>"*@"
@=\@@"<"=@}""*
@<{{@"¤*@*={
@ " @@ "" \@ *=
* * @ *= @ " *= £ " < @<= *= * !
"<<"¤@{*"{
§¤" { °" { { @" *" @= =""*@@"{@@"=\
< * = "" "" \@*@
@{»{\@@@*"@"=@\
\@{@*\@@@}@\¤"
\ @ { @ <= * " \ = @"@ ~!
@="{!""*@=@}*\@
\@}{!@=*\@¢
@@}{#@\\@"{
< * < { " { %& $ %& { %
{ \ @ ! !||| @ *= \@ |!! " @ @ @ @
@<=!{"""@
<*{@%&{!< {
"{\*"{@"@\
@"|!!"@}@""*
\@\@@=*"@!{
"ª!@=*"@}*@=*!
*\@*
*
¥¦°"#{#{^"@#{°{@ { #{@!{{""*
* "" \@ \@ @<= <*={!#*«{
¥¦ *" { " !{ º}º" °{ { ^ *" @= ª!<\{<^"«{
¥¦§¤"#{@={^#{~{{{^<*@<=
@={@=!<¢¢«{
104
105
¥¦{{@{{¤|{^@={!"<^^@=^#¢«¢¢{
¥¦@!{°"#{°^{<{}{{°{^"@#{{@
*@*}@={=
@=¢«{
!
&$.
&
/'<'6"' <'*!
"&"'4' >'
A!)!!
@#"=!"";< §@#"¤""³=¤
|{
< <*@@"@*{|*=<{"
@" @"@ \" "@ <*{ < "@<<*"{|*=<
{ § * @ @ """ " @" @ @
|{@@*@=@"<<*{@
"*"""@*<*{@\\<
"@<@""""{
# !* < @ <= \ *< "
*" @ "" <= @ "" * * *<=
" < { @ @ @ \ !* !* @ <* * \ *< " <* * *<={ !*\ { \ "* | \@ \ "@
³=¤{@!**@"
@ *=@ = * "@ ~ * =@ ^=¤
=@@{""|!*\"*§*
@ *<= < {
\=={#\¢\
\@*=\""¢\"}"*
\@{"@=\"*<="{
"!*@<**<=<
{"\@=
*<={\*!*\@<=
"@""{
"ª|!*<
106
107
Shifts on bacterial community structure in Antarctica Fildes Peninsula soils with
different levels of metal concentrations
Siderophore-mediated iron dissolution from iron-bearing clays is controlled by
mineral cristallochemistry
J. Santos1,2, C. Magalhaes1, H. Ribeiro1, A. Padeiro3, and J. Canario3
A. Zegeye1, D. Parrello1,2, C. Mustin1, P. Billard1
1
1
Interdisciplinar Centre of Marine and Environmental Research, University of Porto, Portugal, Rua dos Bragas, nº 289,
4050-123 Porto, Portugal
2
Institute of Biomedical Sciences Abel Salazar of U.Porto, Rua de Jorge Viterbo Ferreira n.º 228, 4050-313 Porto
3
Centro de Química Estrutural at Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, 1049-001 Lisboa,
Portugal
Antarctica is one of the most isolate and extreme environments on earth with temperatures reaching -88ºC. Even
under these extreme conditions it is possible to find life inhabiting those ecosystems which have evolved toward
an adaptation to the extreme conditions. Understand how these communities are distributed under different
environmental conditions are of the outmost importance.
In this study it was intended to understand how natural bacterial communities on such pristine sites may be
affected by different levels of heavy metals (Cr, Ni, Cu, Zn, As, Pb, Cd and Hg). Twenty one sites were selected
from Fildes Peninsula, which is located on Kings George Island, characterized by its high density of human
presence. Shifts in Bacterial community structure were analyzed by using the automated ribosomal intragenic
sequence analysis (ARISA), and heavy metals levels in the same soil samples have been also analyzed.
Hierarchical clustering analysis shows that bacterial community structure among sites yielded low similarity
levels and therefore significant differences was observed between soils with different levels of metals
contamination. Further statistical analysis is required to understand how natural bacterial communities may be
affected by different levels of heavy metals.
Keywords: Fildes Peninsula, Antarctica, Bacterial community, Trace elements
Laboratoire Interdisciplinaire des Environnements Continentaux (LIEC), UMR 7360 CNRS - Université de Lorraine, 54506
Vandoeuvre les Nancy cedex, France
Present address: Civil and Environmental Engineering E2509 Lafferre Hall University of Missouri Columbia, MO 65211,
USA
2
Bacteria living in oxic environments often experience iron deficiency due to limited solubility and slow
dissolution kinetics of iron-bearing minerals. To cope with iron deprivation, aerobic bacteria have evolved
various strategies, including release of siderophores or other organic acids which scavenge external Fe(III) and
deliver it back to the cells. This research investigated the role of siderophores produced by Pseudomonas
aeruginosa in Fe(III) acquisition from two iron-bearing colloidal nontronite clays (NAu-1 and NAu-2),
comparing differences in bioavailability related with site occupancy and distribution of Fe(III) in the two lattices.
Indeed, these are phyllosilicates of similar composition with two tetrahedral sheets per octahedral sheet (2:1
structure). The structural Fe(III) are located in both the tetrahedrons and in the octahedrons for the two
nontronites, the main difference being that 2 % of total iron is located in the tetrahedral sheet for NAu-1 against 8
% for NAu-2.
To avoid direct contact of colloids with bacterial cells and uncontrolled particle aggregation that can lower the
reactive surface area, stable suspensions of nontronites were homogenously dispersed in a porous silica gel
before dissolution experiments [1]. A multiparametric approach coupling fluorescence and UV-vis spectroscopy
to spectral decomposition algorithm [2] was implemented to monitor simultaneously Fe(III) solubilisation and
the production of pyoverdine (the major P. aeruginosa siderophore) in microplate-based batch experiments. Both
nontronites released Fe(III) in a particle concentration-dependent manner when incubated with the wild-type P.
aeruginosa strain, however iron released from NAu-2 was substantially greater than from NAu-1. The profile of
organic acids produced in both cases was similar and may not account for the difference in the iron dissolution
efficiency. Likewise, no significant changes in Fe(III) release could be observed with a mutant strain defective in
phenazines production, suggesting that these redox-active compounds may not contribute to the dissolution
process. In contrast, a pyoverdine-deficient mutant was unable to mobilise Fe(III) from either nontronite,
whereas iron dissolution occurred in abiotic experiments conducted with purified pyoverdine.
Overall, our data provide evidence that P. aeruginosa indirectly mobilise Fe(III) from nontronites primarily
through the production of pyoverdine. The structural Fe(III) present on the edges of Nau-2 rather than Nau-1
particles appears to be more bioaccessible, suggesting that the distribution of Fe, in the tetrahedron and/or in the
octahedron sites, governs the solubilisation process.
Keywords: siderophore; Pseudomonas aeruginosa; iron mobilisation; nontronite.
References
[1] Grybos M, Billard P, Desobry-Banon S, Michot LJ, Lenain JF, Mustin C (2011) Bio-dissolution of colloidal-size clay
minerals entrapped in microporous silica gels. J Colloid Interface Sci 362: 317–324.
[2] Parrello D, Mustin C, Brie D, Miron S, Billard P (2015) Multicolor whole-cell bacterial sensing using a synchronous
fluorescence spectroscopy-based approach. PLoS ONE 10(3): e0122848
108
109
<-)
$
#3
"
Solubilisation of synthetic minerals by metal-resistant bacteria
H. Vojtková
Institute of Environmental Engineering, Faculty of Mining and Geology, VŠB – Technical University of Ostrava,
17.listopadu 15/2172, 70833 Ostrava – Poruba, Czech Republic
7@
%'F7('<
A%'F%' %'!
6%
The paper experimentally verifies bioleaching capacities of selected Pseudomonas bacterial strains and their
efficiency in the release of toxic metals from synthetic minerals, namely adamite and olivenite, containing toxic
arsenic. Based on the interactions in the As-mineral – toxic metal – microorganism system, it aims to quantify
the morphological and structural changes in the solubilised minerals at the microscopic level.

#*#"=@"~;<=@¤{³""
§"*°
<=>|@;<=|@"*°
@="=<¤*"@*§@\
*@ " 3 @ "{@ "@*
}"<"@\@*<""¥¦¥¦{@"
@"\"*"@\<{|@"=@
*3\\°"<¢±¾~±¾°{!
\""<@@\\ଇ{ \@"
"\{!\@@==@\
<¢"@=\@§"="=\
"{ > " \ " \@ 3 3 # 3 #
!!#{>@"\"\@3$||3||{
@ " " " @ \ <={ @ @=
@}<<@*<=¢"{\*<
@@=@*"@={
Introduction
The physiological interactions of microorganisms at the morphological and structural level of minerals are
conditioned by their biological activity. Learning about their mutual relations and dependencies helps to predict
their behaviour in various systems. It has been established that the presence of microorganisms accelerates the
bio-geochemical degradation of minerals, which leads to the liberation of elements into the surrounding
environment. Increased mobility of elements in the given environment subsequently influences their
bioavailability, transformation and form of occurrence in the chemical compounds.
Materials and methods
The model As-minerals, namely adamite Zn2(AsO4)(OH) and olivenite Cu2(AsO4)(OH), were synthetised via the
reflux method. The synthesis took place on the grounds of the required stoichiometric composition of adamite
and olivenite, including their morphology, which was confirmed via SEM microscopy. VESTA programme was
used to visualise the spatial representation of the crystal structure of the observed minerals.
"ª3@\<¤*<=="
To identify the most effective microbial species, we used various types of bacteria from the Pseudomonas genus
retrieved as new isolates from anthropogenically arsenic-contaminated localities. Bioleaching experiments lasted
for 30 days using the method of static cultivation at standard laboratory conditions. The efficiency of As
bioleaching process was assessed in an FC analyser EcaFlow 150 GLP (Istran, s.r.o., Slovak Republic).
Results
In the release of As from both minerals, the most efficient were the following strains P. chlororaphis ZK-1
(93.13 %), and Pseudomonas sp. SL-2 (73.10 %); and two strains P. monteilii CCM 3423 and Pseudomonas sp.
ZK-3 had analogous efficiency (42.86 % and 40.36 % respectively). During blind experiments with redistilled
water only roughly 1 % of arsenic released in both the observed minerals.
*
¥¦ {\{{"#{^{°<!<{°{{=@\*ª=
<*¢~!"¤¤<{:
(Rª
¥¦{}*{}*<;{°°{¤°{¤#{{@{{*""
§¤**"@\@*{
R%:(N%(;¢
Conclusion
The obtained results may be used as a methodical model to study the interactions between mineralogical
substrate and microorganisms. The results are significant for the prediction of element mobility in the
biogeochemical cycles of toxic metals in the environments contaminated by mining and industry, as well as in
the processes of modern mineral biotechnologies in recovering metals during recycling.
Tab 1. Adamite and olivenite minerals
Keywords: bioleaching; solubilisation; adamite; olivenite; Pseudomonas
110
111
Taxonomy two original strains belonging to the genus Caldicoprobacter, producing
thermostable xylanase and protease
<
&&BAA<"
Amel Bouanane Darenfed
|"<;<=°¤\^
3B"B'1B!='73'A
&!B !&B
Laboratory of Cellular and Molecular Biology, Microbiology Team, Faculty of Biological Sciences, University of Sciences
and Technology of Houari Boumediene (USTHB), PO Box 32, El Alia, Bab Ezzouar, 16111 Algiers, Algeria
"@*<"<=**\=<
*"¤<"\\{@3\@@
" * "@ = ~ 5 , =
="@=@{@<=@
"\@{!@**"¤""^=@
\ = " * * "<< \"{
Terrestrial hot springs were found to be the original bacterial consortia tank. New phylogenetic lineages of
unknown species were determined using molecular techniques and the choice of the 16 S RNA like scoring
scalable. These prokaryotes have very different physiological and metabolic characteristics and are very
interesting from a biotechnological point of view, especially as a source for new thermostable enzymes. Their
use has led to the development of high value products used in the chemical, pharmaceutical, cosmetics, food,
textile and paper. Currently, proteases and thermostable xylanase, enzyme form the group most sought through
the advantages they present.
*\"{<"
^\<=*"@\""""*¤
@"ª½\\¤{@""\{
@@*"\@¤"*@\{@"
@\@<3{\@"\@{
"{\=@{@""@\"\
3{!33@<"@
"**\@3"{@¤@\@3
@ " \ @ \ @ \ \@
""*@½{!\¤@\
@ \ \ " @ " \@ \ "{ @ = @<<\@½""*3{!½3@
3@<\@*"<@\@3\@@{!@@@
"@\3\@<\@*"@\@3
\=@@{
Our work allowed to isolate and characterize in anaerobic conditions at 70 ° C, new bacterial species belonging
to the genus Caldicoprobacter (Clostridiales) from the hot spring Hammam D’ Bagh (Guelma). Xylanase
activity (250 U / mL) in Caldicoprobacter algeriensis and Protease (23000 U / mL) in Caldicoprobacter
guelmensis are found between 70 and 90 ° C. The results obtained from the characterization of two enzymes are
very promising.
Obtaining new xylanase and protease could lead to new biotechnology applications for improved performance of
existing enzymes.
Keywords: New species, Anaerobiosis, Hot Spring, xylanase, Proteases.
@"@@3@"**<
\@"\½{!@}"@\""
\\ \ " @ " " *"¤ < "{ \< @ \@ \ " <= @@ "@
@@"@<@""@@="*
\\{
"ª**"¤<"
@@\"*=@~@< °>~>¢
;<="~|~{
112
113
<
B
$
<"
&
$
&"
#
&
"
$
-4=&'
7!%'(' %') %'@*&
%'<6
%'4 Z
%

|#<@;<=^^""½
^^"
|"!*};{^"*{½^^"
7E%', %'6%'04 H
%' ,%'073
%' 6.%'
A
(' A('E*+%(!E/
%

"@*\@\<*==}{@
@\ \ \@ @ @= \ @@ @=
@ @ *= @ @ * "{ | @¤<"={~""@
@@"*=@*<
={ | @ "= \ <" @ " = @ " "
{ " < @ * " " = @\
<= \@ = @{ | " @ = <* @ @ " !@ } @ @ " ={
*<@"@"="@=@"
\"""<*@@\"
=@{
"#=!>!!><=""

=|"{#{@#~;<=*
";<¢*!
@="=@;<=*>*§*!

\\*¤@"@@<\*@{!@@
**|"@@{@"
|"@"@@¤\@"@\@@@
|=<\@@{\<|@<*\
\@<"="{|*@¤\*@@"@@*=
\*"="
\{@"\"¤¤=
{ @ *§< @ @ \ @ @ *
* \ "= " \ \@@ *" @ ""{
!"\\"@"=*@
" \ *"= < ! "¹ * ^<
!{|\"ª\@@@*"=
"@ <{ @ "= \ " \@ @= "={ @ \ = *=
|@"\@"<^
^ <" <" " ! <" <"=<" *<"
^ \ <* @" <" *= "" <* "
<"¬<"*==@=@{!\"=}
@ @ *\ @ |{ @ © < | < \
*=<{>@=}¨{©©|{{
¢{©©|{{¢¢{©©|{¢{@|<"<"*@*=
= \ @ <={ | = *= *@¸ !@ < @
@ @ {{ | @
@\<¨{¢*\@\**@
* @= < @ { @ "= @ @"<\@@@"@@*"=<©
\@@©¨{M<""
@ " @{ < < "= \ {© © | {¢{ <"©©|¢{{^¢{©©|{{@"<"
©©|¢{¢{¢<"¢{©©|{{<"¢©
©| {¢{ =<"{ @ \ \@ <" " @ < " @\<@@<"=}@"@
@={!@<""^@"<"\@{©@\
"@"@@={!\=^<*<"\@
<"<"<"=<"{
@<\<*"<"\@\
*=|"<""<@}@
<" " @ * * \ "= { @ § <* @"
<"^"*"<<@"
\ " @"@ @ = \ @ @ <" * @"
"{
"##*\"=*<"<"
114
115
<
-
"
%%
&
$
-"
-
>
3
"
:"
;
$
1
$:
;
)67* 7I
3' !.'/!'3!@@
@=#*=|;~^«®^";<=}¢!<
!^}{
@@!""";<#="°"""
#=
|"\"*=""=@"@*=\@@
\="@"@<\{@*@
<\@@@<\@<"@
{@="*@*"="\*{@
<=@@"@"""*==
{|@@"*"<"
** " @ < @ \{ @
*§<@"==@"!=*==
<"="""{|\
""\@@!={=""
@"*@{{¢<=§"
{{!=@""\@"*=©>©">
\"@{!="<="@\
}@{|\"=**"}@<"@
@ "¸ "{ ! @ @ = \ " "
@""}@{@\@\"*="
"@"@@""*@={
! @" " Ñ ± \ " @ "= <" \@@ \ \ ={ | \ " @ " @ " @ " \
{@"<=@¸@"@*"@@
@{@\"@"{|\"
@@=\<@"@""@@
=="@{
@ *= @ *<< " " # \
*=""={|@"=§"<"@*
\ " = * " " ª « " @
« " « @ « " @{!\"@¤\§"<"
*"{=";@*<"{@""@
*"*={¢«{©\¤\@@*@"@*"
*={©{@"@*"@"<<
*= @ @ \ "{ "" " @" " @
=@"*\@\""@@
@
"#*"
"#"<<*@
B"
#!^{~^!^^{
*
¥¦!{{{{{{#^{{{~{@@{{{
¹" "ª| " " ç } = " \ ª |
"=@}"={$"¹~<{
¥¦°{{{}{{{{ª#ºº!È
ª#@@"!{#! {
¥¦\{#{@"={<\^ª«{
¥¦#@!{{@{ {!*<}#{{!>={
¢{
¥¦>@{{°{°{#{{@°{@\@"@"!@=\
\@"~¤{<=«{
¥¢¦ §¤" { ^<" °{ { @ " \\{ " }"
#{
¥¦ { #{ { ^@ " ! { ;<= @ |
^§{^{
¥¦ ;{{ < ^ != { #@ " @ " = " <
@\ {@{^!¢{@;!ª>@
<{
116
117
&$$
"$
:*</;
/A%'!.B
%'*/B('/&%/ %

#""~@;<="§\°\

@|""<"¤§@"¤=

><@@<"@=
< <* "@ * \ <@ \@
@"<{"@**=@
\@@@<"==@<*@\*"*=*@
<¥¦{"@@"@@\¤@"
"*§*""{
" ~ "" = \@@ " "
{ !@"@ " { ¥¦ @ @ " " =
\@@<@{{<@@@<*"={
! * " @ " "" = * @= {|@"=@\<@<"=""
<"@@@=~<*{
="<#¢¢**\@
\@ ~" @ = @ \ " @< @ "" \ "" \ =
"@<*¸@¢~!{!"\<
*=\<\"*{
|@\@=@=\"*<{
\@~{
3
%{~"""<*>¤\!{@
@\=~"@"{*ª{
"#"~^@""
*
¥¦ " # ¤ # * @ < #* @ @*{#*{ª«¢
¥¦" #<<\@@"={<{
#*{ª«
118
119
A new target for highly specific molecular detection of Escherichia coli by PCR
amplification
Alfredo Simancas, Felipe Molina, and José Emilio Rebollo
Área de Genética, Departamento de Bioquímica y Biología Molecular y Genética., University of Extremadura, Avda. Elvas
s/n, 06006 Badajoz, Spain
A significant amount (approximately 0.1%) of the total bacteria within human intestines is represented by
Escherichia coli. In newborn’s intestines E. coli, together with lactobacilli and enterococci, represent the most
abundant bacterial flora. Escherichia coli scarcely causes sickness but some lineages, like serogroups O157:H7
and O104:H4, are commonly associated with foodborne disease outbreaks. Most outbreaks of O157:H7
infections are caused by the contamination of ground beef but raw milk, and other foods, including sprouts, have
also been implicated. Therefore accurate and highly specific detection of E. coli is critical to establish the
microbiological safety of food, water and clinical samples. The presence of -D-glucuronidase, encoded by the
gene uidA, is extensively used to specifically detect E. coli in food, water and clinical samples. However, -Dglucuronidase is an inducible enzyme and its activity is affected by incubation temperature and the growth
medium. Although primarily limited to E. coli, -D-glucuronidase activity is found in other bacteria such as
Flavobacteria, and it is frequent in Yersinia, Salmonella, and Shigella. Conversely, a high proportion of -Dglucuronidase-negative E. coli strains has been reported [1]. An mPCR assay was developed to target uidA gene
for the common detection of E. coli and Shigella in milk [2]. Fricker et al. (1994) analyzed water samples and
found that some non-E. coli coliforms were identified by uidA primers [3]. These results indicate that developing
alternative primer sets might be required for improved detection. Therefore, we wanted to design a PCR primer
set non-redundant with the target of the enzymatic tests, i.e., an alternative to uid amplicons. Although orphan
genes are ideal targets for the specific detection of E. coli, comparative genomics has revealed that most of them
depict a narrow distribution, i.e., orphan genes tend to be lineage specific. Furthermore genetic variation within
the four species of Shigella is encompassed within the range found in natural populations of E. coli. Thus finding
a gene suitable for identification of all E. coli serotypes but absent from Shigellae is a challenging task.
Here we have evaluated a new target, an orphan E. coli gene, showing wide within-species distribution and
compare the detection accuracy with that obtain for assays measuring uidA amplicons and -D-glucuronidase
activity [4].
Keywords: Escherichia coli; PCR; Molecular detection; Food safety; Food microbiology
References
[1] Feng P, Lum R, Chang GW: Identification of uidA gene sequences in beta-D-glucuronidase-negative Escherichia coli.
Appl Environ Microbiol 1991, 57:320–323.
[2] Riyaz-Ul-Hassan S, Syed S, Johri S, Verma V, Qazi GN: Application of a multiplex PCR assay for the detection of
Shigella, Escherichia coli and Shiga toxin-producing Esch. coli in milk. J Dairy Res 2009, 76:188–194.
[3] Fricker EJ, Fricker CR: Application of the polymerase chain reaction to the identification of Escherichia coli and
coliforms in water. Letters in Applied Microbiology 1994, 19:44–46.
[4] Molina F, López-Acedo E, Tabla R, Roa I, Gómez A, Rebollo JE: Improved detection of Escherichia coli and coliform
bacteria by multiplex PCR. BMC Biotechnology 2015, 15:48.
#
&
&
'0 /X','7X'/
'4'*'*4'
4'7'
!')' '.'
*'*4!C
'))*

|"@=@«~";<={!<{;
^{®{}{
è@"@*""=@\¤{
@*"\@@@<<"
<*@=@@={|@@*
=@""<"¸\@=**\@@
*=@""{@*\"""
<\@3!{<"\©
*=!¢={"""@
\=\@}\"<©\{!\@"
\"#@#*@¤\"3{¥¦{
@<"@""\}=¢{@
""\©<""*@"{*@
*""3\"*@"}**<
" © <" { @ 3 \ " ¥"""©¦{@<*\
"*="@"#@\@¤{!\
{ @ " @\ @ @ "" " * * < * ""*3\@{\@@\*<=@@\@
©©"""\*
@@3\@#{@"@\*=*
\@ @\ *@<{ @ 3 @\ \@ @@@@@<\@#"*@{|=@*"
"< \@ © { ; © { ; * @\ @"""\@@<@"""
\@@\*"{@@{@=@<@@©
@@@*\@@@@\{;{;
\@ <={ ~<@ *@ = < @@ * \@
\@#"¢{;{>@"¥¦@<@\@*=
= " < " @ \@ @ @ "* =\@*<*@<"@*{@@
\<"@@@"\@"*
"\@@}@*"@{
"#***"3{
*
¥¦}}>#"@=!##!}#¤{**@=
@\@3{#*=<{{¢{{
¥¦ # ° { ;} * *@= *= = @" <{
!#*=<{{{{
¥¦ = ^ "* ! ¤ ^ { * \@ < * \@ *<={ " !"" @= <{ {
¢{{
120
121
-6%'6(,%,(!$)
&$
@04
$
"'
/ )
3
V!'
'E
'*!
@
8
'76&4'
44Y
*
%')*
%'7E,
V
(' ,H$2'* 4( 7+
%

={"{;<!"@""
<{#°{{;<{^@{#º{
;< "§"°{{{|"^¢|" "§"#º{

;<" "§""¹°{{^ "§"#º{

#*==;<={#¢"§{

!=@=;<={#¢"§

^@="=@;<=;!<{¢
#

!!"""== *"=*=
#{|@=@@{
"!!"!!
! ! {!@@
""<@}{*="=""=
"@}@@{@@"=\@
@ " ! ! ! ! \ *= } =
@{
=\{!\=}
" } @ << < = \@ «\
¢ª << " " \ ± " \ { #^{ " "
!"= " " @@ " ! * ^"
" À{¢ { Æ } " <} \@ "
{
@ @@ < \ * ! \ ! ! ! { <= \
@@¤\@{@@¤\@{{<<\
\=\¤\@@@@=<@¤\@@\<{
@>\@@<"@
@*¤"À*\@*@<@*¤§{>
\{!!{! ! {@">$\
{!!{! ! {!!! ! \
{© {© {© {© @ <={ @ < " <
*\{{Á¤{<!"¤"@
"<=\\@"{@@"="@<
{
@@"=\<="#«#}"«#
<" @ " @ @ " < @@ " <*{ # \ * *= * { | < <= \
<" *= <" # © \@ ^! @{@= \ \@Æ"# %&%
"*=±{=\@\*@@@
#{!©#\<"*=\*
@ @" @* = "* " ½{=@©#©=\@"\@
=@=<<<*<"\@@###
© # © \ < @< * @ @ " \*=@=**={
@"@\@#©@<"@"*
@*"\*\@©@#©#*<"
\@©==ª{{{<=¢¢@=
\{@ \@ ©# |© = © @ \@ < *="\@=\*<@"{
@§*<\@=@*@#@=@\
@=@=%&%{@\
< # \*= %& @\ @= @==<={
| " @ "= ""*= < @ * @=@ " " <*\@**@}"{
B"
@ "@ ¤\ " #|~> @ <
^§! {
"#"^¤=#
#N(*=@*<{! \@#'O 'O%&&
%'#<\@"@={
"##}"{
*
¥¦@§=^@;#^{{^@@"^
<\{"#ª{
¥¦ !*""" ^ # ^¹! ^ # "} !
^!{{#"@ª¤*="*{!
"{!ª{
122
123
&
:;
-
&$
&
6
&04!..< !5 !
4 %'6]
%'!4Y
%'7 ,(' 4
('64Y27
6E
8
%
<!
%') HE
('@
8
%'7)
8
(' ,4=&%'3+
/
%

!=@=~"@=;<=
"
@=|"#@||#|

!=@=;<="##

~"=¹!^""|¹!
;<="!<{!"¶}¢§}{

@|"!""|~!¬" <!<{!"¶}¢
§}{

><<@"=*"@=\"**<"
\@@<<*"@"<"¥¦{@@@
"@@"@"*"
<= \@@ @ < * ¥¦{ "@ " @ " <" <@<"*="@<"=@*§<
@@\@*<""*"*<
*{|@"=@<\}=¢*{
@" @\ @ * \@ == \@ @ < {
"@@<@\¤@*==@**\@@
\ * ª ! ! 3 ! !
{@@<\"*""
@<@"*<{
"<=**<=*<{
*
¥¦^"#}"**~"{{K{
<<ª!{+#{
¥¦>³{{!*<<"*@K
{,#{
@ * @ = = @ "@"="{*@@@@
"{ @ * = <= @ < { | @=@*<"@=@"
< @ @ " @ *"{ "= @ <<@"*@{!"*
@"@<*<*@*@
{
>" @ @ *¤ "" * { @
* *¤ * @ *= }== " =} = *= # { | @ \¤ = "
@@= " \@ = = ||##
< \ " @ \@ "*" = \@ \ \@ "<*"**~|{;}#@"*
@@@\@
""*"{"@"
"@@"@@"}@
"*=<*"*"@~|{
@<@*¤="**
{ | @ @ @ < * \ " 3@"""*=
<= " = = "ê{{ @ \*=@"@\"{@=
@ * \@ \ =} *= |##{ ^ *
@ = " @ { @ "
"<=""==}*"@<\@"*{@*
**=}="*"{@"
" @@= # # # ## \@ = } @ " } *= @@*" < #
""{
"@"\@@"@
@"}@"*=<*"*{<
@ @ {{ $; #!> \ "
*@\@"=="{
* @* *\ @ " @=
@ * < @" @< * " @ * <{ @" " @ * *\ @ " = @ * @" @< * * @ " {
|##==@*<"""
"*{@"=@\@
"<*¤{
124
125
*
¥¦ Ð@ °{ { { @ < * *=
#!|>{@{~<ª¢
¥¦**"{{@{{#{##{{¤{{"@!{{¤\¤{{»=
!{^{ { "* @} \@ " *= # =*
^{!{<{#*{ª¢ª¢¢
Bacteriocin: Antimycobacterial activity in milk and its molecular characterization
1
K.E.N. Nwanekwu, 2R.N. Nwabueze, 2J.C. Orji and 2S.U. Oranusi
1
Department of Microbiology, Imo State University, Owerri, P.M.B 2000, Nigeria
2
Federal University of Technology Owerri, Imo State. Nigeria.
B"
@\¤\"*=ª@§@#==<=! {@
\¤Å!"*=@>#"{
Bacteriocins have received considerable attention due to their potential application as biopreservatives, especially
in dairy industry. The inhibitory activity of bacteriocins produced by Lactic acid bacteria isolated from raw cattle
and goat milk and other processed milk products against Mycobacterium bovis in milk was studied using
spectrophotometry. Six bacteriocin positive strains of LAB were isolated and identified as Lactobacillus
acidophilus, Lactobacillus casei, Lactobacillus fermentum, Lactobacillus brevis, Lactococcus lactis and
Streptococcus thermophilus. The antibacterial activity of the bacteriocins were first screened against
Staphylococcus aureus and Pseudomonas aeruginosa, Escherichia coli, Klebsiella sp and Lactococcus sp. The
bacteriocins were shown to inhibit the growth of the organisms with diameter zones of inhibition ranging from
10mm to 26mm. The antimycobacterial activity of the bacteriocins in milk showed that the bacteriocins from
Lactobacillus inhibited the growth of the mycobacterium over a period of 15 days while bacteriocin from
Streptococcus did not inhibit the M.bovis in milk. However, there was a resurgence in growth on the 18th day as
shown by increase in absorbance. The bacteriocin mix from all six bacteriocins against M. bovis was the most
efficient when compared to that of individual bacteriocins, recording a significant decline in absorbance from
0.79 to 0.026 even on the 18th day. The genetic analysis of the LAB to determine the presence and localization of
the bacteriocin gene showed that all six LAB lacked plasmid. The presence of bacteriocin coding genes in the
chromosome was investigated by PCR amplification with primers for bacteriocin and was confirmed to be
present in the LAB chromosome. The molecular weight determination of the bacteriocins showed that the
bacteriocins were less than 5kDa in weight thus they are of the class I bacteriocin known as lantibiotics. From the
results, bacteriocins particularly bacteriocin mix would serve as a good biopreservatives and antimicrobial in
diary products against bovine tuberculosis.
Keywords: LAB, antimycobacteria activity, bacteriocins, milk, biopreservatives, plasmid, PCR
126
127
Bacteriocins produced by lactic acid bacteria isolated from Romanian traditional
fermented foods
6
L!,&
$'/
M. Zamfir, M.M. Stancu, I.R. Stefan, S.S. Grosu-Tudor
#*= *;<=^{#{{ *~{
!
&&B'.&.@
&&B/""
Department of Microbiology, Institute of Biology Bucharest of the Romanian Academy, Splaiul Independentei No. 296,
060031 Bucharest, Romania
| @ "= @ * "= °@ " * \
<{ "* °@ \ @ \@ @ <
""{{ {!¤##¤^{@¤@
\ *= =} = * \@ @ " \ @ * "{ @ ¤@ \ * " "*§ " @ <" "" { ! | * \ @< *= =
@==@=*@{@*"
" ¤@ \ { ¬ { ¬ {¢ ¬ { ¬ { ¬ \@ "{¬{¬{¬{¬{¢¬{{ {!¤#
#¤^<={@@@*"\*<¤*@@°@
\@ ^ @ @ \ " @ = @ = @
@"{<@@@"{©
{©!{©9!!!¢{©
"#\@{©!"#!"#
@ \ " @ * @ °@ = \ "*@@{
Many lactic acid bacteria (LAB), belonging to Lactococcus, Lactobacillus, Enterococcus, Leuconostoc,
Streptococcus, and Pediococcus genera, have been shown to produce bacteriocins (De Vuyst and Vandamme
1994). These are ribosomally synthetized proteins or peptides responsible, along with other compounds, of the
antibacterial effect of the producing bacteria, having a great potential for the use in food industry, to prevent the
food spoilage (Beshkova and Frengova 2012), but also with clinical potential due to the activity against human
and animal pathogens (Perez et al. 2014).
LAB used throughout this study have been isolated from traditional fermented dairy products, fermented
vegetables, and bors - a fermented beverage obtained from wheat brans and maize flour, used to sour the
Romanian traditional soups or as a refreshing drink. Selected bacterial strains were identified to species level by
molecular methods (including (GTG)5-PCR fingerprinting and 16S rRNA sequencing).
Six LAB strains, namely: Lactococcus lactis 19.3, Lactobacillus plantarum 26.1, Enterococcus durans 41.2,
isolated from dairy products, and Lactobacillus amylolyticus P40, Lactobacillus amylolyticus P50, and
Lactobacillus oris P49, isolated from bors, have been recently reported to produce bacteriocins (Grosu-Tudor et
al. 2014). The first three bacteriocins are heat stable, low-molecular mass peptides, with a wide inhibitory
spectrum (including Listeria monocytogenes and Staphylococcus aureus), while the other three are heat sensitive,
high-molecular mass proteins, with a very narrow inhibitory spectrum.
"#°@""=!*^"{
Bacterial growth and bacteriocin production were assayed in different incubation media, with different
compositions, including the presence of some commercial prebiotics or bacterial exopolysaccharides as the sole
energy source of the medium.
Cow’s milk was able to support a variable growth, but the bacteriocin production was high, especially for the
strains isolated from bors. In soy milk, on the other hand, the growth was good for most of the strains, but the
bacteriocin activity much lower comparing with synthetic media. MRS with an initial pH of 6.2 and containing
glucose or sucrose as carbon source was, in general, the best synthetic medium for growth and bacteriocin
production. Moreover, the use of buffered MRS (by addition of 2% CaCO3), resulted in a significant increase of
the bacteriocin activity for all six strains. Changes in the composition of MRS medium, such as removal of
Tween 80, replacement of the nitrogen source with tryptone, lactalbumine hydrolysate or casaminoacids, had a
variable effect on growth and bacteriocin production, depending on the strain. On the other hand, strains grown
under mild stress conditions, such as in the presence of low concentrations of NaCl or bile salts, showed a higher
bacteriocin activity as compared with the control. Bacterial exopolysaccharides, produced by LAB isolated from
fermented vegetables, used as the sole carbon sources allowed a good growth of all strains and bacteriocin
activities similar with the ones obtained on control MRS. Very high activities were also detected in the case of
Lactobacillus amylolyticus strains in the presence of lactulose and inulin, although the growth was much slower.
This work was supported by two grants of the Romanian National Authority for Scientific Research, CNDI– UEFISCDI,
project numbers 105/2012 (PLANTLAB) and 77/2012 (PROLAB).
Keywords: lactic acid bacteria; antibacterial; bacteriocins
References
[1] Beshkova D, Frengova G. (2012) Bacteriocins from lactic acid bacteria: Microorganisms of potential biotechnological
importance for the dairy industry. Eng Life Sci 12: 419-432.
[2] De Vuyst L and Vandamme EJ eds. (1994) Bacteriocins of lactic acid bacteria. London Blackie Academic and
Professional.
[3] Grosu-Tudor SS, Stancu MM, Pelinescu D, Zamfir M. (2014) Characterization of some bacteriocins produced by lactic
acid bacteria isolated from fermented foods, World J Microbiol Biotechnol 30(9): 2459-2469.
[4] Perez RH, Zendo T, Sonomoto K. (2014) Novel bacteriocins from lactic acid bacteria (LAB): various structures and
applications. Microbial Cell Factories 13 (Suppl. 1): 11-53.
128
129
6
&
B
:";6
>
'V
/
F'%'(6&%.&(
Biodiversity of the characteristic microbiota in refrigerated, frozen and heattreated donkey milk
S. Ozturkoglu Budak

#*==;<=^{#{°~

#*=°";<=^{#{\\\=°"~
Department of Dairy Technology, Faculty of Agriculture, Ankara University, 06100, Diskapi, Ankara, Turkey
=*. '¤=Ê¿=="*=
"~="{@@@=""={\<¤"
@ < @ @ " @@ @} \ @ "= @ { | @
"=@*"=@"@\"\=;<=
° ~ \ <" @ @ * \ { !
= * ¤ \ "@ \@ @ \ " =
;<={@\*=""*§*="*
" @= " @ ** "* @" { \"@"*§ ¾*@{@"
* @ " @\ @ @ " {¢ ¬ {¢ ¬
;{@"""@**"*@\@@
\@@{"@{@@}@
<@@=="""©@@¢
©*¢©@{©{
© * { ©{ @ @ * @ "@"@"*¤{@@
" @ < !\ "<= " " \@ < @=@"@@@*@""*{
"#=*¤!\@@}~
In recent years, interest in donkey milk was considerably increased due to its nutritional and functional properties
(Vincenzetti et.al., 2008). Its chemical composition is similar to that of human milk, therefore it can be used as
an alternative food source for infants who have cow’s milk protein allergy ( Carminati et.al., 2015).
The aim of this study is to investigate the changes in natural microbiota of donkey milk when different
treatments are applied. Samples were obtained from Arcadia breed originated from Turkey by machine milking.
In total 20 milk samples from 20 different donkeys were analyzed. For analyses, each sample was divided into
three; first and second parts were refrigerated at 4° C and frozen at -20° C, respectively and the third part was
again divided into four and each division was heat treated at 65°C, 75°C, 85°C and 100°C, respectively and
subsequently stored at 4°C
From each milk sample decimal dilutions with sterile Ringer solution were plated on Plate Count Agar,
suplemented with 1% skim-milk (PCM) and incubated at 35°C for 48 h, on Potato Dextrose Agar (PDA) at 30°C
for 5-7 days, on Glucose-Yeast Peptone Agar (GYPA) at 37°C for 24 h, on Violet Red Bile Agar (VRBA) for
total coliforms and incubated at 37°C for for 48 h, on de-Man Rogosa and Sharpe (MRS) for lactobacilli and
incubated anaerobically for 72 h at 30°C, and on M17 agar for lactococci and incubated at 30°C for 48 h.
Colonies were restreaked for purification and used for DNA extraction. Extraction of DNA was performed by
boiling the loopful culture in 500 μL in sterile demi-water. PCR amplification of the partial 16S rDNA was
performed in 2720 Thermal Cycler (Applied Biosystems, USA) with PCR GoTaq Green Master Mix (Promega).
Sequencing was performed with the BigDye terminator chemistry (Applied Biosystems) in accordance with
manufacturer’s instruction and analyzed on an ABI 3730 XL Genetic Analyzer (Applied Biosystems). Sequences
were edited and trimmed using SeqMan software in the Lasergene package (DNASTAR Inc., Madison, WI). A
homology search with the generated partial 16S rRNA was performed on GenBank.
Among the 88 isolates, 17 different species (6 Staphylococcus, 6 Pseudomonas, 2 Acinetobacter, 2 Bacillus, 1
Pantoea, 1 Corynebacterium) were identified by molecular techniques. No lactic acid bacteria, yeast and mold
were detected. The highest number of total aerobic bacteria were detected in refrigerated milk samples.
Approximately 1-2 log reduction was observed in frozen milk samples. Heat treatments completely destroyed the
microbiota at each temperature degree, but denaturation of proteins was observed especially at temperatures
higher than 75°C.
Keywords: donkey milk; microbiota; heat-treated; refrigerated; frozen
References
[1] Carmiati, D., Tidona, F., Fornasari, E., Rossetti, L., Meucci, A., Giraffa, G. 2015. Biotyping of cultivable lactic acid
bacteria isolated from donkey milk. Letters in Applied Microbiology 59, 299-305.
[2] Vincenzetti, S., Polidori, P., Mariani, P., Cammertoni, N., Fantuz, F., Vita, A. 2008. Donkey’s milk protein fractions
characterization.
130
131
6B
&
$
&04 !5 !
4
$
&
<(@<(-&
6]
%!4Y
4
7,76E
8
64Y4
%
%'7E,
V
(' ,H$2')*
%'* 4( 7+
%

!=@=~"=;<=!<*
"

|"#|<@@@""*¢¢

!=@=";<=#!<"#

#*==;<={#¢"§{
!=@=;<={#¢"§

^@="=@;<=;!<{¢
#

§ " *" *= @ " @{@@"**@=
*"=@*"*=@"<
"@@"{@@@
"@\@""<@<<
@@""""{
" \= " @= { ! {"=@\@
* @" @@{ @@ = " *= { @< * "*< = ! @@{ =
@=!@@{@=@<*@\@*~!~!
=@"~!@{
@"*=""@@=
@*""@*\=<@<{
"@""@^@=\*@{
@ *" * = " @ = @@
<@<*~"@;°@"@@=
* " @ ¤ = @ @ \{ "= * @{!<"¢;@*"*@@>"
@";{@@@\"="@
<"@=*"@"@
<{ @ \ " " < @@{
=#!|>=@@\@<@@*@
\@*=@@@=\@<
¥¦{ | "* " * \@ @ @ @< *
@}*=@{>"=\@
@"*@=@@"{@"
* = *¤ ¤ @< * ¥¦{ ~<@ #!|> #
@ * " <"""
{
! @ ""= @< @@
\*=*=-#@\@,{{\<@<=*\
"<{{§"
#{~<@@<*
@@@@*"@=="
@=@@*=*@¥¦{
<*@@"@*
= = "<= * " = @ {|@"=\"@@*¤@
@"*=@"{"@*¤"*
@@\{
@@\¤\¤\@<"
*=@@
<*\@@""@{
@**¤\"*=|##=@
=@*{@@\@
#!|>#=\@@*\"\@@@
*¤@@<=**=#!|>#={!@*
@<*="<@*=@
" { = @ @< * " @
*" "= "*= \@ @ <" @ *¤ *"{
\=}*=^\@@=**=#{¥¦{|@@@
< \ " \ *= *= \@ @" = "*½{\{ !½\=@"{@@
"=@"*=@
\@"<@"={@*"*<=""¤
@<=<"{
"#*=@"*=##
*¤
B"
{ @ "@ ¤\ " #|~> @ <
^§! {
*
¥¦ Ð@ °{ ¶}~ |{ { ^} #{ { #{ ¶}"} { Å { # ^{
@{
¥¦¶}~|{{Ð@°{ {#{¶}"}{Å{#^{@
¢{
"#*=@*=\@@"="<@"=@=
@¤"==
*
¥¦#º}<#¹{"=@\¤@{
@ < { ^@ @{ #*= = ;<= {{
¥¦#<#{!{#{º}#{#~{{|@*=@@*
\@ # " " {ª{
B"
@ \¤ \ " *=ª @ § @ #= = <=
! {@\¤{Å!"*=@>#"{
132
133
4&
$$
:)-/
;
$
*$
4$
(
#
$
"
7
%'0**6
%'.4),
%')0
%'*'
%'<4
!(0
!%
*=@="@@}*"@\}
7!
'*
.'4$
0-'0

*=#*=@;<=^¹*®^}
#;<=^*"^«}

* " = " "@ =@" @{ @= \@
@"<<"{|@"=
\="<@*\@@*@<"@@@"@"
*\@<@{
%&@*{{@""3#
" " "< @< @}" @ @ " @ ¤ <"{ >< =@ " } @< * @ @ }@@<"{\<@"@
="\*¤@@"@@@<"@
" { | @ @ \ <= = < <@"@@"{@=@@|¥=ë~
="¦@*<@<""
"@"<="=
* " ¥¦{ = > @< < @* \
<="{>} ! =}@""=
**@@\*"<
{ | @ * | > " @ *
*<==@=@<="{@>
* # {{ ~ > @\ \"
*<="@@*@«{>
@}*=@@\@@@*
@ *< @ @ > ¥¦{ @ "= <" @ = | > @*%*=*@"{@|¢
>{{Á*\<"@
= \@ @* # | % " @ \@ "* @" " ^ "* ± @{ @ @* | \ *<
""*{@""{@"
"*½@¥¦{@||£>{Á
| £ > { Á \ * @ " \ " \@ %
¢"<<"<=<={@<=
|\<¢@¥¦{|@
=@\@|¢@\"%\@
# |{¢{©\@"# |{©\@<*=>{Á{
@ " <= # | © \ *= > { Á \@ | > \
=*{@@@|¢@*|¢
\@>@\© |{@""@@*==
\@%"@*|>{@|
"\@%\\<<=@"<={@"@
*@ | > = = @ @ = @}" "@\=@\@\@"
*= | { @ @*= \ @= " \@ @ " "
*{@"@*|
><<@<@}""{
!*\*@=*=
<<{\"\@
"*@="<<\@"<=
@ * " ¥¦{ @ * <= \ < <= 3#"!,!
%9\*<{
| @ 3 * @ 3 ¢
33333$\"{
@"\@"<=<{<
\=@**<=@@={
@ 3 | \ " " " "
"""{#**"¤*§"<
{ ! @ < \ " *= @ ""=@""@3{
@ @ \ " " |" ~ @={ @ \
@ { \ "@ @ @\<*@{@@""
{ "@ <= @*" " \@ @ *" " \@ @ 3{ @ " @ @ @" @ \@ @ { "@ @ " \@@ " " { <
@*" @@= @" ==
" ¥¦{ @ @\ @ * \@ @ " @
@"{
" " \ { ! ="@ = \@@ "
@== § * " #"¤ @= ¥¦ =@ =@
==" " "" " " ¥¦ \ \@ " <={ "= "* "@ " < <
"<{
>"@\@3@@=<@=@\@
\@@ @= \{ @@"@" * \@< " < " @ * @ "= *= <=
"{@@@"\<
@ @ " <={ = @ @ @ <
"<*<@{
"#3"
"#**@<=
*
¥¦|{"#*#@ª¢
¥¦#<{#"~"»@{ª«
¥¦@\{^{ª
¥¦#=|#*{ª{
*
¥¦ ¹#{{"¢{
¥¦}}¤~{ {»¤{{(##,#!{
¥¦><{{{{(+
#«¢{
¥¦^º}#{~{{%
#Q!{
134
135
4$&
$
&
&
$
&&
4$*)4*3,
$ 6<^* aX'@
>0>)X' &
<*>*/X'
^/0<>*@/XX'
C
*,/FX',]
/>*FX
3, ' &B%',_4,_B(
%

*=!#*=="=">;<=^¢
>!{
#@;<=¢!¤"¤={
X"=!"";<="¤"<!"¤=

XX@°!@=;<=>=°¤"!>=
"¤=
@ \¤ @ @ " !^^ " >^|#> # ¬
^ "||}={@\@*=
"¤@ =" " { @ <"="""*@""{
&1
# | @ "= * \ * *@ "*="*<@*@
! ! 3
#\{
= \ =*= "*= \ =}{ | @ " *\ =
@\"*=!§"!{
# \ = " *= " "@
£{ !* <= * @ \ *= °*= "@{\<"!!*!!#<"*=^
@=<\=@=@{
@@<@@<=@<@="
{
||>^|#>@\*"*==\@#{
*
# @ * * *= @\ * ^!~¢@<*
!¢@<*
^ @< * @<
* 3 #{ * © # © *
© ¢© # © * © {@ *
\ " © @= © © @= \ " ¢© @= © @= <={ | \ " @ 3 # \ * @ @ @ * * *@ {
4#@\@*@
@ \@@ " " "={ | " * =
@<"@""<<{>@@@*
"*\@@@*<=@"@}@<
@""<<"@<"{
@"*"@}=@"*\
*@ @ < { \< " | \@ | <*@">^|#>\@#{@**
|{¥{{¦{@@"{
>@@@!^>^|#>="@\*==@^ |
|=!¨{¥{¢{¦¨{¢¥{¢{¦{^=\@@@"
=@<="={
"#=^ !^^{
"#@
136
137
)
$$$@
$
$&
Designing specific and efficient Lactobacillus based probiotics for broiler chickens
E
%'
%'!8
('.&
3
('<B!2'
,
%'7!
7 =%
Gh. Salehi Jouzani1, M. Ghaderi-Joybari1,2, N. Aazami1, AA. Sadeghi2, M. Chamani2, M.A. Afshar2
1
Microbial Biotechnology Department, Agricultural Biotechnology Research Institute of Iran (ABRII), Mahdasht Road, P.
O. Box: 31535-1897, Karaj, Iran
Department of Animal Science, Science and Research Branch, Islamic Azad University, Tehran, Iran

*#*ì#*##*!";~>@"*=
^=@;<="={

#*="=!"";<=
{

°>>#"^§#{

~>"{{{
2
~ @ < " } @ <¤ * @ *
@ @ ¬¬| "= ¥¦«¥¦{ ~ " @ @ \@ " <"@\=*@@"@@
¥¦¥¦{ >" "= \ * \@ ~> " = } = *
< ~{ | ¤ = ** * * = ¤¥¢¦{ @ @= \ < "©<\¤@@\=@@"\{
~<@*="=¤<@<
@\@""*¥¦{="""
\@<<<\
\<=*@}"@\¤@@¥¦*"
@*=""{|@@*""<\@@
"*{@@*@@**@*"
{*"@<¥¦¥¦¥¦{
@*§<@"=\@}@*=@"@="{
@ \ @"@" @ "= \¤ @{\ª{="=¤{
\{*"@*"=\=¤{#"=
@=\"@**<{
"#"@=<¤{
*
¥¦ { { !{ { ¶@}= !{ #{ !{ ¶@}# { { Ê < @ @" " Å ~
^¤¿#<{{{«!{{
¥¦ ^{{#"@!{#{ {{^{>{{°{{{^{{¤{{!@¤{{{
~{@{°{{{ {={{ =~{{ {{@{{#\{{#={#{{
{ * { ^{ ! { { "" #{ { !{ { " { { @\ { { @ { { ~@ { #{
>¸ { { ^ { { @*= { { * { #{ @ Ê * @¿5<{{{«#{{
¥¦ |{{{°"}¤{5N !:!{{
¥¦ { \ #{ = ;{ ¤* #{ !{ " { ~{ { { { @ !{ ¤ { }} { ~{ \= ^{
"¤ !{ @ { ! °{ "*@*@ { { <#{ ! ~{ \= !{ { "\
Ê@*=@\="=@*=@\="=¿{
¥¦ !{°@{}55--{{
¥¢¦ Ê^"æ~>"{¿¥>¦{!<*ª@ª\\\{{"{¥!ª!"¦{
¥¦ {@^{@=<{ "{#"=¤~{{Ê@*@
@="\=ª!<\¿8%<{{«{
¥¦ >{@<³{";{@<{\@Ê#@="<=\=¿{
~<*{«{
¥¦ ^{ \{{^{#{"}Ê>""\\¤¿8%<{{{«
{
¥¦{{"{{^{#{"}Ê<"\*@=ª!<\¿
<{{«¢{
The objective of the present study was to design specific probiotic bacteria for poultry applications. To do this,
about 700 lactobacilli and bacilli bacteria were isolated from ileum of some Iranian native chickens and ducks
(naturally having high resistance to biotic and abiotic stresses) by using acidified MRS broth (pH 2.5 + 0.3%
pepsin) and other selective media. After primary screening (Gram staining and Catalase test), 60 lactobacilli and
bacilli isolates with high resistance to acidic gastric conditions (pH 2.5) and high concentrations of bile salts
(0.5% Oxgal) were selected. The 16srDNA amplification and sequencing revealed that the selected strains
belonged to the species Lactobacillus crispatus, L. reuteri, L. salivarus, L. vaginalis, L.oris, L. agilis, L.
fermentum and Bacillus subtilis. Then, the strains with fast auto-aggregation rate (10 to 120 minutes), tolerance
to salinity (up to 15% NaCl), tolerance to low and high temperatures (between 4.5 and 45 °C), relative resistance
to 16 different antibiotics used in veterinary and medicine, antimicrobial activities against different pathogens
(Pseudomonas aeroginosa, E.coli , Streptoccus mutans, Clostridium defficile, Enterococcus hirea, Salmonella
enteric, Staphilococcus aureus), and high ability for adhesion to the Caco2 epithelial cell line (up to 40 bacterial
cells/cell) were selected. Finally, 6 Lactobacillus and 4 Bacillus subtilis strains with high probiotic potentials
were selected and used in the farm experiments. The objective of the broiler farm studies was to evaluate the
probiotic effects of the selected Lactobacillus and Bacillus strains on the yield (weight, feed conversion ratio
(FCR), breast and thigh yield and feed consumption ratio) and immunological parameters (antibody titers against
bronchitis and Salmonella, cholesterol and triglycerides contents, and also mucin gene (muc2) expression rate) of
broilers (Ross strain) challenged or non challenged with Salmonella. The research was performed during 42 days
at the framework of Factorial statistical design (5 (1- Six Lactobacillus strains (each strain 106 cfu/g feed), 2- Six
B. subtilis strains (each strain 106 cfu/g feed), 3- Lactobacillus and B. subtilis strains(each strain 106 cfu/g feed),
4- Commercial probiotic, and 5- Control (feed without probiotics)) x 2 (challenged or non challenged with
Salmonella) by using 300 one-day old roosters fed by a defined feed regime containing one of the above
mentioned probiotics. The results showed that the maximum increase in the broilers yield and immunological
indexes was observed for those chickens fed by feed supplements containing the Lactobacillus strains, but the
minimum was observed for the control. The application of the selected Lactobacillus strains could significantly
reduce the feed consumption rate (FCR) and cholesterol and triglycerides contents, and significantly increased
the total broiler, breast and thigh weight in both challenged and non challenged broilers. This also significantly
increased the antibody titers against bronchitis and Salmonella. The real time PCR results, also showed that the
presence of Lactobacillus strains significantly increased the mucin2 (muc2) gene expression rate in the broilers in
comparison to the control and other treatments. It was shown that the presence of probiotics (Lactobacillus, B.
subtilis or commercial probiotic) could not reduce death rate in the challenged broilers with salmonella, but they
could significantly increase yield and immunological parameters in the living challenged broilers. These results
confirmed that the selected Lactobacilli strains could be effectively used as specific probiotic bacteria for broilers
at commercial level after fermentation and formulation optimization studies.
Keywords: Bacillus subtilis, Broiler chicken, feed consumption rate (FCR), Immunological parameters, Lactobacillus,
Mucin gene (muc2), Probiotic, Salmonella challenge
138
139
)
E
0
B'
-4 !
$&
: !!;
&
Detection of Salmonella and Campylobacter in chicken rinse water using a surface
plasmon resonance sensor
B4*Z6'63
*'/44
!'.
,
4'!
<)'3
4
4$'E
0 *
Fur-Chi Chen1, Suping Zhou2, Samuel N. Nahashon2 and Roger C. Bridgman3
*#*!{#*|"«|;~^«""«^{
{
2
@ @= " @ " = <"
""{^"¤@==@"
**"=@*<\@@"
"*{@=}=
*<<@=@"{@"=<
\@ *< ® ^" }{ @ \ "* ¤ " @ ! ^ "¤ *=
^{@"@\*=@*@*@\
@ "* #!{ ! @ \ < \@©{©@\*<{@
@@"@<*"@<=
=@="@=@@
"@""*"*@@{
Contaminations of Salmonella and Campylobacter in poultry products are major food safety concerns to the
poultry industry and regulatory agencies. Regular monitoring of the processing facilities and final products for
potential contamination is critical for improving product safety. Rapid and sensitive detection methods such as
biosensors would provide effective and efficient monitoring tools.
1
Department of Family and Consumer Sciences, Tennessee State University, Nashville, TN 37209, USA
Department of Agricultural Sciences, Tennessee State University, Nashville, TN 37209, USA
Hybridoma Facility, Auburn University, Auburn, AL 36830, USA
3
We have developed a surface plasmon resonance sensor analysis for simultaneous detection of Salmonella
typhimurium and Campylobacter jejuni in chicken rinse water without prior enrichment. A three-channel sensor
was configured, each with individual fluid control system. The sensor was functionalized using monoclonal
antibodies specific to flagellar antigens. The sensor surface was constructed by depositing a layer of neutravidin
on the gold surface, followed by attaching biotinylated monoclonal antibodies specific to S. typhimurium and C.
jejuni into separate channels and a non-specific antibody into the third channel as a reference. An analytical
protocol including glycine-hydrochloride extraction, centrifugation and gel filtration was used in the preparations
of the chicken rinse water for sensor analysis.
By eliminating enrichment procedures which normally require 8-16 hours incubation time, the developed
protocol could be performed in less than one hour. The sensor specifically detected S. typhimurium and C. jejuni
in the coexistence of non-pathogenic E. coli. Quantitative results were achieved in a log-linear range between 102
and 105 CFU/mL in chicken rinse water for both pathogens. The detection limits for S. typhimurium and C. jejuni
in chicken rise water were 3.5x102 and 4.7 x 102 CFU/mL, respectively. The sensor can be used for repeated
measurements of negative samples without the need for regeneration of sensor surface. The same sensor surface
was regenerated for more than 50 times and the responses in the middle log-linear range remained above 88% of
the initial level.
The developed sensor is capable of producing quantitative results in less than one hour. This sensor analysis
provides a valuable monitoring tool for poultry processing facilities with minimal instrument investment and less
labor intensity than other molecular methods.
Keywords: biosensor; foodborne pathogens; food safety; monoclonal antibodies; flagellar antigens
140
141
Determination of an efficient and economic medium for growth of some probiotic
Lactobacillus strains using response surface methodology
Determination of seven Mucor spp. growth behavior in relation to cheesemaking
conditions
S. Akbari Vala1, 2, Gh. Salehi Jouzani1 and J. M. Sinaki2
S. Morin-Sardin1, K. Rigalma1, L. Coroller2, S. Madec1, J.L. Jany1, E. Coton1
1
Microbial Biotechnology Department, Agricultural Biotechnology Research Institute of Iran (ABRII), Mahdasht Road, P.
O. Box: 31535-1897, Karaj, Iran
2
Department of Biotechnology, College of Agriculture, Damghan Islamic Azad University, Damghan, Iran
1
Probiotics have received increasing attention as an alternative to in-feed antibiotics and for the purpose of
improving productivity in the poultry industry. Lactic acid bacteria (LAB), particularly Lactobacillus spp., are
one of the probiotic groups which make up a large group of microorganisms in the GIT of all humans and animals,
and currently have huge commercial importance in food and feed industry. Optimization of fermentation
conditions and also designing economic media toward reduction of probiotic bacteria production costs are known
as one of the most important aspects of economic production of the probiotic bacteria. The objective of the
present study was to optimize fermentation conditions, carbon and nitrogen sources and also design economic
media based on agricultural and industrial wastes for four native probiotic strains (OR7-86 (Lactobacillus
crispatus), Es7-44 (L. salivarius), Or10-130 (L. crispatus) and M4-7P (L. oris)) isolated from Iranian native
chickens. To determine optimum temperature, pH and preculture concentrations, growth kinetics of each strain
was evaluated in the MRS broth at four temperatures (32, 35, 37 and 40 °C), seven different pH (4-7) and four
preculture concentrations (1, 2, 3 and 4%). The strains showed significantly different growth kinetics when the
same fermentation conditions were used. The strains M4-7p and Or10-130 showed the maximum (Cfu: 5x 109)
and minimum (Cfu: 108) growth, respectively. The optimum temperature for all the strains was 37 °C. The
maximum growth of the strains OR7-86 and Es7-44 was occurred when 2% preculture used, whereas it was
occurred for M4-7p and Or10-130 at 3 and 4%, respectively. The maximum growth of the strains was occurred at
pH range from 5.5 to 7, and it was significantly reduced outside this range. The optimum pH was 7 for the strain
M4-7P, where it was 6 for other three strains. The effect of different carbon sources, including glucose, sucrose,
maltose, fructose, lactose and xylose on the bacterial growth was evaluated. The maximum growth of the strains
was observed at maltose, whereas the minimum growth was observed at xylose, fructose and lactose,
respectively. To determine the optimum nitrogen source, different nitrogen sources, including bacto-pepton, soy
pepton, yeast extract and casein were evaluated. The maximum growth of the strains was observed in the yeast
extract and soy pepton, but the minimum growth was occurred in the casein. After that, optimization of the
economic medium content based on the agricultural and industrial wastes was performed by using Response
Surface Methodology (RSM) in the format of a 3 variables Central Composite Design (CCD), in which the
variables were date palm extract (10-70 g/l), corn steep liquor (5-15 g/l) and malt (5-25 g/l). The results showed
that the strains had the same response to different concentrations of the date palm extract, and changes in the
concentrations did not significantly affect bacterial growth. The strains showed different responses as result of
malt concentrations changes, and therefore different concentrations of the malt were used as optimum for
different strains. Also, the strain OR7-86 showed different response to the corn steep liquor in comparison to
other strains. Finally, based on these results the optimum economic medium was designed for each strain.
The genus Mucor belongs to the Mucoromycotina subphylum and Mucorales order [1]. This genus includes a
large number of ubiquitous fungal species. In the dairy environment, some of them play a technological role
providing typical organoleptic qualities to some cheeses while others can cause undesirable effects including offflavours, anomalous textures or discolorations [2, 3, 4]. To investigate whether various Mucor species exhibit
different growth behaviors, we studied the impact of abiotic factors (temperature ranging from 0 to 50 °C, water
activity from 0.84 to 0.99 and pH from 1.8 to 13.6) on the growth of Mucor strains on Potato Dextrose Agar
(PDA) medium. The selected strains were representative of dairy technological and contaminant species (M.
circinelloides, M. racemosus, M. lanceolatus, M. fuscus, M. spinosus, M. brunneogriseus), as well as of a plant
endophyte (M. endophyticus, integrated as an outgroup). Data collected were used to estimate the temperature,
pH and water activity growth limits for each species on PDA medium. Growth kinetics were then acquired at
15°C on cheese agar medium and actual cheeses (Tomme de Savoie and goat cheese). Interestingly, a
preferential growth behavior was observed on Tomme matrices for M. fuscus and M. lanceolatus, suggesting a
potential adaptation of these technological species to this specific habitat [5]. Based on published studies, an
integrated model was adapted to predict the radial growth of the seven Mucor species on cheese matrices [6, 7,
8]. Relevant predictions were obtained in most cases, showing the potential of this model to be used in cheese
industry for process optimization. For some conditions exhibiting major phenotypic differences, a proteomic
approach is currently carried out to identify proteins potentially involved in this adaptation.
Keywords: Carbon source, Economic medium, Fermentation, Lactobacillus, Nitrogen source, Optimization, Probiotics.
142
Université de Brest, EA 3882, Laboratoire Universitaire de Biodiversité et Ecologie Microbienne (LUBEM), ESIAB,
Technopôle Brest Iroise, 29 280 Plouzané, France
Université de Brest, EA 3882, LUBEM, UMT Spore Risk, IUT, 6 rue de l’Université, 29 334 Quimper, France
2
Keywords: Fungal growth, Mucor, Cheese, Spoilage, Technological species, Predictive model, Adaptation
References:
[1] Walther, G., Pawowska, J., Alastruey-Izquierdo, A., Wrzosek, M., Rodriguez-Tudela, J.L., Dolatabadi, S., Chakrabarti,
A., de Hoog, G.S., 2013. DNA barcoding in Mucorales: an inventory of biodiversity. Persoonia - Molecular Phylogeny
and Evolution of Fungi 30, 11-47.
[2] Zhang, N., Zhao, X.H., 2010. Study of Mucor spp. in semi-hard cheese ripening. J. Food Sci. Tech. 47, 1-7.
[3] Hermet, A., Meheust, D., Mounier, J., Barbier, G., Jany, J.L., 2012. Molecular systematics in the genus Mucor with a
special regards to species encountered in cheese. Fungal Biol. 116, 692-705.
[4] Desmasures N., 2014. CHEESE. Mold-Ripened Varieties. Encyclopedia of Food Microbiology (Second Edition): 409–
415.
[5] Ropars, J., Cruaud, C., Lacoste, S., Dupont, J., 2012. A taxonomic and ecological overview of cheese fungi. Int. J. Food
Microbiol. 155, 199-210.
[6] Rosso, L., 1995. Convenient model to describe the combined effects of temperature and pH on microbial growth. Appl.
Environ. Microbiol. 61, 610-616.
[7] Pinon, A., Zwietering, M., Perrier, L., Membré, J.M., Leporq, B., Mettler, E., Thuault, D., Coroller, L., Stahl, V.,
Vialette, M., 2004. Development and validation of experimental protocols for use of cardinal models for prediction of
microorganism growth in food products. Appl. Environ. Microbiol. 70, 1081-1087.
[8] Dagnas, S., Onno, B., Membré, J.M., 2014. Modeling growth of three bakery product spoilage molds as a function of
water activity, temperature and pH. Int. J. Food Microbiol. 186, 95-104.
143
Differential count of Bifidobacterium spp using selective culture media in
commercial probiotic yogurt
&&
$&$
-
$
Luciana Rodrigues Faleiroa, Beatriz Silva Pereiraa, Inayara Cristina Lacerdaa, Jacques Robert Nicolib,
Tássia Costa Souzab, Álvaro Cantini Nunesc, Luige Biciati Alvimc, Marcelo Resende de Souzad, Evelyn de
Souza Oliveiraa*
7.L
!
*
!
"|¹!;<î«{^ª¢*{
a
Departamento de Alimentos, Faculdade de Farmácia, Universidade Federal de Minas Gerais (UFMG), Belo Horizonte-MG,
Brazil.
b
Departamento de Microbiologia, Instituto de Ciências Biológicas (ICB), Universidade Federal de Minas Gerais (UFMG),
Belo Horizonte-MG, Brazil
c
Departamento de Biologia Geral, Instituto de Ciências Biológicas (ICB), Universidade Federal de Minas Gerais (UFMG),
Belo Horizonte-MG, Brazil
d
Departamento de Tecnologia e Inspeção de Produtos de Origem Animal, Escola de Veterinária, Universidade Federal de
Minas Gerais (UFMG), Belo Horizonte-MG, Brazil
The microorganisms Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus are used as a
starter culture in other fermented milks. In addition to the starter culture, probiotic fermented milks may contain
bifidobacteria. However, Bifidobacterium are phylogenetically similar and have nutritional requirements similar
to the starter culture bacteria, which complicates the enumeration of this probiotic in selective culture media.
Reliable techniques for the selective enumeration of probiotic bacteria in fermented milks are thus required. The
objective of this study was to determine the most appropriate culture medium for the enumeration of the
Bifidobacterium longum 5 1A, Bifidobacterium breve 110 1A, Bifidobacterium pseudolongum 119 1A and
Bifidobacterium bifidum 162 2A species in the presence of different S. thermophilus strains from commercial
starter cultures of yogurt. For this purpose, 11 colonies of mixed commercial cultures containing the species S.
thermophilus and L. bulgaricus or pure cultures containing only the species S. thermophiles were isolated,
purified and subjected to repetitive element sequence-based polymerase chain reaction (rep-PCR) to differentiate
the strains. Of the 11 isolates obtained, 9 different strains were identified, indicating the presence of distinct S.
thermophilus strains within a single commercial culture. The results showed that for the selective enumeration of
a Bifidobacterium strain, the most appropriate culture medium depends on the S. thermophilus strains used in the
starter culture. In this study, the culture medium B-MRS showed the best result for the selective enumeration of
all of the Bifidobacterium species evaluated.
@ " = @ <*= * 3 * # ^$! *= @ " <" @ @ <*= = \ "\={=\
@*=¤@\¤="
=@»^*^{@\"=*^
@\ @ * @ © ! { ! @@
"@=\\\@"@@"{"
@ = < "< { è { è { @ @
<"*\{{\{°{
@="@<*=@*@{
±""<<@\{;@\¤
=@<@=*<"
¢ ± < @"= © <" <= < = @ <*= @ @"={<*=@\¤*@<\@@\@¤
\ { = @\ @ @ = * @ @ "{è"
°=\ª=*@
Keywords: Bifidobacterium spp, Streptococcus thermophilus, culture media, selectivity
Acknowledgements: The authors thank the Fundação de Amparo à Pesquisa de Minas Gerais (FAPEMIG)
144
145
$)*+
#
$
,$'
"
$
&3
%NNN0$
$&#
%
'3
%' @'3
%' 7'6
'!'0B8'('3
' 7%
!&!!&%'('/
+
*H
('7+ )H
('*
!
%

|=@!@||!"==#;<=*!<{
;<º^;<¶!!§"*^"{
|"!^@==!*=!#*=Ýº<§¢°Û<¤

@^@"@=@^@";<=®^"
{^{"^{^"}
@"=;<=">"!
>"

* " "* " *= " * \@
*<=<*¥¦{#=*!"@@
<=*@"¤\@@*
@""<<{@@"=\<"
@=""*=°@\@3
<*¤<
½½"¢@"{°\"\
"\*!^¥¦{@\\=
\@ " \@ 3 " =
*{@\±=@@"\@±
@ ={ @ "= \ " \@ " \@ \@"
*ª\{\"\@3\"
\@3 ©{ \ \@ ©{
#*=\@"@@@¢@"*
½ 3 " * ! " |
|>{@@*3\@"
"@½"@{@@"\@½\
3 " *" \@ " @ @ " = \@ 3
{@*"!\{@
*@"=<""@@"@"*=°@
"<<ï\@3!@@"*""<<
"3{
3*"*""\@
* @ " ¥¦{ ! "@ *" @
@=^!@*"@="**
""¥¦{|""\@@=^@@=="<
\@@ " *= @== @= ^! ¥¦{ | @ \<@
= <"}= }= " \@ <
@==}@\@=<@@=^@\@@
" " @ ^! " *= 3 { @ "= \ " *= "" 3 ¢^@==}@\@=@\""<"}=@==}
"¢@½{@\@=\@"<"}=
\"{"\==}^\@;^@
^!{@"^!"\*\@3\\@\@=
@==}@{#{\<@<*^@\{{@""
\@ @ \@= @==} ¢ @" @\ ^! " { { # ^@ {{<={@"\*<@@<@
¨ { *\ ^@ ^! "{ "@ " " * *" @
"}=*@"^!"<""*^@
\@@ " @ \ \ "* < "{ > @ @ @ =@<^@"^!"\@@@\=
"^@@^!{@\"@@"<"}="^!
"*=3¢^""@\@=*@@=={
"ª°3={
",3<"}=@=@\@=@=@=={
B"
#@ "@ "= ¤\ " ·· |<® | !¸¸ ||!# ;|¢ " #¶ "= =
#;<=**=@§Ê^"""ª<=
"=¿^! !|*="®ð{
*
#
¥¦#¤<#{"¤<!{"={¤"#{~|{{ª^@}*"
*=<°{{!{#*{{
¥¦~|{{³{{{{{ *==@}!*^
!ª!<\{{@{¢¢«¢{
*
¥¦ * {{ #{ }¶} {#{{ » >< { ^{ { { ><<\ 3 *"*{%(¢«¢{
¥¦º<>{}#!{¶}#}!{» ¹{{{!"<=*
@\@@="{(+
#«{
¥¦¹"}~{{#{º{»¹"}{#{{!*<=@=
"*=*@{«{
146
147
1
$&"
%
"
&
Effect of postharvest application of Metschnikowia pulcherrima L672 as biocontrol
agent on `Ambrunés´ sweet cherries (Prunus avium L.)
6B%'`\B('<<
B%'2'![B\(

E. de Paiva1, S. Ruiz-Moyano1, M.C. Villalobos1, M.J. Serradilla2, M.G. Córdoba1, F. Pérez-Nevado1 and
A. Hernández1

1
};<=@!¢ *!¤"¤=
!¤;<="==#!~"~"¢
!!¤"¤=

};<="=##= ¢<!¤"¤=
Nutrición y Bromatología, Escuela de Ingenierías Agrarias, Universidad de Extremadura, Avda. Adolfo Suárez s/n, 06007
Badajoz, Spain
Área de vegetales, Centro de Investigaciones Científicas y Tecnológicas de Extremadura (CICYTEX), A5 km 372, 06187,
Guadajira, Badajoz.
2
| "= @ @¤ @ @@= }{@@"\<"@=
@ "{ @ } * * \ * <@{!@@<<"@<*§@
"*@@@¤*=<{
@@"=\<@<"" =!
<***="*<@{
*\"@"={""\"§~
^"^ "{\" =\
<"@*=\@<§={{>@="*@}}
@@ @ " \ =} @ < < " = * @ *= " "< ^{ @ *
\=<"@@{@^
"\<"<{
@*=@¤§\@*\<"@@{
@"@**<"@\"<<@
"<{
| @ " * \ " * \@ < " *" @
"{|=@¤\@{
@ @¤ * } @ " * @ * {
@@@@*=\@@@*=*@*"
\\@@§~"{@@*"^^\
@@^"@@*=@^{
Moulds are responsible of 20–25% losses of worldwide production of fruits. Biological control of fungal
postharvest diseases is gaining popularity in recent years [1]. Several yeast strains have been proposed as
antagonist of producer fungi of decay because yeasts collect most of characteristics of an ideal biocontrol agent
[2]. The capability of Metschnikowia pulcherrima L672 for controlling pathogenic moulds both in vitro and in
vivo has been previously demonstrated [3]; however, results obtained in lab trials are sometimes not reproducible
when the experiments are replicated on postharvest conditions. In this study, we inoculated M. pulcherrima L672
on `Ambrunés´ sweet cherries (Prunus avium L.) which were packaged and stored under commercial conditions.
Microbial counts, percentage of disorders, and physicochemical parameters (TSS, pH, TA, and firmness) were
evaluated. The results were compared with control batch without antagonistic yeast strain. The results showed a
proper colonization of cherry surfaces by M. pulcherrima L672. Moulds presence was controlled until the end of
storage of cherries. Finally, the application of M. pulcherrima L672 on `Ambrunés´ sweet cherries did not
modify noticeably physicochemical parameters.
Keywords: biocontrol; Metschikowia pulcherrima L672; postharvest; sweet cherries
References
[1] Sharma, R. R., Singh, D., Singh, R. 2009. Biological control of postharvest diseases of fruits and vegetables by microbial
antagonists: A review. Biol. Control, 50 (3), 205-221.
[2] Wilson, C. L., Wisniewski, M. E. 1989. Biological control of postharvest diseases of fruits and vegetables: an emerging
technology. Ann. Rev. Phytopathol., 27 (1), 425-441.
[3] Ruiz-Moyano, S., Martín, A., Villalobos, M.C., Calle, A., Serradilla, M.J., Córdoba, M.G., Hernández, A. Yeasts
isolated from figs (Ficus carica L.) as biocontrol agents of postharvest fruit diseases. Food Microbiol. (under review).
! @ * @ @\ * <= " < " <"
@"@"@"*"<"
"="@¤{
"#^*<*
*
#
¥¦>!{{!#|>#!{!!°>#{;~|{{@<
@<"@@@@¤{"!
PN#{
¥¦{{~{{^!°;|{!{!!{{>> >{{^><<
"|><!*"""{SDª«¢
148
149
Effects of anaerobic and respiratory adaptation on the physiological response of
Lactobacillus casei N87
$
$
$
$$
Lucia Camprini, Giuseppe Comi, Federica Ginaldi and Lucilla Iacumin
*
%'0**6
%'7
%' %'<4 !('
0!%
Department of Food Science, University of Udine, Via Sondrio 2/A, 33100 Udine, Italy

*=#*=~"@;<=^¹*®
^^¹*«}
#;<=^*"^
Lactic acid bacteria are largely used in food industries and they are subjected to different stresses. Those stresses
give rise to complex physiological reactions and possible changes in the strains behavior. Therefore, changing in
the strains behavior is often strain specific and it is very difficult to correlate the stress response to a particular
applies stress. The cause/effects relationships between different adaptations, sublethal stresses and physiological
responses were investigated during the latest years, but the big picture about the stress response is still far to be
completed.

@ "" { @ "< @ @< \@@ @
"<=@"@¤<""¥¦{@@
<< @ < @< ={ >< @
@\@@\"=@"\@@"@<
"""<@"@@{|@
@<*"@<<*<
{"\@"@\*¤@<*@@¥¦{|@=@@
| " ¤ ~=" " *< ** **=@*<=*@=
@"¥¦{@*§<@"=\<@@|@
\@ ##! ##!
##¢##$##\@@\"
= @ } ¥¦{ ; @ \@ "* @" " @ | " \ © << "@ " ^! ^
!*|{{{#=¤{
= "" @ \ @ ^ @ ^!"\@@@|
^! \@" | \ "* ± ={ @ = \@ \
*="@=@=@"{@\@
@ \ \ { @ = \@
" \ @ \@ @ | = @ @ @ ^ @{ @ "
\ = \@ = = \@ @* # | ¥¦ = \@ # ¥¦{ | { {
< " { | { @\ @ @@
@* # | ¢{ * < " Ë{ @ # {¢{ =
{{={@|@\=
@# |<""{@=|@# @
="*"*\@@"
< @ " @ " "= " < * ""{
The aim of the work was to evaluate the effect of a diverse adaptation (anaerobiosis vs. respiratory growth) on
the antibiotic resistance, the hemolytic activity, and milk fermentation capability of Lactobacillus casei N87.
Moreover, after the milk fermentation process, to evaluate the effect of the additional stresses caused by the
technological process (pH, fermentation and refrigeration temperature) the bacterial cells were recovered and
tested again for their antibiotic resistance and the hemolytic activity, as well as the ability to compete with
pathogens, and the survival ability the gastro-intestinal tract in vitro, using both the approaches, the single step
and the sequential digestion. In the sequential in vitro digestion the viable but not colturable (VBNC) cells were
also assessed. The fermentation process was monitored by microbial analysis and pH measurements.
As far as the microbiological analysis and pH results are concerned, the strain demonstrated good capabilities to
survive to the oxidative and technological stresses and showed good fermentation performances.
During the process the inoculated Lactobacillus casei N87 was able to adapt to the environment and ferment the
milk reducing the pH from 6.6 to 4.3 units. During the refrigerated storage the bacteria concentration remained
stable, as well as the pH values, and viable. No significant differences in the fermentation process were observed
considering the two different adaptation conditions. Conversely, several changes in the behavior of the strain
have been observed in the antibiotics resistance, hemolytic activity and antimicrobial capabilities of the soluble
fraction.
The applied stresses increased the ability of L. casei N87 to compete with all the tested pathogens (Listeria
monocytogenes, Bacillus cereus, Escherichia coli, Salmonella enteritidis, Staphylococcus aureus), inhibiting their
growth. Only L. monocytogenes was able to grow from an inoculum value of 102 CFU / mL to 108 CFU / mL in
4 hours but, after 12 hours, the microbial load of the pathogen decreased exponentially becoming not detectable
when the strain was adapted under respiratory conditions.
The strain during the single step digestion, survived to saliva and intestine, whereas after 30 minutes in the
stomach the viability decreased, and the adaptation under respiratory conditions amplified this trend. Considering
the sequential digestion, the strain showed a similar behavior, but after a decrement during the stomach passage,
a significant increase in the cellular load was observed in the intestinal tract. Looking at the VBNC cells value, it
was possible to confirm that during the stomach passage the cells were not vital but still alive.
"#"<=@
The selected strain reacted positively to the adaptations and to the technological stresses, showing good
capabilities of competition with pathogen and surviving to in vitro digestion, promising to be a good probiotic
strain.
*
¥¦~{{{+""#¢«¢{
¥¦~{{{{
#{
¥¦!#{38,S,#{
¥¦~{{{#¢«{
¥¦#{ {#{{+!{
Keywords: respiratory adaptation, L. casei, stress response.
150
151
&
&$
-
&
-.
(
0
3
$
'
!7+*
&
7!$BB
%')7B
('!B('2')!
BB
%
ñ º"¹=¹#"= º{;<="!<{<
¢¢§}

=$"==!=@";<=@}{
°"@"
@=°";<=@=<"{°"@"

|"°";<=@=¤<{°"@"

* @ < < *" " @* @ @" @ <*{ !@"@ * "¤= "
@=<="@\"
"={<*=@"@*<"=
<= { @ " @ @ <= " @ E
}=*=@T{¤=@"*<
¤{"@>@{¥¦@@}
=*=~!§"@**@\*"
T"{@ =\@}\@*@@
= *= <{ @ \" @ =@= " "@"<"{|<"\¤¥¦\<=
@ < * *= ^ \@ \= {
T"*=^=@**=\
= = < " \@ @ * T
"=@}E¤@}=<=
#@<*""*=<"""@
\@<@<<*{
!@\*-0{*¤
\*=@*<=<=""
! ! ! % ! 9
3! " $! , ${ != * ""
3 ! ! 3 ! 3 !
3#\"@@{!*<=
\ *= \ " @{ "" \ \ # # "{=*"\§"#~{{{|
@"@= " \ " < ± " @ \ @"@= < *" { ³ "" \ \ ± @
" ={ = " \ §" @ #
~{{|@"@="\"<"
"={""\@"\"^@{
@@}@"@<"*=<{@
""\ £*\<"{@}=<=@
E \ \@ @ " @ @= \@ T >" " @
*" " < < " " <" " =¥¦{
@"*=@\@@<\\*=@
\<={%""\@<@*}
",$«"$S"«!«
! 9 3 ¢ { #\@ @ @ @* } "" " <={ @ " \
\*<\@@*}%{@@*
}*\3!03!
)U3!)*03#0{
"#*} #"=*=
*
¥¦>@\ !ª@"*<{5
Nª«{
¥¦#}!*| }!*ª|<
**="^{
#%ª{
¥¦ ¤ ¤ ª ! @ = @ @ @@ \{3
#%Pª«¢{
@"@"@@""=<
<@<*=@=@{
"#*<==*-0{
152
153
Evaluation of the anti-Campylobacter activity of Lactobacillus salivarius SMXD51, a
bacteriocin-producing lactic bacteria, in broiler chickens
3
&#
V
"
Manuel Jimmy Saint-Cyr1,2, Nabila Haddad1,2, Typhaine Poezevara3,4, Ségolène Quesne3,4, Michel
Amelot4,5, Xavier Dousset1,2, Marianne Chemaly3,4, Muriel Guyard-Nicodème3,4
1!
=;<=°=°=«{|
1
INRA UMR 1014 SECALIM, BP 40706, F-44307 Nantes, France.
LUNAM Université, ONIRIS, F-44307 Nantes, France.
3
ANSES, Laboratoire de Ploufragan/Plouzané, unité Hygiène et Qualité des Produits Avicoles et Porcins, BP 53, 22440
Ploufragan, France.
4
UEB, Université Européenne de Bretagne.
5
ANSES, Laboratoire de Ploufragan/Plouzané, Service d’Elevage et d’Expérimentation Avicoles et Cunicoles, BP 53, 22440
Ploufragan, France.
2
@\>"@@"*\"
@*"<"@"@{\<
@ \ * "*= < @ @" @
\<@"*@""{
|@"=">\""""3@
"" " " \@ = © " {
""¤\@*!"<{{"*<
< @ " \@ = { * \=<"*\"
* < @ "{ @ " \ *= * \@ " ={ < " { © { © " { ©
@"\\@{{¢©@<"@
"{{©@"{©@
"{
Campylobacteriosis is the most frequently reported zoonotic disease in humans in the European Union with
214,779 cases in 2013. Poultry is the main reservoir of Campylobacter and poultry meat the main source of
human infection. Reducing Campylobacter colonization in broilers from livestock will therefore have a major
health impact on consumers. Several intervention strategies are being developed in the primary production,
including the use of probiotics. Lactobacillus salivarius SMXD51, a strain isolated from chicken ceca, has
shown in vitro anti-Campylobacter activity by its ability to produce a bacteriocin [1, 2]. The aim of the current
study was to evaluate the effect of Lb. salivarius SMXD51 on cecal colonization of Campylobacter of artificially
inoculated broiler chickens.
|<@"@#<©
©{¤\"*=©#\@@
"{*=\@\@@3@
@\ @ *@ @ @ " "} @
"=<#{"*\@*@@@\"@
<©#*=@*>{
For this purpose, 2 groups of 30 day-of-hatch Ross PM3 chickens were used. Every 2-3 days, chickens were
individually treated orally with 100 μL of MRS broth for the first group (control group) and with100 μL of a Lb.
salivarius suspension grown in MRS broth (3.7±1.7 x 108 CFU/mL) for the second group (treated group). At day
11, chickens from the 2 groups were individually inoculated orally with 100 μL of a culture of C. jejuni
C97Anses640 strain at 5.5±0.9 x 105 CFU/mL. At days 14 and 35, 15 birds per group were euthanized.
Campylobacter and Lb. salivarius loads were assessed in cecal contents following the decimal dilution method
and by quantitative real-time PCR respectively.
Ceca of the control group harbor 7.1±0.5 and 8.3±0.4 log10 CFU/g of Campylobacter at days 14 and 35,
respectively. At day 14, the comparison between the control and treated groups showed a non-significant
reduction of 0.82 log. After 35 days, a significant reduction of 2.81 log was observed (P value<0.001) and 73%
of chickens treated with Lb. salivarius exhibited Campylobacter loads less than 7 log10 CFU/g. Lb. salivarius
was not detected in the control group while 7.8±0.3 log10 CFU/g were enumerated in the cecal content of
chickens from the treated group.
"ª*@@\@
In conclusion, Lb. salivarius SMXD51 presents an in vivo anti-Campylobacter effect, leading to a 100-fold
decrease in the cecal loads of Campylobacter in broilers. In addition, this potential probiotic seems to be able to
persist in the digestive tract of broiler chickens. For a future industrial application, an in vivo assay to test this
strain as a food additive will be challenged.
Keywords: probiotics; lactic bacteria; anti-Campylobacter activity; broiler chickens
References
[1] Messaoudi, Soumaya, et al. "Identification of lactobacilli residing in chicken ceca with antagonism against
Campylobacter." International Microbiology 14.2 (2011): 103-110.
[2] Messaoudi, Soumaya, et al. "Purification and characterization of a new bacteriocin active against Campylobacter
produced by Lactobacillus salivarius SMXD51." Food microbiology 32.1 (2012): 129-134.
154
155
Influence of starter culture and ripening temperature on the survival of L.
monocytogenes in traditional Portuguese dry-fermented sausages
.
$$"
$ !
-
&
$
B
A. P. Pereira1,2, V. Cadavez1,2, U. Gonzales-Barron1 and T. Dias1,2
74%' B('"B4$B2'7"
B4%'* B(4$B(
1

CIMO Mountain Research Centre, School of Agriculture (ESA), Polytechnic Institute of Braganza, Campus de Santa
Apolónia, Apartado 1172, 5301-855 Bragança, Portugal
2
School of Agriculture (ESA), Polytechnic Institute of Braganza, Campus de Santa Apolónia, Apartado 1172, 5301-855
Bragança, Portugal
Linguiça is a popular ready-to-eat dry-fermented sausage in Portugal. During the fermentation and drying of
these sausages, L. monocytogenes is expected to decrease steadily. However, despite the various hurdles in the
dry sausage manufacturing process, this food-borne pathogen may be able to survive and be detected in the final
product. Factors that may affect the growth or survival of L. monocytogenes in dry-fermented sausages include:
water activity (Aw), pH, temperature, use of starter culture and use of ingredients with antimicrobial activity
(e.g., garlic, smoke). The objective of the present study was to evaluate the influence of the addition of a
commercial starter culture and ripening temperature (10ºC and 18ºC) on the fate of L. monocytogenes strains in
experimentally-inoculated linguiça.
For the control batches, sliced raw pork was mixed with salt, dry garlic, sweet pepper, laurel, dextrose, a mixture
of red/white wine and water, and inoculated with L. monocytogenes (~5 log CFU/g). The batter was macerated
for 3 days at 4ºC. After stuffing into natural pork casings, sausages were hung vertically in a climate controlled
chamber, for ripening at 10ºC (2 batches) or 18ºC (2 batches) with 83% relative humidity during ten days. Other
four batches were prepared by adding commercial starter culture (~5 log CFU/g) at the mixing stage, and
following the same procedure as explained above. Two batches were subject to a ripening temperature of 10ºC
and other two to 18ºC.
During maceration, there was no significant change in the counts of LAB or L. monocytogenes. During ripening,
in both treatments – control and inoculated with starter cultures, LAB counts increased while L. monocytogenes
decreased steadily. In the control batches, by the end of ripening, L. monocytogenes population was reduced in
up to 1.00 log CFU/g at 10ºC and 1.57 log CFU/g at 18ºC of ambient temperature. With the addition of a
commercial starter culture, the pathogen was further reduced in 1.57 and 2.24 log CFU/g when sausages were
ripened at 10ºC and 18ºC, respectively. In a parallel microbiological surveys investigation in processing plants,
L. monocytogenes was occasionally recovered from linguiças in counts lower than 50 CFU/g (1.70 log CFU/g).
Thus, the use of starter cultures would help lower this level. Although this kind of sausages is traditionally
fermented spontaneously, further work should be directed towards the preparation of a tailor-made starter culture
that would constitute an additional hurdle to control the occurrence of L. monocytogenes in linguiça.
Keywords: Linguiça; fate studies; inoculation; maturation
Acknowledgments This research was supported through the project PTDC/AGR-TEC/3107/2012, awarded by the
Portuguese Foundation for Science and Technology (FCT), European Regional Development Funds (ERDF). Dr. GonzalesBarron also acknowledges the financial support provided by FCT through the award of an Investigator Fellowship (IF) in
the mode of Development Grants (IF/00570).
|" !{#¤\}=}}^
@=#*=^}Ú;<=§¤^¤¢¢
^}Ú^

|"@=^>^}Ú;<=§¤^¤¢¢^}Ú
^

*@}@@"=*@°@¤@\@@
="@@*"
*<"*"="{@"<
\"@"=\@@=<"
< = @ * @ "{ @ *< @@*\@@*"<@*@*\@
@ \@ @ * * @ ¤
"¥¦{
@@"=\"}"@"~ @*
*="**"{!\@*"=
@"=\<"~ {
@ *§ @ "= " @ @¤ @ \ "@ "¤ @ ¤"§\¤¤ < ^{ ! = = @ \
" @ \@@ " @ <" @ " "{ ~! \
" #!¬¤!»!@=@""¸"{
| * ¢ ~! \ " "< ª ¸ «
!! !! !! ! !!! ! !! ! # !! « ¸
¸ |" \ \ ¤ \ " ¢ª
¸
«
!! ! !! ! !! ! !
¬¬¬¬¬¬
! ! ! !! !! « ¸ < ¸ |" = *
< < ¤ < { \ = " <Â
\{
"="@@*"@== @{|@\¤@
"=@"*""*§@==@<\@
@@¤{!*\{!
"* @ * @ ¤ " "ª / # # " # "
# " % # #
#{
@"@*@"@"*"@
@@**@"@"
<*@<@@="}"{
"#**=|"#<*
B"
ª "*§ "* \ *= @ |<< = > ^
^>| {{{@\¤@"<"{
*
¥¦ } { #}"¶} { { !"; #{ }! { { =*@{|#=@}**@{
{@~"{
156
157
¥¦ *!{"!{#}}{#{"|{*#{{~!*@
@}={{|{¢{
Investigation of adaptation of Escherichia coli to high salt environment
. Uuz1 and F. N. Çoksöyler1
1
Department of Food Engineering, Faculty of Engineering and Architecture, University of Yüzüncü Yl, Tu
ba, 06071 Van,
Turkey
Microorganisms give different responses to stresses according to importance of stress or stresses. Stress response
system varies according to the type of microorganisms, stress intensity applied to microorganisms and whether
they can be adapted to this stress. The aim of this study was to determine the stress response tolerance system of
E. coli ATCC 25922 and E. coli O157:H7 strains against salt, which is one of the osmotic stress sources. Study
was carried out in 3 parallels for each combination to determine whether strains have been adapted to salt before
and how tolerance level changed with salt concentration. Growth of culture in TSB medium containing various
salt levels (0-10%) was observed both by cultural counting and absorbance measuring at 600 nm. When the salt
level increases, the growth rate of microorganisms is reduced; while maximum specific growth rate (max) and
maximum population density (A) decreases, the lag phase time () increases. The average max values of E. coli
ATCC 25922 cultures, which were adapted and not adapted to NaCl, decrease with the increasing salt
concentration of the growth medium of cultures. In all of the cultures in which E. coli ATCC 25922 was adapted
to salt, at almost every salt level, average max values of adapted cultures were higher than average max values
of non-adapted cultures. In its 0-7 % salt-included TSB medium, the average max values of NaCl-adapted E.
coli O157:H7 decreased depending on the increasing salt concentration. Differences between the average max
values in every salt concentration were found to be statistically significant (p<0.05).The situation was the same
for E. coli O157:H7 cultures that were not adapted to NaCl.
Keywords: Escherichia coli, adaptation, salt stress, osmotic stress.
158
159
#
&
$
$
&$
$
#
&
,
)
&-
,$' '3
' @'3
' 7'6
'!3
' 7
*1
|=@!@||!"==#;<=*!<{
;<º^;<¶!!§"*^"{
~"@@=»^@=;<=
¢¢!^;°
*@"@@{|@"="¸
"=<@\\@@@"@"*
@ "@ //! ! 3 # ¥¦{
6Bª 3 # <= * @ \@ <§@"=*@*
{ @ " *= ! = @ @ 3 # °} °{!{ { "" { » >¸= {^{ { !@"@ <"
"¤\@ !=!#{{"¤\
@"@ !=3#{<="@""
@""@@*""@@@<=
\@§@"={
*!"¤\@**"
"@*}"""¸*¤¥¦{@
@"=\<"@@*=3$3
"""@*=¤"="{
3 \@ " @ ¤¤ @ ¢ \ // // , ***WX! 3 # , Y1Z! , Z1[[! \2! ' ! { < \\=¤"="*=^
//{ @ 3 $ 3 @\ * *= @ @ *{ 3 $ @* @
@@@*=<=@{3^^¢
@\ @@ @* , Z1[[ \@ @ ^¢ *
",{3^@@*@*"3
#,Y1Z{
&1
ª>"\¤\@<"@"@<=@
! ={ " < = @* @ <= @ !
=@"@\¤\"¤=@@*@@{
# |= \ @ #" |@*= " @ \" *
< 3 # { "*"= \ @ "<< @ # " "<< @ @
@"|"|\*=Ò@ {!\
"#{ {|\@@#"
\"@@@*={|""ò
*"= !! " ò *"= !! \ @"@ !
= " @ { @ @ " @ ! <= = \
<{ "@ " = * " 3 # \@
*=@"<@**@{
"@@\*<\@¤\@@*=\"@"
@*=*"@**{
"#*"=*=*={
*
ª >" } " \ * @ = @ <= " !! !!*"@ "= !!*"
!!{|\@#"\@\@#*==*@\@
\"¤"@@"*"@*="@
""@@@{\<\@
\@§ !<=\@@\"*= {|@
\ < !! \@@ \ \@ \ "@*=@ !=<={\<@\
!!"{@\@@ !<==
= !!"\=@*={@"*
<={ "@ * < *
\"{
B"
#@ "@ "= ¤\ " ·· |<® | !¸¸ ||!# ;|¢ " #¶ "= =
#;<=**=@§Ê^"""ª<=
"=¿^! !|*="®ð{
*
#
¥¦!~@\!{ "{ "{{Ê=*@@@@=
""*"="¿«@={{"|"
^{
¥¦~«#¤=#"¬"@@{^"*=*
**""@"={^>{ª{ª{§"{{
{
4# >" \¤ @\ @ @ @ <= 3 # @ *= " @* @ ! <={ @ \ \@ "@ !!@@
"= !!*" !!{
"# !=#" !!3#
*
{#{{{«{
{°}°{!{ {""{»>¸={^{{
«{
160
161
Microbiological evaluation of food-contact surfaces and food handlers in
Portuguese catering sector: a preliminary study
Microbiological quality of olives and its antimicrobial action
A. Rebelo1, B. Proença2, A. Xavier1, M. Freitas1, O. Monteiro3 and M. Vieira da Silva1
1
G. C. Santos1, J.M. Planas2 and M. A. Calvo Torras1
Department of Health and Anatomy Animals, Autonomous University of Barcelona, Building V, 08193 Bellaterra, Spain
Department of Physiology, University of Barcelona, Av. De Joan XXIII s/n, Building B, 3° floor, Barcelona, Spain
2
1
Department of Environmental Health, Research Centre on Health and Environment, School of Allied Health Sciences,
Polytechnic Institute of Porto, Rua Valente Perfeito 322, Vila Nova de Gaia, Portugal
2
School of Allied Health Sciences, Polytechnic Institute of Porto, Rua Valente Perfeito 322, Vila Nova de Gaia, Portugal
(BSc student in Environmental Health)
3
Unidade de Saúde Pública do ACES do Grande Porto VI – Porto Oriental (Public Health)
According to the World Health Organization over two hundred diseases are caused by unsafe food containing
harmful microorganisms or chemical substances, which represent a growing public health problem worldwide
[1]. Food handlers are often involved as vectors in the spread of foodborne diseases mainly because of poor
personal hygiene or cross-contamination. The aim of this study was to assess the microbiological safety of foodcontact surfaces and food handlers from restaurants in the metropolitan area of Porto (Portugal). The survey was
performed in 8 randomly selected restaurant kitchens colleting a total of 32 microbiological samples from foodcontact surfaces (n=24) (including work surfaces and utensils/equipment) and hands of food handlers (n=8). The
samples were collected using two traditional methods: the swab contact method for teflon chopping boards,
utensils/equipment and hands of food handlers; and the RODAC plate method for worktops. All samples were
analysed for indicator organisms associated with hygiene practices, including aerobic plate count (APC),
Staphylococcus aureus and Enterobactereaceae. The percentage of samples in conformity with microbiological
advisory standards are reported in Table 1.
Table 1. Percentage (%) of samples in conformity with microbiological advisory standards [2, 3]
Enterobactereaceae
APC
Samplesa
a
S. aureus
Satisfactory
(<1.3Log10cfu)
Unsatisfactory
(1.3Log10cfu)
Satisfactory
(<1Log10cfu)
Unsatisfactory
(1Log10cfu)
Satisfactory
(<1Log10cfu)
Unsatisfactory
(1Log10cfu)
Work surfaces (worktops, Teflon
chopping boards) (n= 13)
56%
44%
85%
15%
92%
8%
Utensils/equipment (Knives,
spoons, forks, skimmer, slicing
machine) (n= 11)
27%
73%
73%
27%
91%
9%
Hands of Food handlers (n= 8)
0%
All samples (n = 32)
29%
100%
50%
50%
75%
25
71%
72%
28%
87.5%
12.5%
2
For work surfaces the results obtained are in Log10CFU/cm ; for utensils/equipments and hands of food handlers the results are expressed in Log10CFU/unit.
The majority of the samples complies with the advisory standards, which indicates an adequate level of hygiene
in these places except for the parameter APC, that recorded unsatisfactory values (>1.3 Log10CFU) in 71 % of
the samples. These results may possible indicate cross-contamination after the sanitization of these places [3],
particularly as regards utensils/equipment (73% of unsatisfactory values). However, the worst results for APC
were obtained in the hands of food handlers (100% of unsatisfactory values) ranging from 1.55 to 5.47
Log10CFU/unit which may be associated with poor personal hygiene. Also regarding hands hygiene, the results
showed 25% of the samples with unsatisfactory levels for S.aureus reaching a maximum of 3.41 Log10CFU/unit
in one food handler. Although people that carry out S. aureus in their hands are allowed to work in food
production, it is crucial that they recognise the importance of careful washing and disinfection. The results
obtained with microbial contamination with Enterobactereacea group, highlights the fact that the washing
procedures applied by some food operators may not being effective and can induce risk for health consumers by
unsafe food available.
Table olives are a traditional fermented vegetable of the Mediterranean diet consumed worldwide. Its benefits in
nutrition are associated, besides the presence of monounsaturated fatty acids, the minor components such as
phenolic compounds and triterpenic acids. The aim of the present work was to proceed to the microbiological
characterization of table olives commercialized in Barcelona’ markets or obtained directly from the producer and
to verify antimicrobial action of these olives in front of several microorganisms.
Olives bought in Barcelona’ markets are Sevillanas (OS), and olives obtained from producers are Arbequinas
(OA), Marfil (OM) and Empeltre (OE). The olives were cut and made suspensions with sterile Ringer solution.
From this suspensions were made dilutions to 10-6. For the microbiological quality counts were performed of
lactic acid bacteria, Staphylococcus aureus, coliforms and other enteric pathogens, moulds and yeasts,
Clostridium perfringens, Salmonella spp., Listeria monocytogenes, and a several pathogens microorganisms. The
antimicrobial activity was observed in 96 wells plates and pathogenic and lactic microorganisms (Lactobacillus
brevis, Lactobacillus plantarum, Bacillus subtilis, Listeria monocytogenes, Pseudomonas aeruginosa,
Escherichia coli, Salmonella enteritidis, Salmonella typhimurium, Aspergillus niger, Penicillium rugulosum,
Candida albicans and Saccharomyces cerevisiae) were treated with the olive suspension. A McFarland N° 1
standard suspension of microorganism inoculum was prepared in sterile Ringer solution. After 24±2h incubation
for bacteria and 4 days for moulds and yeast, 40 μL of 0.2mg/mL INT (p-iodo-nitrotetrazolium salt) solution was
added to each well for one hour. Plates were read in an Elisa system.
Sevillanas olives purchased in 3 different markets in Barcelona/Spain had, on average, growth of 6.6x106 UFC/g
of lactic acid bacteria. One of these samples had growth of 8.7 x 102 UFC/g of Staphylococcus aureus. This
sample should be considered as unacceptable and improper for consumption, because it can cause food-borne
illness. Olives obtained from producers showed no growth of lactic acid bacteria or Staphylococcus aureus.
However, there was growth of coliforms and other enteric pathogens in Arbequinas (8.9 x 107 UFC/g) and Marfil
(4.0 x 107 UFC/g) olives. The olives had growth of moulds and yeasts. The number of mould was varied between
2.0x103 and 3.3 x 105 UFC/g, and this growth was higher in the Sevillanas and less in Marfil olives. Olives
presented yeasts growth between 7.0 x 103 and 3.0 x 105 UFC/g, with lower growth in Sevillanas olives and
higher in Empeltre and Arbequinas olives. It was not detected Clostridium perfringens nor Salmonella spp. or
Listeria monocytogenes in any olives analyzed. In general, the results obtained have shown that the olives
commercialized in markets has more Lactobacillus spp. than olives obtained directly of producers and is
necessary improve the quality and safety of olives using good practices in agriculture, hygiene and
manufacturing.
No olive extract was able to completely reduce the growth of microorganisms analyzed. Among these extracts,
the Sevillanas olives showed some reduction, but this did not reach 50%. And among these Sevillanas olives, one
of the samples stimulated the growth of Lactobacillus spp. This may be due to the type of treatment used or the
olives would be acting as prebiotic, stimulating the growth of Lactobacillus spp.
Keywords: olives; microbiological quality; antimicrobial action
Keywords: food hygiene; food handlers; catering sector
References
[1] World Health Organization (2014). Media Centre: Food Safety. Fact Sheet n.º399. Available:
http://www.who.int/mediacentre/factsheets/fs399/en/
[2] Henroid, D.H., Mendonca, A.F. & Sneed, J. (2004). Microbiological evaluation of food contact surfaces in Iowa
Schools. Food Protection Trends, 24 (9), 682-685.
[3] Sneed, J., Strohbehn, C., Gilmore, S.A. & Mendonca, A. (2004). Microbiological Evaluation of Foodservice Contact
Surfaces in Iowa Assisted-Living Facilities. Journal of the American Dietetic Association 104, 1722-1724.
162
163
0E
&$ &$
$
)&#
$3
"B
&
B(N%(
0E$
& $$
0+
E%' %'
4%'6
%'!0
@
('E
2'/
7)!'
6&%'*
0
%!&4
!-%
0+
E%' +
%'!&4
!-%'!&
7
(' ('!
0
@
2'*
0
%
!E

;<º^!~=*=#!
~^"|"^

@|"=="@"

@|"^"*@"<«#"{
;<º^!~=*=#!{
|@^¤|"#!
~^"|"^

@ = @ @ < < =@"" ¥¦ªª " " ¤ {
^"=*"*¤>\=""
*=@<{
\!""@**"*¤>@
@"\~\¤@"\@@|"
^"*@"<{"*\@{@@\*"
*=\"{!@@\\"@*
< \ " *" @ @ "*= @ @ " @ < " \@ < "* <{ | @ "= \ < <" "" <*"*
=#!@@@=="*{
#<*"@@=\@#!#""*"*
!="*=@""={@@"<
@ @ @ @ *= = @@ "*= <= <=@"""{{~<@""<¤{
""""={@*=*=@
@¤@<*"*~¢{
<*~@{\@@"@@"{\=\~
\ " \@@ < ~ \ @ < "*{ @ =@ @
<~\<""\"^"
"{ \=@ #! \ @ "* \@ =
^ =@<*<"={>@"=^ =@
{"*©\"*=#!=@@<
|{<{¢@^ {@@<\<
= " " * >{ \=@ \
@\¤\\*"=@"}@#!{
=@#!@<\@""*@
\@@"~>{@#!\
\\@@""@\\@
>{ @ @ " "= "<= "*¤ < *= @ =
*=!~{
164
|@"=\<"@*=#!"@=""
@ < { " " \
@@\#!ª*={=@""\@<{
=@""{@\<"="="*@¤="
\ { \ @ *="<@"@@~~|>¢{
!@="@\<#!{@**=
<* #! <= \ © * *< @ @{|"""@\@@@<*=¢¢{
@\< " @ #! " = @ " *
<"*¤"=\@=""{
165
Pediococcus acidilactici KTU05-7 strain as an alternative for synthetic preservatives
against foodborne pathogens
-$!$
%'7E,
V
(' ,H$2')*
%'* 4( 7+
%
Dalia Cizeikiene1, Grazina Juodeikiene1, Algimantas Paskevicius2 and Elena Bartkiene3

#*==;<={#¢"§{

!=@=;<={#¢"§

^@="=@;<=;!<{¢
#
1
Department of Food Science and Technology, Kaunas University of Technology, Radvilenu Rd. 19, 50254 Kaunas,
Lithuania
Laboratory of Biodeterioration Research, Institute of Botany of Nature Research Centre, Akademijos Str. 2, 08412 Vilnius,
Lithuania
3
Department of Food Safety and Quality, Lithuanian University of Health Sciences, Tilzes st. 18, 47181 Kaunas, Lithuania
2
#=" " ""= "" < @ \ = " " \ \ { ~\ @ * @ *<" < " < @ < { ^<
"@@¤=\@"="
¥¦{|@«<=@=¤~@|=\@
} ¤= @ @ " { #} \@
!\"@@<#@
¤ \@ @ }{ @ " @< < "@ # < @ " @< ¤
}@¥¦{>@<=\@
\@@"@!>!@{
""!!@<@"=@\
@ ¤\ @ = *" < "* @ < " ={@"@;¸!=!
"*@@@\@@<§==
*"!\*=>!"@"=<
}{
@ @ "= \ @ =" " { @
@\@ª=\@"@
\*=@}"@"@{@"
@" * @ @= " = " <="^@<*"¥¦{#<<"=@\
@=@<<@@@<
*{
@=""\!\*=
# { {
@@=""{
B"
@ "@ ¤\ " #|~> @
<^§! {
In recent years health-conscious consumers are looking for natural foods without chemical preservatives that will
fit in their healthy lifestyles. Lactic acid bacteria (LAB) play a key role in food fermentations where they not
only contribute to the development of the desired sensory properties in the final product but also to their
microbiological safety [1]. Bacteriocin-like inhibitory substances (BLIS) from LAB are antimicrobial
compounds that possess bacteriocins capacities requisites but that have not been characterized for their amino
acid sequence yet [2]. BLIS producing LAB have gained importance as natural biopreservatives for the control of
spoilage and pathogenic organisms in different foods. For expanding the possibilities of the application of LAB
that produce bacteriocins active against Bacillus subtilis [3] spores in the other food production, is important to
evaluate their spectrum of antimicrobial activity against varies bacteria, fungi and yeast.
The aim of this study was to evaluate antimicrobial activity of Pediococcus acidilactici KTU05-7 strain
previously isolated from spontaneous rye sourdough against foodborne pathogens.
Antimicrobial activity determination was performed using the agar well diffusion assay method by measuring the
inhibition zones diameter (mm) after cultivation on appropriate medium for 48-72 h. Foodborne pathogens such
as Bacillus, Pseudomonas, Escherichia, Listeria, Salmonella genera and some fungi belonging to Fusarium,
Penicillium and Aspergillus genera, and yeast as well, previously isolated from various foods were used for
antimicrobial activity evaluation. Moreover, Escherichia coli, Enterococcus faecalis, Staphylococcus aureus,
Bacillus macerans, Salmonella enteritidis, Micrococcus spp., Yersinia enterocolitica, Listeria spp., Pseudomonas
aeruginosa isolated from outpatient pathological material was used as indicator microorganisms as well for P.
acidilactici antimicrobial activity evaluation.
The supernatants and neutralized supernatants of P. acidilactici KTU05-7 strain show wide range of
antimicrobial activity against varies bacteria, fungi and yeast. P. acidilactici applied for bread production
prolonged the shelf life of bread. The results of antimicrobial activity against varies food borne pathogens
confirmed that the use of P. acidilactici KTU05-7 producing antimicrobial substances may be a good alternative
to avoid the microbial spoilage and obtain more safe food products. Moreover the results confirm that the LAB
metabolites show broad range of antimicrobial activity spectrum against fungi, especially against F. culmorum
and F. poae. Therefore P. acidilactici is appropriate to use not only in bread production, but also for other foods,
especially in organic farming for grain seeds biological pollution reduction, where major problems are caused by
Fusarium spp. fungi.
The presence of BLIS and organic acids by tested P. acidilactici KTU05-7 strain is an indication that this
bacteria can be used widely in the food industry as bio-preservatives due to their broad inhibition spectrum.
"#"=""¤=#{
{{
*
¥¦ ^{ { ^{ ^ !{ " !{ { { |~|| ^> "* !{
#@@;"@{$"~
!${
¥¦ ^{ # ~{ ^ !{ "}} { ^{ { " # @|=}{|"#*=ª«{
¥¦ # < #{ { ^Å { º} #{ { ! @ ! *= ^*@"@#{
|"#*=ª¢{
¥¦ { # < #{ }¶}º #{{ º} #{ ¶}"} { ^Å { { *=\@@ª@{!<ª
!ª{
166
Keywords: lactic acid bacteria; antimicrobial activity
References
[1] Smaoui, S., Elleuch, L., Bejar, W., Karray-Rebai, I., Ayadi, I., Jaouadi, B., Mathieu, F., Chouayekh, H., Bejar, S., &
Mellouli, L. (2010). Inhibition of fungi and gram-negative bacteria by bacteriocin BacTN635 produced by Lactobacillus
plantarum sp. TN635. Applied Biochemistry and Biotechnology, 162, 1132-1146.
[2] Jack, R. W., Tagg, J. R., & Ray, B. (1995). Bacteriocins of Gram-positive bacteria. Microbiological Reviews, 59, 171200.
[3] Digaitien, A., Hansen, A., Juodeikien, G., Eidukonyt, D., Josephsen, J. (2012) Lactic acid bacteria isolated from rye
sourdoughs produce bacteriocin-like inhibitory substances active against Bacillus subtilis and fungi. Journal of Applied
Microbiology, 112, 732–742.
167
1K
K
&
$
$
&
K
1: ;
F&'4B6
&('.0%'!&%'
!%
<
'6'6
'3' '3
' @'3
'0B83
' 7
|=@!@||!"==#;<=*!<{
;<º^;<¶!!§"*^"{

**@"º;<º#@>"§#
*º¸=@@¤#
@@<{@"*=@
*@#@=={³=@<"
<" " " @ * ¥¦{ @ = = @ "
< @ * = * " < " @
" <"{ @ *§< @ \¤ \ = = = !§¸
"@@*=@*{!
==^"""Ê"¿Ê@"®¿
Ê@"®¿Ê@®¿Ê@"<@¿Ê¿\<"{@<"
@ * < * ! ¢¢
3$! !:!3
3 $ @ Ê"¿ Ê@" <@¿ }= <= = == = \ » ³\ ¥¦{@
<" " " @*= \ " { Á { @
}*=!^|"\"{{©@=
@*= ! {© \ * @* 3
# ¢{© @ = \ @* {
< = @ ""= \ * @* @ @ @ * \ @ "@"@@*="\""{|="@
@* @"@ " " @= = @\ @*= { @ @ \ ª ! % #! !
&~ @ @ = "=
<=*"&!@\=<={
@=\<{%#@*=<
< * 3 { " @ !
&@*@¤=¸@*
""<<"\@@*{
<< = { | @@ <= < \ "
@\<*@@\"*{@
@ \¤ \ < @ < * *#{

@"=<<@@*"@\
"="@@">"§#<\="@"=
*{>@\""#{¤=
*=!^|{"*=@\=*\
#""*{
" @\ <= < \@ @@ * " << "= = "" © @ @@ © = © ! ©
"@}@ © = © == © !<" ©©©© =©{
@@@<="*<@"<=
<<*{
"#!*#{
"ª="=@*<*
B"
# @ "@ "= ¤\ " |<® | ! ;|¢ "= = # ; *= @ § ^!
!|*="®ð{
*
#
¥¦» {@¢ª""ª³{|*¤#"=*=
¶³{{"|!¶@ {*¤=¤\{
¥¦ < {^{ ³\ { { @ ª #@ @ ={|@="=@<*=~{{{°<
§<^"*@{{!{{
168
169
&
"
$&"
"$
&:'&;
$
B
-
!!:;%'*14"%'B6(
3
/3
6
!

@=@*=;<="!{
@<";<=°¤|{

@|"@=°¤|{
@***==*\\*@"<
@ @@ @" "@= ^* §¤ » * { < @ @<
@\ @ @ *= * * *@= *@ "* ° » "¤ @} » { \< = "= @ *
@*@"*"*<\@{=
< "< @ \ @ =* * *""@\<\@
*"\{={{@"
@ \@@ * * " *= * = *
"{#<"=*\{
"=\@*<*@
< @ * "{ @ @ @ \¤ \ "= ^* <=
\"*"<}{\@*=*
* {{ !* <= @ * @ * \@"@!!{*
" @ \@ " @< * " \@ ¤ @< * <{ | "= @ \@ ¤ "
\@ < © * * \@ " © <
*@ \ "{ !* <= @ \@ @
*\*="}@*{@*\"""
*{{"{@*@""\@\@<
©©"©*\@©"*{|
©@"}@*{\*<@"*{
| = * " ¸ ¤ "= ¢{© ={@ ¸ ¤ *= "\=*="<=@¤
*@@=*@="={
@"@@""¾¤@@*{@
=@@@\@@\"@"¸¤{
! \ " " *@ ¤ " " \
" = " %& \@ * ¢ " ±
"* ¢@ " {© \@ * "
±"*¢@"<{©"*={
@¤<@""@@!{
{;"*
{¢;"*%{@!!^
@}=
{@@@@%{¢"@=
<=!^@=@@@}="*=@¢{@\@*{
@ \ " @ @ "" ¾ ¤ @
{@@=**=@"

@**={\@@=\@"
%{¢@{¢{
"##¤<=@@¸¤
%&=
<={
"#**=*
*
¥¦ "@= °#^* #§¤ * { ·; * * < " @@¸{ "
<={!"ª¢{
¥¦ ° "¤ { · "@ *= * **¸{ !
<#*{"¢¢¢ª¢{
170
171
Prevalence of Salmonella spp., Campylobacter spp., Listeria monocytogenes,
verotoxigenic E. coli in healthy domestic ruminants in Northern Spain
&
#
$B
$
$$
Medelin Ocejo, Beatriz Oporto and Ana Hurtado

/%'7@%'!('!,@('.@72'.,!2'!4!%
!@=°¤"¤;<="°
!"°¤"¤;<="°
*{{! =¢¢°

<! =~;<=§"¢¢°

Department of Animal Health, NEIKER – Instituto Vasco de Investigación y Desarrollo Agrario, Berreaga 1, 48160 Derio,
Spain

Introduction: Contamination of foods with bacterial pathogens is a major public health concern worldwide.
Livestock acts as an important reservoir of these pathogens, as they colonize asymptomatically the
gastrointestinal tract. Hence, reducing the prevalence of foodborne pathogens in the farm constitutes a crucial
point in the microbiology control of the food chain continuum.
| @ "= 3 ¤ @\ * =}= " <{ ^* < @ \ <" *@ "*
"{;"*"3@\@@
"* *< ; \ \ <" { ¢ @" "*{ ! *"
* <= \ *< = - { ^" = \ @@
@=**<#@""*{"@*<<
\@ * <={ ! <= *= ^^ @ @\ "
=<<=@"{;@@"*²;
\ @< @"{@ @ "@ @" \¤
="{!*<=""@"*=
"\@3@\"@*=-
¢@"@"<={!<=\*<"¢@"@¤
=""*3@\"<<=#!{
|"@3"*"*"\
"*<=<=\@*=}={
Aims: The aim of this study was to determine the prevalence of the main food-borne bacterial pathogens
(Salmonella spp., Campylobacter spp., verotoxigenic E. coli (VTEC), and Listeria monocytogenes) in cattle and
sheep farms in the Basque Country (Northern Spain) and characterize the isolates obtained.
Methods and Results: As part of a larger on-going study, 189 farms were sampled. Rectal fecal samples were
collected from 25 animals per farm and pooled into subsamples for selective enrichment of each organism.
Colonies of the four microorganisms were confirmed by specific real-time PCR assays. In addition, for the
detection of E. coli O157:H7, real-time PCR was used as screening method and positive samples were then
submitted to immunomagnetic separation (IMS), chromogenic isolation and PCR confirmation. Salmonella
isolates were further characterized by serotyping using antisera agglutination. The most prevalent microorganism
was Campylobacter spp. (86.0%), followed by VTEC (46.7%), L. monocytogenes (37.6%) and E. coli O157:H7
(15.9%). Salmonella spp. was rarely isolated (3.7%) and only one serotype among those commonly associated
with human infection (Typhimurium) was identified in a beef cattle farm. In beef cattle, the prevalence of
Salmonella spp. (4.2%), VTEC (66.7%) and E. coli O157:H7 (21.1%) was higher than in dairy or sheep farms.
However, dairy cattle presented more cases of L. monocytogenes (48.3%) and Campylobacter spp. (100%) than
beef cattle and sheep. Among the thermophilic campylobacters, the most frequent species was C. jejuni, present
in 86.8% of cattle farms and 42.1% of sheep farms; C. coli was found in 10.5% of cattle and 18.4% of sheep
farms. Both species were found in 7.9% of farms. C. lari was only found in two dairy cattle farms and in both
cases in combination with both C. jejuni and C. coli. A selection of 172 VTEC isolates were characterized for stx
and eaeA genes by real-time PCR, detecting stx2 in 59% of them, stx1 in 42% and eaeA in 4%. Whereas in
isolates collected from sheep the most common profile was stx1+stx2 (67%), in cattle stx2-only was the most
frequent pattern (63%). Conversely, among E. coli O157:H7 isolates the combination stx2+eaeA was the most
frequently found (88%).
"#3^*!*<=!<=
Conclusion: Although these are only preliminary results, prevalences found here are slightly higher to those
found in the region in previous studies [1-3]. These differences might be due to improvements in the detection
techniques used here. Still, no increase has been reported in the number of clinical cases.
Keywords: Salmonella spp.; Campylobacter spp.; Listeria monocytogenes; verotoxigenic E. coli; O157:H7; fecal;
foodborne; cattle; sheep
References
[1] Oporto, B., Esteban, J.I., Aduriz, G., Juste, R.A. and Hurtado, A. (2007) Prevalence and strain diversity of thermophilic
campylobacters in cattle, sheep and swine farms. Journal of Applied Microbiology 103, 977-984.
[2] Oporto, B., Esteban, J.I., Aduriz, G., Juste, R.A. and Hurtado, A. (2008) Escherichia coli O157:H7 and non-O157 Shiga
toxin-producing E. coli (STEC) in healthy cattle, sheep and swine herds in Northern Spain. Zoonoses and Public Health
55, 73-81.
[3] Esteban, J.I., Oporto, B., Aduriz, G., Juste, R.A. and Hurtado, A. (2009) Faecal shedding and strain diversity of Listeria
monocytogenes in healthy ruminants and swine in Northern Spain. BMC. Vet Res. 5, 2.
172
173
Probiotic properties and antioxidant capacity of Lactobacillus plantarum 15
&F
#&
&
K. Riane1, M. Sifour1,2, H. Ouled-Haddar1,2, T. Idoui1,3, S. Bounnar3 and S. Boussebt3
!' '$!
'!
1
~"!#;<=^>°
"!*
Laboratory of Molecular Toxicology, Faculty of Nature and Life Sciences, University of Jijel, Algeria
2
Laboratory of Biotechnology, Health and environment, Faculty of Nature and Life Sciences, University of Jijel, Algeria
3
Department of Applied Microbiology and Food Sciences, Faculty of Nature and Life Sciences, University of Jijel, Algeria
Antioxidant probiotics are useful in dairy products and have a benefic role for consumers by providing lactic acid
bacteria with antioxidant potential during their growth in human intestinal tract. In this study we investigated the
probiotic properties and the antioxidative activity of Lactobacillus plantarum 15 isolated from milk. The
evaluation of probiotic properties showed that Lb. plantarum 15 resists to acidity and to bile salts (survival rate
was 86.40% and 80.58%, respectively, after 6h of incubation). The isolate showed a broad inhibitory activity
against several pathogenic bacteria such as methicillin- resistant Staphylococcus aureus, Escherichia coli,
Salmonella sp. and the food-born pathogen Listeria monocytogenes. Then, the antioxidant potential was assessed
where the DPPH method showed that Lb. plantarum 15 cells and supernatant have good scavenger effect
(82.65% and 72.21%, respectively). Results showed a good resistance to hydrogen peroxide (76.12%), hydroxyl
radicals (46.15%) and considerable ability to chelate iron ions (20.52%).
Keywords: Antioxidant activity; DPPH; Lactic acid bacteria; Lactobacillus plantarum; Probiotic
< * * = * * " @ \@ <}={*"*=\*"*§@<@
<@<}=@"{=@*
\*\\"}""@@@"
@ * \@ ¤ @ " "{ @ < @ @ @ *³^^"^=*"}<
\ * " \ } @ *
"{@<@}"="*"
=@"{@"*"*§"@"
"@""{ =@\*"
\@ \ ¤\ ^ " " "" !
#{ @ ^ " * " = " = * "*§ "
"@<"@"*=@"{>"
" @< "*@ < @ @ @
@"@""@@
"@*{|@"=\\=@@"
}@**"@"=*"
@=@=**"{@"\*"*§=
" @ * \ *= = ¤ "* @"{
"#^*
*
¥¦ °@ { # !{ °{ @ { °{ #{ #@ { ~{ » @ { ¢{ " } < " " @ " ¤ \= ^"
"{(/ #ZZ{
¥¦ °@ { ! #{ " { @ #{ °@ #{ » @ { °{ #{ { ! # "=«=
!=@@^#@ ;=@"^ !*=
={WX{
174
175
L
4$:&;$
"&
:&1< !2N;:/"$
;
Relating microbiological and physicochemical patterns of a traditional Portuguese
fermented sausage along processing
4/
%'/
B
(7)B
/2

U. Gonzales-Barron1, A. P. Pereira1,2, A. Gomes2, V. Cadavez1,2, C. Fernandes1,2, P. Rodrigues1,2, L. M.
Estevinho1,2, P. Pires3, and T. Dias1,2

1
#*=|;<=^{#{>\~{
~"»|;<=^{#{{>\~{
#*=|;<=^{#{{>\~{

CIMO Mountain Research Centre, School of Agriculture (ESA), Polytechnic Institute of Braganza, Campus de Santa
Apolónia, Apartado 1172, 5301-855 Bragança, Portugal
School of Agriculture (ESA), Polytechnic Institute of Braganza, Campus de Santa Apolónia, Apartado 1172, 5301-855
Bragança, Portugal
3
School of Technology and Management, Polytechnic Institute of Viana do Castelo, Viana do Castelo, Portugal
2
@"=<@!*@"\*<<#~\@
\ <" * = { # " @
@ \ < < < @@ " @ @ \
<<#@@@~\@{\<@*="
{«*"\<@{«{<@{
" " ¢{ « { \ @ { « { @{
"@==@@\*=*@\^²{
@ = \@ @ \ ^Ë{ @ " " *=
@ < @{ # ~\@ < <= @\ @@ "< <" \@ @== @ "{ #*= *@ < @\ \@ *" @ = @\< ²{ @ < *" Ë{ " *= @ @{ # @ *
@ @ = " ¤ " *" @@ " \
=@\@{
"#!*§#~\@<@#*==={
‘Linguiça’ is a Portuguese ready-to-eat traditional dry-fermented sausage manufactured by small production
units following spontaneous fermentation. In two regional industries, systematic samplings of linguiça at five
stages along processing were carried out in order to investigate the particularities of the manufacturing
technology that explain the different levels of Enterobacteriaceae, S. aureus and L. monocytogenes in the
product from batch to batch. In addition, physicochemical analyses of the product were conducted: pH, water
activity (Aw), sodium nitrite, sodium chloride and polyphosphate (P2O5) concentrations. Statistical analyses were
applied to such complete longitudinal microbial and physicochemical data in order to elucidate main
contamination sources, critical production stages and risk factors leading to the growth/survival of
Enterobacteriaceae and the tested pathogens in final products.
The mixing stage can be deemed as a critical point as Enterobacteriaceae, S. aureus and L. monocytogenes
increased significantly until the end of this stage in the batches from Factory II, which raised concerns in relation
to their good hygiene practices and equipment sanitisation. Analyses of sausages from Factory II, formulated
with nitrite and polyphosphates to meet the maximum legal limits (150 ppm and 5000 ppm, respectively), proved
that their fermentation process was not optimal. The delayed fermentation, and higher pH level, was partly
responsible for the increase in Enterobacteriaceae and pathogens’ counts during maceration. The better
acidification process of sausages, attained in factory I, led to lower counts of S. aureus (2.6 log CFU/g, SD=0.22)
and L. monocytogenes (10 CFU/g, SD=6.3) in the finished products. Nitrite had a strong effect (p<0.01) on
reducing Enterobacteriaceae throughout smoking and maceration, and contributed also to the control of L.
monocytogenes (p=0.061). S. aureus was not affected by nitrite, as suggested by their significant increase in
numbers during smoking and ripening (up to 3.4 log CFU/g) in the nitrite-formulated sausages. S. aureus growth
arouse due to improper fermentation (Factory II) that kept the fermenting meats above pH 5.3 for too long time.
In Factory II, although L. monocytogenes cells entered the chain at the point of mixing, most likely through
contaminated environments, the pathogen became steadily inactivated throughout smoking and ripening, despite
the delayed fermentation. Likewise, Enterobacteriaceae counts decrease in both nitrite-free and nitriteformulated sausages during ripening, mainly because of sausage dehydration (moisture 46.5%, SD=1.25) and
low pH (5.4, SD=0.05).
The main hurdle hindering the development of S. aureus is the pH, and so a rapid pH drop in the sausages is
needed early in fermentation. Other factors contributing to the control of S. aureus, as determined from our data,
are ranked as: longer ripening days (if sausage pH below 5.3) (r=0.877), low S. aureus in casings (r=0.66), low S.
aureus in raw meat (r=0.65) and shorter smoking period (r=0.59). In the case of L. monocytogenes, at least three
hurdles (tested in this study) prevented its viability: low Aw (p=0.004), low pH (p=0.040), nitrites (p=0.061).
Ranked factors that contribute to controlling L. monocytogenes are: longer ripening and smoking periods
(p=0.072), washed casings (p=0.099) and use of nitrite (p=0.179).
Keywords: Enterobacteriaceae; L. monocytogenes; S. aureus; linguiça; dry-cured
Acknowledgments This research was supported through the project PTDC/AGR-TEC/3107/2012, awarded by the
Portuguese Foundation for Science and Technology (FCT), European Regional Development Funds (ERDF). Dr. GonzalesBarron also acknowledges the financial support provided by FCT through the award of an Investigator Fellowship (IF) in
the mode of Development Grants (IF/00570).
176
177
Ribotyping bacterial community existing in fresh fruit juices
I. M. Mashhour, M. A. Alshehri and M. M. Albokari
*
4
>"
0&
.
!
3
Nuclear Science Research Institute (NSRI), King Abdulaziz City for Science and Technology (KACST), P. O. Box 6086,
Riyadh 11442, Saudi Arabia
!E%' /3(',)
%'),12
Fresh fruit juices are becoming more popular and consumption is increasing rather than soft drinks for all age of
people. Routinely, quality control and monitor are carried out in the spot such as open shops using strips, swaps
and other small portable devices for quick tests for handling and cleanness. However, samples of fresh fruit
juices are randomly collected for further investigation and evaluation regarding certain microbial strains of
pathogenic population. Those practical methods and detection do not reflect the bacterial community of which
might be taken in consideration. Therefore, the present study was set up to identify the bacterial community in
fresh fruit juices from the open shops in Riyadh City using advanced rapid technique of RiboPrinter® System.

A total of 27 fresh fruit samples of Orange (n = 6), Apple (n = 4), Banana with milk (n = 4), Cocktail (n = 5),
Mango (n = 4), Arissy (n = 2) and Sugar cane (n = 2) were collected from different fresh fruit juice shops from
central of Riyadh City, Saudi Arabia. Six different agar medias; Total Plate Count (TPC), E.coli Agar, Staph
Aureuse Agar, Salmonella & Shigella Agar, Y&M Agar and Coliform Agar were used to obtain bacterial
isolates. The genetic similarity of total 77 isolates were assessed using RiboPrinter® System, whereas 14 species
were detected. The dominant bacterial species Entrobacter spp. and Klebsiellah spp. were identified and
matched about 90% similarities comparing to built-in library RiboPrinter® System.
Keywords: riboprinter®, fresh fruit juices, Klebsiella spp., Enterobacter spp.

¸;<=!""=#"=!@
¢!""
;<=ô"=@== @==@=^}}
¢

@<@ !=!""=
*""¤
@@""=\<"@<@@""
" ¤ "\ *{ < ^* ^ \ @ <"}"*3{;{
{;{¥¦{"@¸"*
\"\""¨**\
=\@"@="#\@¢©"^{
@@\* @^*^<\=
={@\*\@" {|<"@
@ "" @ " ¤ "@ @ @@= @@"\"¥¦{
|*@ @""@¤"}
Á¢Á<=@"}*{#"@"\"
**@@=@@\¤}{@¤@=
@" \ Á @ @@" Á{ | @ * @
=\¤\@@=*@\@@@<\"{#"@<¤@
}Á"}Á}Á\@@"}*
{@""@<}Á@=<Á@
="{@@""=\*<*"@@"¾"@
"=*@@@@{@""\@¤{
| * @ " " @ ¤ @ " } \@ < } ¢ Á } ¢ Á @ " } * @ "{@@"\**\@@¤Á"@
@ { | @" \ "@ @ Á{ ^= \ " }
""*"***{\"
@ *" *{ #@ " @ < " ¤ < @ "}<*@^\@
"{ @ } @ ¢¢Á \@@ < } @ ¢Á \@@ } @<<Á{"*@"*\@@={|@=@=@=@
= \¤ \ *< \@@ @ " @ = @ * *{
\"{|@@"""\@"
""\@""\*<<@"@=@
@ " ¤{ @" @¤ \ Á @ < ¢ Á @
*@@@"{
|*"@"@@^@"}""@
@"@@*¤}"@@"{|@
"*@@@"@"¤¤}=\@
@@<{
"#"\*<@=""
*
¥¦#}@|{"=*{|ª"*\@=¤¤*@
{@^¤=ª*{{
¥¦{{<!{@=^@"{@{@"@<~\³¤
¢{¢¢
178
179
!
$&
!
"B
&&
B
E
1'/B$'
<
E1
' 1<~B'!
!B' 1'/,
60@.*1'4/</7&'* /
4*6007
&
*=#"#*=|"#" ;<=
§<^{>{*
***@#¸"<º¸>!º
*¹"<Å
*
@<"*{@@"
" @< < " " @ { #< @= @< * * {\<@**
"*"@@@<"@*{@\@<=}
"<"="""¤
< * " * " @ @{
!="¢¢\<**=¤"="*§
"@"{"\*^¢~!"ª
{ @= <
*<"*=^\@
* "ª= * <= "<< @ @ @@@¸"{#=*"@\@@*=
\@@@{!@@""
@ \@ *@ " * " < < <\*{
@ " * @ " * "" \@ @ < @ " @ @ @ "{ @ < @
<="*@<*=\*
<{ @ " "= @ " ! ¤ * @{ ! @} * @ " @
*" \ ¤ *= @"@@"* \ =}{ "@\ *\ \@ @ ¤ @ 3Ø{{\<\{|¤
*=""\*=²©@@
\@ ""{ #< \ \ * ¤ \@
"{
"ª*¤\¤={
"#{="**@"{
180
181
Sensory and microbiological quality of kale (Brassica oleracea var. acephala)
packed in a modified atmosphere using microperforation of packaging film
!
'
B
<(@<(-
R. Biegaska-Marecik1, E. Radziejewska-Kubzdela1, R. Marecik2 and K. Czaczyk2
%'7E,
(' ,H$2')*
%'* 4( 7+

1
Institute of Technology of Plant Origin Food, Poznan University of Life Sciences, Wojska Polskiego 31, 60-624 Poznan,
Poland;
Department of Biotechnology and Food Microbiology, Pozna University of Life Sciences, Wojska Polskiego 48, 60-627
Poznan, Poland
2
The study investigated the effect of modified atmosphere packaging applying microperforation of the packaging
material (MP – 0, -20 and -30 holes with a diameter of 70 m per 262,3 cm2 ) on sensory and microbial quality of
minimally processed kale during 12-day storage at a temperature of 4qC. Kale leaves after washing was packaged
on PP trays of 205/160/60 (mm) and oxygen permeability of 7 - 8 cm3/m2/24 h*atm in batches of 50 g each and
sealed using two types of packaging film, i.e. Opalen HB 55 AF (OPA/PE) with oxygen permeability of (OTR)
35 cm3/m2 /24 h*atm and Flow 70 PEEL PE with OTR 2500 cm3/m2/24 h*atm. Samples were packaged in a
modified atmosphere containing 10% O2/10% CO2/80% N2, 30% O2/10% CO2/60% N2 and 55% O2/10%
CO2/35% N2, as well as air atmosphere. The packaged product was stored at a temperature of 4RC for 12 days.
Quality was evaluated after 1, 6 and 12 days of storage.
The use of microperforation of the packaging material significantly improved quality of minimally processed
kale samples during 12-day storage when compared with samples packaged without microperforation.
Significantly higher scores in sensory examination of aroma and taste (p0.05) were recorded for samples
packaged using MP-20 in comparison to the microperforation of MP-30. In packagings of samples with the MP20 modified atmosphere conditions were retained longer, particularly a higher level of carbon dioxide, in
comparison to samples packaged at the MP-30. The application of packaging film with oxygen permeability of
2500 cm3 /m2 /24 h*atm made it possible to obtain a product with a significantly better sensory quality than
samples packaged using a film with oxygen permeability of 35 cm3 /m2 /24 h*atm, both at a microperforation of
the packaging material and without this measure applied. The dominant microflora in the control sample
packaged in air atmosphere without microperforation (film OTR 2500) after 1-day storage comprised mesophilic
and psychrophilic bacteria (103 cfu/g), yeasts and psychrophilic moulds (102 cfu/g). Lactic acid bacteria were
detected at 102 cfu/g, while coliform bacteria were recorded at 101 cfu/g. The application of MP-20 and
packaging film OTR 2500 significantly improved the microbiological quality of samples during 12-day storage
in comparison to samples packaged with no perforation. Moreover, samples packaged in the atmosphere
containing 55% O2/10% CO2/30%, both using microperforation and without microperforation, characterized by
significantly lower counts of psychrophilic bacteria throughout the entire storage period, as well as lower counts
of mesophilic bacteria after 6 and 12 days of storage, in comparison to air-packaged samples. In all analyzed kale
samples microbiological contamination increased during 12-day storage.
Key words: modified atmosphere, kale, microperforation of packaging film, sensory and microbial quality

#*==;<={#¢"§{
!=@=;<={#¢"§
^@= "= @ ;<= ; !<{ ¢
#

# " << @ " @@ < = ! @@
=={@@*
\@*=@"\|=¤
@ @@ @" " <<{ @* ~!
~! =@ @ "{ | @\ ""< = " ~! { " \@ = { @ =
< @ @ " @ " *@ < < {#<"=@\@""@@*
={
@*§<"=\<"@=@"\="
""@@}@}^*"}@\@
#""\{!@*§<\@
@"{
>@<"*<\=¤"<{@
\\§"{{{}\¤\@"@"{
@=¤\ª^{{{{{{¢{
{{!"*@½\<"\@¤{@¤\
"=^@"=\@"#"*
½{"\"{@\
{ = " " @= @ @ \ "\@ =\@@\@{
<"\@ {@@"\@@
"*\¤{@\"*=
^"@"="^^!
*@{
\@\=@½\{@{\"{
\@"\"{@<"
¤\@¢²<={@^\
{{¤{²¤<={@\{¤@
\{²¤{@=@"@*\@@#\@
^²²²{;\}*=@\@@{
| < \ @@ @ @ { >< < \ @@ ½ @ ½
= = = \@ " { ; @ <\@@@""{@@@<\{
¤"\@¢¢{¢¤"\@@{
"¤\{\@@@<\"\@^{¤
@@@<\"\@{¤{\²¤½
²¤½^²¤½²¤½²¢¤{@
="="^Ë{{
B"
# @ "@ ¤\ " #|~> @ <
^§! {
"##@@"
182
183
<
$
&
$
$
$B
<
&*
$
3'4'!6
73
F0
'!4' '7F'F7'F7'!
B'470!B4
|=@!@||!"==#;<=*!<{
;<º^;<¶!!§"*^"{
}""*!=<»"!= ="
!"~ "|@"*°
@ * "*" " " \@ " " \ * " @ " # @ ¤
#!^{!""@"@"@\@@\@
!^ ¤= < < * @} * " " *"{ @ @ @ ""= *@Ê}¿@<"*\½¢½{@
@@\\@\"*@*"
" * ¤ " *" " { @ @ \¤ \ @
" *" " #!^ @ { *¤\
" @* \ " *
@*½{|@"=\=\"*"
{@\¤"=@@<@=
*"=*@@
""{@\¤ !"
@©>©>\@\@\*=>>*=ª>Ë
>Ë\Ë@""*ª½
*¢@"½¢@"½£¢@"½¢@"½£¢@"½£¢@"
½{!@"*"@\½"=*
¤<={@*\*===\@¤
@=\={@"¤*"*½
!*"{ "
" !~>! \ ={@ * ½ \=
@@"*@"*""
@ * "= "{ @ * = * "= "*"<@@*"<""
@ " "{ > @ @ @ * @ ¸ ""
""*"==*""{
>¤"#!^@*""{!
"@"*"@<""{@"@
*\@*"@""*"\
<{|*@="{""*@
{
@ " @ * = @< * @"@ = @ * @
" <{ \< @ ""= <" @ <" " "@
*@ @ * "= { @ "= \ " < @
*<**!!
#! @" " = "
\@@ \ " °{ ! \ @ *= |# "* = ¤{ ! \ " @
"@°{@<<**\{¢
;@\{©{@="\@@=*=*
*{;{\=@""
\ =¤ " @ < \ " ;{
!#\=@"=}
@ "={ @ " \ * " " * °@}\@{
"#="*°
#"@\@@="
"@"@"*"""={
"#@"*"
*
¥¦{°¤!{}°{»>{{@@¤¸=<{
*X¢«{ª{¢§{{¢{{¢
B"
# @"@"=¤\ "··|<®|
!¸¸ ||!# ;|¢ " #¶ "= =
#;<=**="®ð{
184
185
<
$
!6#
$
$
-
&
<
&-
&-#'
6%'4
('46
('
%
*@6
,

~";<=@¤@ ¢¢!^;°

.# @ " *= = ! @ § @ "*¤=*@"3#{=¤\@
@ !=<=\""@*@<"3#=
* < * * " @ @
{ @ " @ ! = \ \@ @ " " @
*={
~"@@=»^@=;<=
¢¢!;°
"#*=@~"~;<=
| \= \=|
6Bª@"3#@@
@" *" " { @ *" < \@ " @= @=<= @ @ # @ = @ <"= * *" <*={
# ! <= *= @< * @ " @* @ "
*= @ { @ " \ @ @ !
=°3#{"@"@
*=@ !=\"@@@*=\@
{

&1
ª @ " @\ @ # 3 # <= @
@\@ {|@"=\"<@"<"<"
<@@{
# |= \ @ "<< " "" | Ã#
><@ *¤"{\\"*
* \ ± ± @ < @ \ = @ \@{ ¤ " = *
*\@Ã#{=@@*@@"<<"<\
=""\@"<<\{"@
\={<@*<<
<\@$[1WU*W[Z
3 # *= #* #) #1 @ * " @
=@\@3#"¥¦{@
@=@ \ @ 3 # { ! \ {""{
*
#>@\<=""""@<@\*@
<{@""""{¢#"
{¢#""@"<<3#"{"
""""#\@@"<
@@""{
*
ª|@"=\@\"<=\@@@
#"@@>=@
*={@\@\@±"@@<
@±{@<=@""@<\@@@
@<*"@<""{><@@<=<
{;*"*\@Ã#
!\@"<=@ *¤"{"@
"{ >< \ " \@ "<< \ \ \@ @ "<< " " @ "<< \ **= " @ <={
"@\<==\@@\\@@
"<<{|=@@*@@@=^\<"
=<*"\"*\@\Ã#{
"*"= \ < @ @ @ *= @ \@ " {|="@\@@*<"="@"\"@@
==\@"<"={"@@@\
*= ==\\@"{
|"@"<<\@#"\@\@#*=="<
\@ \ " ¤ " @ @ " *" @ *=
" @ " " @ @ @ { \< \
@ \@§ !<=\@@\"*=
{
4#@"*==<=""\=@*@ !=
@<@"@ !={
4# @ "= " @ @"@ # < @ " @ < " * { | \
@=\@@=@@=3#{
!=@"@*@@@=\"""""\¤\
"@{
@ !=*=@#**@<@*<"=*@@
! = " "@ < "= " @ *= @
¸\@"<<"{
"#@*"*=
"#@=><3#
*
#
¥¦^{{={ @{ {#{
{U*
¥¦#{{'U{
¥¦@={°}°! {+
#{
*
{!{>¾={^{»°{{{
DS
{><{{>{{#{»°{{{
SD¢{
{#@{#{»=¤ {!{{
D¢¢¢{
186
187
<$
$&
&
E&$
&
'&
$&
B
&
E
B%'0$('
(',6
2'E,
2'!%'
%
}B%'(')7B
%

|"#*=!"
|"@!"

;<=@^<<"
|"°";<=@=¤<{°"@"
@=°";<=@=<"{°"@"
*===*!!"@
@= ¤ *{ @ @ \¤ = @ " @ @== *=
<@@*!!{\=@\"@
={ @ * @ !! " " @= ª * 3 3 3 3 3 $ * " 3 { @ ""
\ @ # " @ " \ " "<
^=@"@""@@=={@\@
@ < @< }= \ 3 "" { {
{@{~!\\"
* @=*}{ < * ~! * @ \ \ <ª
@= ¢ * ##" =@@= * ## @" *@
}= ¢ * # @" ¢¢ * 3 ¢" * ¢
" * "" *{ @ @\ <
{ ! ## {© « ##" {¢© « { \ @ }=\@@<=«3{©@{¢©3«
*@{>={¢©@=@}~!#{{{{"<
*"@<<<@@==*=!!\{@\
*@##{@""@@}=@"
*=#@\@{
@ @ \¤ \ @ *" " @ <*= "@@{
"© *" "¢© @* ¤ <* ¢© \ " <{\"*=@""}{
@""<Ñõ¢ Ñõ ;@{!
}@"*=@*¤<**=
*""\@¢©*=*"\@©{!}@
<*\*"\@@<*""©*¤
<*{@*""\@¢©"©<*@
"{
"#*"}!!<*=
B"
ª @ "@ \" ¤ @¤ @ " @ ~ " #= ""*"#;~|{
188
189
F
&&
&$
B
&$
$
&
$
"
&B!
BX%(' !B
2'@11,' 6
2'&7
E
,
%' *
@
&%'D/
6'SC)'R6$
,

|"=@#}";<=#}"|
"#"|"=@@#}";<=#}"
|

@¤^@°@}#*=!};<=§|

|"=@#°;<=#°|
¢
#*=!};<="§|

#*=!};<=!¤|

|#@#}";<=#}"|

6Bª@<@""@
= *\ { ³@" ¤ " \@ "" **\@@"*}=@""{\<@
*@@"<;@*{|@\
@"=@*@<"=\{
Industrial microbiology
ª^"}*=@"<**"*"@"@
\"<#*@"@*=@{@@*\¤\@
; @{ ^@ * " ^# ¢ ; \ @}
**==""""\@¤*^#|
¢"©@{| |~ò~\""^#
*=|!{
*
ª@=@"<*@*=="| |~ò
~ *ª \@ Ë{{@*"*"@""|
Ë{Ë{Ë{Ë{<={*"@""~
|~ò Ë{{ @ " @ < ~ |~ò *=
^# @ \ = \ @ " *= ~ª Ë{ |~òª
Ë{
4ª@@\@*@**=@=
= " "< { | @ | " *=
*"@!"=@""*@~|~ò"{
"ª|"";<*"*"@"^*=¤
190
191
A low-cost solid fermentation medium for potential prodigiosin production by
Serratia marcescens UCP/WFCC 1549
Andean Thermal and Saline Springs: Reservoir of Biodiversity and Source of
termostable enzymes and metabolites
D. Montero-Rodríguez1,2, R. F. S. Andrade2, D. Rubio-Ribeaux1,2 , R. A. Lima2, D. L. R. Ribeiro3, G. K. B.
Silva2, H. W. C. Araújo4 and G. M. Campos-Takaki3
Gina López, Javier Gómez, Carolina Díaz-Cárdenas, Carolina Rubiano-Labrador and Sandra Baena
1
Center of Biological Sciences, Federal University of Pernambuco, 50670-420, Recife, Pernambuco, Brazil
Nucleus of Research in Environmental Sciences and Biotechnology, Catholic University of Pernambuco, 50050-590,
Recife, Pernambuco, Brazil
3
Chemical Engineering Department, Federal University of Pernambuco, 50740-521, Recife, Pernambuco, Brazil
4
Chemistry Department, State University of Paraíba, 58429500, Campina Grande, Paraiba, Brazil
Unidad de Saneamiento y Biotecnología Ambiental, Departamento de Biología, Pontificia Universidad Javeriana, POB
56710, Bogotá DC, Colombia.
2
Nowadays, synthetic dyes are extensively used in various fields such as food and textile industries, paper
production and agricultural practices. According to green technology, less synthetic products and more natural
starting material is favourable for current production lines. Thus, the interest to natural pigments is growing due
to their better biodegradability and higher compatibility with the environment [1].The production and application
of microbial pigments as natural colorants has been investigated by various researchers. However, due to the
high cost of using synthetic medium, there is a need to develop new low-cost process for the production of
pigments. In recent years, utilization of raw materials and by-products of agro-industrial origin have been
proposed as promising alternative [2]. This study was aimed for growth and prodigiosin production by Serratia
marcescens UCP/WFCC 1549 using solid agro-industrial residues.
Production processes were carried out in Erlenmeyer flasks through solid-state fermentation (SSF) using 10 g of
dry solid substrate: sugarcane bagasse, wheat bran and a 50:50 (m/m) mixture of these solid materials,
supplemented with an impregnating solution containing 3% waste cooking oil. A 24 h-culture of S. marcescens
on Luria Bertani medium was used as inoculum. Cultivations were conducted at 28°C during 12 days. Then, the
flasks were incubated for three times with 100 mL distillated water for 1 h at 200 rpm and 30°C. The biomass
was obtained after filtration and centrifuging of extracts for 20 min at 9500 rpm and was quantified by dry
weight. The red pigment produced was extrated from the biomass in solvents system chloroform:methanol (2:1,
1:1 and 1:2, v/v), evaporated to dryness and quantified gravimetrically. The dried pigment was dissolved in
ethanol and submeted to spectrometry scan in a wavelength of 200-700 nm [3].
The results demonstrated that S. marcescens UCP/WFCC 1549 was able to grow in all tested solid media, but
highest production of biomass was obtained on wheat bran (579.46 mg/g of dry substrate). However, the highest
level of red pigment (126.44 mg/g of biomass) was obtained on mixture of sugarcane bagasse and wheat bran.
The pigment was identified as prodigiosin by the maximum UV absorbance at 536 nm.
Thus, this work showed sugarcane bagasse and wheat bran as novel and suitable substrates for the production of
prodigiosin by S. marcescens. The use of this cheap medium can reduce the cost and increase the industrial
applicability of prodigiosin.
Keywords: prodigiosin, Serratia marcescens, solid-state fermentation, sugarcane bagasse, wheat bran
References
[1] Venil, C. K., Zakaria, Z. A. and Ahmad, W. A. (2013). Bacterial pigments and their applications. Process Biochemistry,
48(7), 1065-1079.
[2] Panesar, R., Kaur, S. and Panesar, P. S. (2015). Production of microbial pigments utilizing agro-industrial waste: a
review. Current Opinion in Food Science, 1, 70-76.
[3] Lins, J. L., Maciel, C. C. S., Xavier, H. S., da Silva, C. A. and Campos-Takaki, G. M. (2014). Production and
toxicological evaluation of prodigiosin from Serratia marcescens UCP/WFCC1549 on mannitol solid medium.
International Journal of Applied Research in Natural Products, 7(2), 32-38.
192
Terrestrial thermal and saline springs in tropical Andes are habitats of a high diversity of microbial species,
metabolically diverse and potentially useful for industrial processes. The springs are located in the Eastern and
Central mountain ranges of the Colombian Andes having temperatures between 50°C to 70°C, pH 2.0 to 7.5 and
Total Dissolved Solids (TDS) content of 20-54 g.L-1. The composition of microbial communities was analyzed
using culture-independent and dependent approaches to generate biodiversity inventories. The results indicated
that these springs harbor a microbial community made up mostly of Fermentative and chemotrophic organisms,
some of which were involved in sulfur cycle. These studies show that these springs are source of new taxonomic
diversity (Diaz-Cardenas et al, 2010; Rubiano-Labrador et al, 2013).
Several strains selected to analyze enzymatic activities were capable to produce mainly amylases, proteases,
pectinases, xylanases, esterases, and lipases. Among the selected strains are highlighted thermoacidophilic
bacterial strains that revealed high lipolytic activity. A novel lipolytic enzyme named 499EST, was obtained
from the thermoacidophilic alpha-proteobacterium Acidicaldus USBA-GBX-499. Sequence alignments and
phylogenetic analysis indicated that 499EST is a new member of the bacterial esterase/lipase family IV. The
esterase reveals its optimum catalytic activity at 55°C and pH 9.0. This enzyme also exhibits stability under harsh
environmental conditions, and enantioselectivity towards naproxen and ibuprofen esters, yielding the medical
relevant (S)-enantiomers (López et al, 2014).
Most of the anaerobic thermophilic isolates was closely related (between 96 to 98% 16S rRNA sequence
similarity) to Thermoanaerobacter italicus and Thermoanaerobacter mathranii, subgroup II (sensu Subbotina et
al., 2003). Our results show that Thermoanarobacter sp. USBA 018 has the ability to produce L- lactic acid on
batch fermentation using glucose as carbon source. Under these culture conditions, the yield (Yp/s) was 0,96 g.g1
with a productivity of 0,62 g/L.h and a lactic acid maximum concentration of 16 g.L-1 at 26 hours of
fermentation (Gómez et al 2015 submitted). The D-lactic acid isomer was not observed, indicating the optical
purity of the produced metabolite, which constitutes an advantage over other types of fermentation with lactic
acid bacteria, routinely used in industrial fermentation, or chemical synthesis of lactic acid.
These microorganisms are relevant for their abilities to convert different substrates to end-products, and/or
compounds with potential utility in the production of bulk chemicals.
Keywords: Bacterial diversity, Colombian thermal and saline springs, lactic acid, lipolitic enzymes.
References
Díaz-Cárdenas C; Patel B.K.C, Baena, S. (2010b) Tistlia consotensis gen. nov., sp. nov., a novel aerobic chemoheterotrophic
free-living nitrogen-fixing -Proteobacteria, isolated from a Colombian saline spring. Int J Syst Evol Microbiol; 60,
1437-1444.
López G., J. Chow, P. Bongen, B. Lauinger, J. Pietruszka, W. R. Streit and S. Baena. 2014. A novel thermoalkalostable
esterase from Acidicaldus sp. strain USBA-GBX-499 with enantioselectivity isolated from an acidic hot springs of
Colombian Andes. Appl Microbiol Biotechnol. 98: 8603-8616
Rubiano-Labrador, C., S. Baena, C. Díaz-Cárdenas, B. K.C. Patel. 2013. Caloramator quimbayensis sp. nov., an anaerobic,
moderately thermophilic bacterium isolated from an Andean terrestrial hot spring. International Journal of Systematic
and Evolutionary Microbiology. 63: 1396–1402
Subbotina, N. A. Chernyh, T. G. Sokolova, I. V. Kublanov, E. A. Bonch-Osmolovskaya, and A. V. Lebedinsky. 2003.
Oligonucleotide Probes for the Detection of Representatives of the Genus Thermoanaerobacter. Microbiology. 72 (3) :
331–339
193
6
'$
$
!!
$
<(N-
&
6
&
$$
"
"!$&B
3 4%' .,=
%')H,H%'74!
(
,I%*4&=% ,(

"^^*!""@>^>|!¤#"¶
*

~;<=*@="=¶*
!@=;<^¡"=!<
¢
!#@|||;<^¡"=!<¢

=\@"=\@@@"
@"*@@"@@<"=\@*"¥¦{
|@*<="*==ª~"
"*@@"\{|@@"""
=@*="@@¥¦{@@@\¤
\ @ " *@<" @ @ "<= =
"*x@ <* "@ @ * " © "
"±@<¤@*"="@^;
=@"@"¤""\@*
" { @ " \ \@ " *= =
{,@\"^>^³!ö**
¢\@\< \ "{ \ = *= " ^ @ =\§"{
" @\ @ @ " ^¨{ @ \ ^¨{ @ ª~ ^¨{¢ \
@@"<={@@@"\*="{©{
" " @ " ^; @\ <" " {{±\@"{±{@\"@"
\ " { ± " { ±{ | @
"\@\=@@"{±{@"<"\@
@"¤ " { \ @@ @ " <" ^; {¢
{@""@""*@<"=@@"{{
@ @ < ^; " @\ @@ " @ \ @ = { ¤@ ¢{ ¤@ { ¤@{ = @ " " @ @ " <*\@@@""<="
"@={
"#*"@ª~\
*
¥¦@{{{#{ª{¢
¥¦ ° !{ @§ { !{ §} ^{ @@ @ #{ {^= @ " ¤ *
{|@{ª{¢§{§{{{
¥¦#@{!{<#{°~{¢{*{|~ª{
{
¥¦>§¤{{*{{"{#{{}!{{"ª@
"={|{
""@=|"@*\@""=\@=\\@
@*=@*="*!={
#= *¤ \ " @ @ @ ""@ @= " @
\@@\"¥¦{@*=@""@=*
*= " @ @"= * " *\ ! =
= @ <{ @ @ "= \ @ @
*@ * *= " \@ ""@ \@ @ \@*¤<<@{
! @ @ "= " \@ ""@ \ \ *¤ *"=*@"@"{
""@@@@@=\¤å½"@
@ @ < ¤ \ @= " <
@{*@*@""@""@@*=!
@ \ @ < "
" \ ={ * = \@
@@ = = \@ @@ ! # \@"*\=\{
@ * " @\ ¤* = *\ @ \ " \@
""@ @ *= " @ @ ""@ \ <{ <" *\
{{{¢{@""@@==\@<"*\{{
¢{{~>{~"@<={|*@""@!\@
<=\@=\""{*"!*\{
{{{;@""@=*\¢{{{{;
= *\ {{ {{ ;{ " @ \@ @
}= @== @ " \ <* @ { @ ""@ <="{{{{@
*@{!@"@@=@\@!~>!
@\@*@*"@"
@**¤"@@@@*¤\
@=*{|@""@"="
! = \ * "{ @ @ @ < @ ""@ " "* " "\@""@"*¥¦{{
"#"""@**=*@*=
*
¥¦ ç < # * :;{ @ * = *@= *=""@\@="{,({>|ª{{
¥¦#@@<¤!Ä@¤^|{<"@*"="=
""@"""*¤<3@{+
ª{
194
195
Bioconversion of Whey Lactose into Single Cell Protein using Killer Saccharomyces
cerevisiae Hybrids
6
&&
@
&:E@&;
-$
$'
F
B&<
!
A. A. Tayel1, W. F. El-Tras2
1
*}@;<=#"= *}°;°³
2
@ \@ @ <
@*#\\""\@"""""
*@==\{ \@""\@{*<@
"\@"{*\
\@@"*"©"\{@\¤@\*=*
""@"*"<"""@""
@==\\{
"ª"O@""\<@*
Genetic Engineering and Biotechnology Research Institute, University of Sadat City, El-Sadat City, Egypt
Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt
Single cell protein (SCP) production was always regarded as a potential strategy to overcome food shortage and
worldwide hunger. Cheese whey is globally produced with very large amounts and without appropriate
utilization approaches. The construction of a killer Saccharomyces cerevisiae strain, with the capability to
assimilate lactose and with competence SCP production, was the aim of current study. Using the protoplast
fusion technique, three fusant strains (i.e. SK2, SK36 and SK55) were chosen after hybridization between killer
yeast, S. cerevisiae, with Kluyveromyces marxianus, as a lactose assimilating yeast. Fusant strains had both the
two desired characteristics. The fusants’ production of SCP, from cheese whey, exceeded the productivity from
their parent strains with increased amino acids contents and killer toxin secretion. The hybridization between the
two parental yeast strains, however, could be recommended as an efficient tool to have superior fusants for SCP
and killer toxin production from cheese whey.
Key Words: Killer Toxin; Lactose Assimilation; Protoplast Fusion; SCP; Yeast
Killer toxin secretion by the selected fusants
(SK2, SK36 and SK55) compared to their
parent strain Saccharomyces cerevisiae (S1)
using Candida albicans as indicator strain
SDS- PAGE protein pattern of the parent
strains Saccharomyces cerevisiae (S1) and
Kluyveromyces marxianus (K6) and their
selected fusant strains SK2, SK36 and SK55
196
197
Biosurfactant production by Candida glabrata (UCP1556) and Penicillium
spinulosum using full factorial design
6
$&
&$$
&
$
$
P. N. Santos 1,4, A. C. R. Carvalho 1,4, , H. F. Nobrega 1,4, A. A. Antunes 4, P. R. B. Filizola 2,4, M. A. Pele 3,4,
P. C. V. S. Maia 1,4, C. F. B. Costa Filho 1,4, V. P. Santos 1,4, E. R. Santos 4 and G. M. Campos-Takaki 4*
)*&*&
-%'2'*3!
2') *H
%'2' 402' %'2'
2'03(' 60(', 4$<BB2
1

2

;<=^*"¢^*"}{
=";<=^*"^*"}{
~""@<@;<=^*"^*"
}{
Master in Development of Environmental Processes, Catholic University of Pernambuco, 50.050-900 Recife, PE, Brazil
Northeastern Network of Biotechnology (RENORBIO), Federal Rural University of Pernambuco , 52171-900 Recife, PE,
Brazil
3
Center for Biological Sciences, Federal University of Pernambuco, 50670420, Recife, Pernambuco, Brazil.
4
Nucleus of Research in Environmental Sciences and Biotechnology, Catholic University of Pernambuco, 50050-590
Recife, PE, Brazil;

"@@"@""@"@\@
" " ¥¦{ @= @< = < @
@= =@} "< *" @= ** @}" ¥ ¦{ @
=@} @ " @=* \* \ "* "@ ""¥¦{@"@@\¤\<"@*""*=
"\"*}{|}@
" @*" \ " " " \@\@=<\\==*"*{|@*
@\}@"{"=*\"
"³#!³#!\@©<<"@\}{@"
@\"@*""*={\~"
©\@=©<\\©=={@"*@
\ © © * ¢ { "* © @\ @ @@ <" " ª © { @ " @\ @ <="*"@"={
Biosurfactants are produced extracellularly by microorganisms such as bacteria, fungi and yeasts. Structurally, it
has amphipathic characteristics due to the presence of a hydrophobic and hydrophilic region in the same
molecule. Also, they have activity on different types of surfaces and interfaces conferring numerous advantages
such as biodegradability, low toxicity, production from renewable resources, functionality under extreme
conditions of pH, temperature and stability when compared to chemical surfactants [1]. The production of
biosurfactant by fungi is promissory due to high biological diversity. On the other hand, total chemical surfactant
produced is estimated to be over 10 billion [2]. Therefore, new alternatives to replace chemical surfactants for
biosurfactants are being investigated from renewable sources, such as agricultural residues [3]. In this context,
the present study aimed the production of biosurfactants by the fungi Candida glabrata (UCP1556) and
Penicillium spinulosum in low cost medium constituted by waste industries such as corn steep liquor and postfrying soybean oil added of a salt solution. The optimal concentrations of the components were established after
conducting three different factorial design of 2². The biosurfactant production was investigated by determination
of the surface tension. The yield of biomass was also investigated in all conditions of factorial design. The results
demonstrated that the fungus P. spinulosum showed high potential to reduce the surface tension (72 mN/m to
32.9 m/m) in medium consisting of 5% corn steep liquor and 3% post-frying soybean oil in the first factorial
design. In this same medium was obtained the highest yield in biomass with 16.32 g/L. Thus, these results
proven that P. spinulosum was the most promising for biosurfactant production using waste as an economic and
sustainable medium.
"#!*""\*{
*
¥¦"{{"{#{"**{!"{{#{{{!{{¤¤ #{!*
@<*"""*=;^{"ª{
¥¦{#{^{{®{{<@!{#{#{{!{{{
«{
¥¦¬"${~¤§#{"{@{|"#"{¢«{
¥¦ |{ #{ } !{ |{ { # #{ {@{ =@{{#@{ #*
*""{!{#*{@{«{
Keywords: Biosurfactants, fungi, industrial waste, factorial design
References
[1] Decesaro, A.; Rigon, M. G.; Thome, A.; Colla, L. M. Produção de biossurfactantes por microrganismos isolados de solo
contaminado com óleo diesel. Química Nova, v.36, p.947-954, 2013.
[2] Silva, Rocha, N.M.P. et al. Screening of Pseudomonas species for biosurfactant production using low-cost substrates.
Biocatalysis and Agricultural Biotechnology, v. 3, n. 2, p. 132-139, 2014.
[3] Morais, R. K. S., Abud, A. K. S. Utilização de biossurfactantes produzidos a partir de resíduos agroindustriais na
biorremediação do petróleo. Scientia Plena, v.8, n.10, 2012.
198
199
Cholesterol biotransformation into androstane steroids by Rhodococcus species
M. Talbi1, F.Z. IbnMajdoub Hassani2, A. Elalami1, S. Amzazi2, J. Kreit2
1
National centre for the control of pharmaceutical drugs, PO BOX 6206, Rabat, Morocco
Laboratory of Biochemistry, Faculty of Sciences, PO BOX 1014, Rabat, Morocco
2
Citric acid produced by Aspergillus sp (SIS 09) using agroindustrial waste derived
from the fruit industry in alternative media for submerged fermentation
M.C. Sá Muniz1, C.M. R. Moura1, B.F. Lima1, J.F.Silva 1, G.K.B. Silva1, , N.R. Andrade Silva1, M.A.B.
Correia1, D.K.S.T. Maciel1, E.C. Vasconcelos2, G.M. Campos- Takaki2 and C. A. Alves da Silva2
1
Pharmaceutical steroids serve a wide range of therapeutic purposes, including anti-inflammatory, progestational,
adrenocortical, estrogenic, diuretic, anabolic drugs and contraceptive agents. Their commercial production is
possible starting with cholesterol or plant sterols; all are naturally abundant occurring products. However, the
selective cleavage of the sterol side chain is essential step in the industry of steroids. This specific cleavage is
obtainable by the microbiological way that converts sterols into C21 or C19 steroid precursors with satisfactory
outputs (Figure 1). Then, functionalization of the steroid precursor leads to various active molecules.
Mestrado em Desenvolvimento de Processos Ambientais (MDPA), Universidade Católica de Pernambuco, Rua do Príncipe
526, Boa Vista, CEP 50050-900, Recife, Pernambuco, Brasil
Núcleo de Pesquisas em Ciências Ambientais e Biotecnologia (NPCIAMB), Universidade Católica de Pernambuco, R. do
Príncipe, 526, Boa Vista, Recife, PE, 50050-590, Brazil.
2
Citric acid or hydrogen citrate, is a carboxylic acid (2-hydroxy-1,2,3, - propanotricarboxílic) is considered weak
organic acid produced by the aerobic fermentation of sugar, but also from renewable sources, and the main
constituent of citrus fruits and a major acids produced by micro-organisms [1] . Its use is concentrated mainly in
the food, cosmetics, pharmaceuticals and beverages [2]. The Aspergillus genus is considerate in biotechnology
one of the most important producers of bioactive substances used in various industrial sectors [3]. Assays
involving full factorial design were performed 23 for citric acid production using media containing agroindustrial
waste industry of fruit juices in the Northeast of Brazil. They were used pineapple waste, acerola and orange. The
assays took place on an orbital shaker at 150 rpm, 28 ° C at 144 hours, were determined the production of citric
acid (g / L), the variation of the pH during the fermentation process and the concentration of reducing sugar (g
/L). The results indicated that the alternative medium containing pineapple at a concentration of 50g / L, as best
condition for the production, obtained 31,51g /L of citric acid in 120 h. The results demonstrate the effective use
of agro-industrial wastes as alternative substrates for the production of citric acid through the formulation of
alternative media, as the reuse of this wastes contributes to minimizing environmental impacts and reducing the
production costs of organics acids widespread use biotechnology.
Keywords: Aspergillus, organic acid; production media formulation
Support by SISBIOTA-CNPq, FACEPE, CAPES, UNICAP.
1
Figure 1. Microbial sterol catabolism. ChOx: cholesterol oxidase; (a): 3-ketosteroid Ã dehydrogenase; (b): 3-ketosteroid 9hydroxylase; in vivo deactivation of (a) and/or (b) leads to the protection of the ring B from rupture with possible
accumulation of derivatives
In a previous work a species of Rhodococcus, strain GK1, was characterized to be a potent degrader of sterols,
comprising -sitosterol and cholesterol [1]. In the presence of Ni2+ or Co2+ added into the strain culture on
acetate-cholesterol [2] or cholesterol alone (present study), steroid derivatives were accumulated in the strain
growth media. This accumulation was due to the inhibition of 9-hydroxylase, a key enzyme in the steroid
nucleus rupture (see Figure 1), with the used metallic cation.
References
[1] A.R. Angumeenal, D. Venkappayya (2013). An overview of citric acid production. Food Science and Technology. 50(2):
367-370.
[2] M. Chávez-González, L.V.Rodriguuez-Durán, N. Balagurusamy, A. Prado-Barragán, Rodriguez, R., J.C. Contreras, C.N.
Aguila (2012). Food and Bioprocess Technology. 5(2): 445-459.
[3] J. Zhang et al., (2015). Optimization of fermentation medium for citric acid production by Aspergillus niger. Advances
in Applied Biotechnology. pp. 497-507.
The present communication concerns the obtention of three major catabolic derivatives of cholesterol by
culturing the strain GK1 in a mineral medium containing cholesterol (2 g.l-1), as the sole carbon source, and 1
mM Co2+. These derivatives were purified on preparative silica gel plates TLC, and then were subjected to
analysis studies, involving molecular behaviors on TLC and HPLC, UV and IR spectra. The registered
observations showed that two of the derivatives are androstane steroids: 4-androstene-3,17-dione and 1,4androstadiene-3,17-dione. Optimization of the production process of these molecules and their final
characterization are under development.
Keywords: cholesterol; biotransformation; Rhodococcus
References
[1] Kreit J, Elamrani R, Melloul M, Elalami A. Taxonomy of sterol-degrading species of the genus, Rhodococcus. In:
Microbes in Applied Research: Current Advances and Challenges (Mendez-Vilas A editor), World Scientific Publishing
Co Pte. Ltd 2012, ISBN: 978-981-4405-03-4. PP 644-649.
[2] Ibn-Majdoub-Hassani FZ, Elalami A, Amzazi S, Kreit J. Biocatalysis of cholesterol side chain cleavage by Rhodococcus
sp. CIP 105335. Biocatalysis-2014 International Conference, Hamburg University of Technology, Germany, August 31September 4. P3-31/book of abstracts.
200
201
4$
-$
&
&
$
&
4
&
$"1
37*H38
%'4*E%'@ E%'7,H (' H
7+
2<
/%
"=!@=#;<=Ê^@¿"@^}""@
¢
!,' !
'!.7',.$

¹=¹|<="!<}|"^º
~!<{|^~¢{{#º{
º=¹#"|<="!<}|"^º
~!<{|^~¢{{#º{

|"¹;~!#"<##º{
=\@*"@==<{
"\@@*=\@<="*@
* * { " @ @@ == @@ \ *
= @ @ @ *= \@ <*
\@@"@@\"¤<"
@{>@\*¤*"@<*=@
* < @ " @ "" ¤ "" \{ @ \ <
" \ "" " ¥¦{ \ @
"< " " §" @< < < * < * " ¥¦{

@@<*""="<@{|#@"**
*@@""\*"@@="=<
*}¤*{
@< " @ " @" # @= "" \{ @
*" @ = }= " * " @ *
"}<@"==@"{!<=
" @ \@ "" \ # < " @="@\{
@ @ "= "" * " " "" "
§"*"*¤*=*={@"\@}*="
=|¬===#{@¬
=*"¬==|<@@""*@
@ "{ @ "" < < " * "=@<@"\@@
@""{
|@**<@"""@@=
"*@¥¦{"@#!@
" " # <= * @ {@#!#\"~!@
³¬\"<<*"{\<
@<""@*\@@*=
\<=\¥¦{>@¤==@"*{
"#*"""§"*¤*=*=
*
¥¦ { "" { ^"" {{ { # |{ » ^{ (N%%{ "" @} * " "*= . # { * " \{ "¢{
¥¦°""!{¤{³@³{~¤"³{(NNP{;}<""§"*"
"*" ~¢"!¢{
¥¦ ;@ #{ ;=¤ °{ !" !@ °{ !{ (N%%{ ^ " ^" #"*=~<| "*{+"«{
¥¦ ¬{ { ^{ * { { } "" * "
"*= ^="{"!¢{
|@\¤"=@*=@"#!"\}
"{@}\*=^*=
@ < ^ <"= * *= = @ " ³¬ *=
"{
@"\@@@@"@\<*=
^ "{ \ *= \@
<<{@\*="@="\@""{}=
<= \ <" *= }= \@ #; # "* " " < <={ " }= <= \ = @ "" "
*@ @ *= @ * = \ * " * " \
{
"#"*@
*
¥¦{{{={{={{==@""*=
*{#*{
¥¦ #}̻!"= { { ^̻ { #{ ¹̻# { ̻< !{ { { #{ ̻#¹} #{ ^̻~= { " " @*̻ #^~̻̻"*={!@#*¢«{
202
203
)
$$
$&-
&
Cyclodextrin glycosyltransferase biosynthesis by genetically engineered
fermentative Lactococcus lactis in aerobic system
7E '!'3E3' 74'/ L6$' 3EL!'/6
,Z
A. Amiri1, M. Rosfarizan1, 4, 5, A. R. Raha 2, 4, Z. S. Wan3 and A. Arbakariya1
!*;<^*"{!<{^#
;<«¢}
1
Department of Bioprocess Technology,2bDepartment of Cell and Molecular Biology, 3Department of Microbiology,
Faculty of Biotechnology and Biomolecular Sciences, 4Institute of Bioscience, 5Laboratory of Biopolymer and
Derivatives, Institute of Tropical Forestry and Forest Products, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor,
Malaysia.
>@\="="=¾=*"@""¤<
{ @ @ @" "@ * \@@ "} @ * ""<<<<¥¦{
" ¤\ * @ @=* * { @ = ¤\ @ @ " \ @ " * <
@ "* *@ "{ \@@ @= " @=* " @ @ @ \@ @="@"¥¦{@*§<@"=\<"@*=
*@ @ * *{ @ * " "
*@#;^{|=\@*@"\@
" "< ¥¦{ @ \ "*§ } {@"@**="=^¤»
"@*""*§*@¥¦{<"@=@"
@< * = ""*¥¦{ @ "
# & @ @ * \@ ¢¢{© @ " @
@ {©{ @ @ " "* \@
{¢©@"@=*@"\@*@@{
@*@\@"\@"\@"<\@\
*< < {© @=* @@ @ @ " @ ¤ \@ @ { | @== @ " @ "<¢{©@ |""*{!@"
@@@\*<#&¢{©@\\*=#
#{©{|*@*@<{¢©@\\¢{©{|@
@*"@\ |¢{©\@@<="\@
@ ={ @ " = @ " # & * @ " * " @ @=* "{
Lactococcus lactis is a facultative anaerobe famous for its fermentative metabolism. Its applications in different
industries such as chemical, food and pharmaceuticals followed by its Generally Recognized as Safe status as
well as being a model lactic acid bacterium and an interesting candidate for heterologous protein
production/secretion have made this bacterium interesting to be investigated under different conditions. L. lactis
has been traditionally employed in dairy and other food industries to produce fermented products. Therefore,
research about L. lactis has been directed toward fermentation metabolism. Despite the classification of L. lactis
as a facultative anaerobe, besides availability of extensive number of studies on its fermentative metabolism,
some studies have pointed its ability to undergo respiratory growth in presence of a key chemical component in
aerated cultures. It should be noted that L. lactis has been isolated from some plants. Intrinsically and in
retrospect, it is not surprising if they endure and function under aerobic and respirative conditions. The key
component for successful respiration of L. lactis is hemin. It is based on the fact that hemin cofactor is the only
component being missed from the respiration electron transport chain in cell membrane of L. lactis. Therefore, L.
lactis metabolic flux can be redirected to aerobic respiration by addition of hemin to the growth medium in
presence of oxygen. It has been reported that aerobic respiration of L. lactis with the aid of hemin results in
higher growth and biomass concentration, long-term survival and robustness. It is very applicable, as slow
growth rate of L. lactis could be the single most important parameter making it less competitive protein
expression system as compared to some industrially common strains such as Escherichia coli. Unfortunately,
studies on L. lactis protein production under respiration conditions are very rare. While, there are various
heterologous proteins being produced by recombinant L. lactis. Additionally, there is not enough information
available about genetically engineered L. lactis behavior under aerobic respirative conditions, despite the fact
that such interesting studies can lead to evolution in sciences and industries related to this strain.
Keywords: Recombinant Lactococcus lactis; aerobic system; respiration; fermentation; cyclodextrin glycosyltransferase
"#=*""{
*
¥¦ ^ { ~{ { { !{ ;{ { º ¿® *¿{
$"¹;{{{¢{^{{
¥¦"|{{{#*"""@|@{
&+
{¢{
¥¦°{ {{ !{{{! @" "
{@=@"<{{{{
¥¦"#{|{!{{^§>}®^{{÷{^ª
!º!{{
¥¦" { #{ ~{ { ¤ |{ { ¢{ @== " \"
{<^"{¢{
204
205
)
&
"
'
$$
'4&
&
&
$
0&
4
Y%'
)C$C$(' *
<&
%
E3
%'44%' 3
%'*6
%0
(

@"=~;<=*#* @@="=~;<=*#*

@ "" " * @ \= " *<
\\{ * @ " @ \ \@@ < * "= "= < "={ | @< @ " " * <" "= { " "
@ = = < @ " *= @ "= \@ * ¥¦\@@""*"=¥¦{#*"
@<\@@=="*<"=¥¦{

"¶;<# !<!ø{¢¢^"@
}# }
¶;<#!<!ø{¢¢^"@}
# }
"" " "¤= = @ " *" @ < @
"@{*="""
"@={@=¤*=
*< *= <= { | @ \¤ * ¤*=^\<"@"""{
@ " * @ 3! 3 3{ @ \
<""""*=@"@<"@
<#*@\@;{ #{©"*±\
=}<=@""@"{!"*±@\"=
#*@@@"{""@\*\{@¤"*\
¤ @ 3 3 3{ | # *@ " \@
**\¢{¢{{|@@""*±@\
<"=33
\*"{{<={|\*<@@"*
@ " @\ <"{ \< 3 3
\ * = @ @ @ { @ " @ * \@
@\@@"**\{{¢;{!
@ @ @ " " ; @" "* ±{ | @ @" "* @ \@ @ @@ " \ 3 3 3!\@@@"{;{;{;
<={@\@@<*\@"@{@\@*
{{;@"{"@*\@*
\@@@@"\@@@\\@*"@
@"¤=\@@*==¥¦{@
"" " " \ *@ @ *= \@"@=@"¥¦{@@
* "" " \ 3 3\@@@\"¤=\<@=@"{
|@"=@@\¤@*<\{
!\*={@*@
*\{#\*="@
"" { < \ @} = *@= " @ #* | =#{ @ " @ *
K##"
#=&"#&
@ " @\ @ \ < @ * " *\ @ @{ |
@**\@@*<{>""
@< " = <"= " * @ " * "
"={
"#"*
*
¥¦ "" °{ { | " @=@ * " "=
@ !* *" { ^ @ ~ != |
«{
¥¦<{{{#{"}{"{{{{»@\{{{<"
""@"={"#*=@=
«{
¥¦ { #{ ^ { { { #{ < { { { { » @\ { { { #" = =@ @} @ * \@ = * {{
#*=«{
"#*"""
*
¥¦!>!>{#{~³!#>>^{;|°{|#!!°{|{;°;|#!#{°|°!!#{@
""=@"{<{{
{
¥¦ ;°~ù° { { * * " "" <" {
#%<{{{
¥¦ >!^ { { ! "" @ < "{
(+
#<{{{
206
207
Extraction of bacteriocin from the fermented broth of Lactobacillus plantarum
ST16Pa using aqueous two-phase polymer systems
3
&
$
"$$
&
#
&
Sabrina da Silva Sabo1,2, André Moreni Lopes1, Valéria de Carvalho Santos-Ebinuma2, A.dalberto Pessoa
Júnior1, José Manuel Domínguez Gonzáles3, Ricardo Pinheiro de Souza Oliveira1
4*4!'4+$
,
' 04$'3 4')H,H .
,=
1
"^^*!""@>^>|!¤#"¶
*{
Department of Biochemical and Pharmaceutical Technology, School of Pharmaceutical Sciences, University of São Paulo,
R. Prof. Lineu Prestes n.580, 05508000 Sao Paulo, Brazil
Department of Bioprocess and Biotechnology, School of Pharmaceutical Sciences, UNESP – State University of São Paulo,
Centro 14801902, Araraquara, Sao Paulo, Brazil
3
Department of Chemical Engineering, Faculty of Sciences, University of Vigo (Campus Ourense), As Lagoas s/n, 32004
Ourense, Spain
2
@"*"**=@"@<"*<
" < "@ ª @ "* <* *= * <
ª @ \ "" ¥ ¦{ * @ * @
"<*==""@""=
@¤{|"*"*=\@<
" " <*=ª " " @ " *" @ @ =¥¦{
In the biotechnology field, it has been suggested that extractions in aqueous two-phase systems can be used
instead of, or complementarily to other more typical chromatographic operations aiming to reduce the costs of
many biological products downstream processing. This study aimed to evaluate aqueous two-phase polymer
systems (ATPPS) composed by poly(ethylene glycol) (PEG) and sodium polyacrylate (NaPA) to extract
bacteriocin from fermented broth of L. plantarum ST16Pa, which was cultures in MRS at 30°C for 48 h. The
bacteriocin activity against the bioindicator strain Listeria monocytogenes L101 was evaluated by agar diffusion
assay in which free-cell samples of L. plantarum ST16Pa culture were serially diluted in phosphate buffer 0.25
mM pH 6.5. The antimicrobial activity was measured as arbitrary units per mL (AU/mL), defined as the
reciprocal of the highest dilution showing clear inhibitions zones of the bioindicator strain. The bacteriocin
partitioning was studied in different PEG/NaPA systems according a 23 full factorial design. The independent
variables studies were: concentration of PEG and NaPA 8,000 g/mol, both polymers at 8, 12 e 16% (w/w) and
molecular weight of PEG (2,000, 6,000 and 8,000 g/mol) while the responses were activity balance and
bacteriocin recovery in the NaPA-rich (bottom) phase (%AB and %RECNaPA, respectively). The results obtained
shown to be very promising since the ATPPS process was effective in bacteriocin recovery. The bacteriocin
partitioned preferentially into the NaPA-rich phase (%RECNaPA>667%), and high values of activity balances
(%AB>750%) was achieved. More specifically, the results of the response variables showed higher values
(>100%), which could be related with removal of a large number of contaminants from the fermentation broth. In
order to optimize the bacteriocin extraction, further studies will be performed increasing the concentration of
NaPA and PEG molecular weight and decreasing PEG concentration, which should result in higher recoveries.
Furthermore, electrophoresis assay and total protein quantification will carry out to determine the specific
activity and purification factor obtained by ATPPS composed by PEG/NaPA systems.
@@@\¤\"=@"}*=\"=*
=
&#!<<*="
"{ @ = \ " *= " "} * = ö * }
={ @ <" \ª " |!
@*"^{**{\"""{@
<* \ª "<< * = <*= " © = ©{ @
=\!~>!"¤=¨{{"<*=;
=<*=©"*;\{{@{
;={*"=!
"<<{Ñ{©{¢Ñ{©<={@"@@
=<*=²{{!=*@=@"*\©"@
¤*=*""{>=\{Ñ{©{¢Ñ¢{¢©
@==@=@\{|=
\*<*\"=!{!{@=
=!@"<<{Ñ{©\@="<<{Ñ{©
@ " \ = @@ @ *= @ "@ = "<< " Ñ {¢©
<"*"*=@¥¦{
|"@<"<*=
#"
{ @ @ \ " ={ @ "} * = " *
< = @ } = =@} = = @ "
*{
Keywords: Lactobacillus plantarum; bacteriocin; extraction; two-phase polymer systems
"#"}*=""*=
*
¥¦°"{°";{{@{{#=""³!!¢"
""<{{{{!{{
¥¦ { #@ ~{ ³" { °"¤\ ³{ ° { |*@ { { \ < " <{ { !{ {
{
¥¦*@"{@¤{@<{~{{*"@
*\{{{¢{
¥¦" {<#{}#{ !<#{"} {{
===<<*=*\ú={"^{
¢{
¥¦"<#{{{*=<==""
"=<*={{={¢{
208
209
," B
$
$
" & High Production and Characterization of Bioplastic from Halomonas organivorans
DB4
*4&=%73
(0,( ,2
Gökhan Güngörmedi1, Murat Demirbilek2, Mehmet Burçin Mutlu3, Emir Baki Denkba
2 and Ahmet
Çabuk4

!@=;<^¡"=!
<¢
"¸!""<¢

!#@|||;<^¡"=!<¢

1
Department of Biotechnology and Biosafety, Institute of Science, Eskisehir Osmangazi University, Eskisehir, Turkey.
Biochemistry Division, Department of Chemistry, Hacettepe University, Beytepe, Ankara, Turkey.
Department of Biology, Faculty of Science, Anadolu University, Eskisehir, Turkey.
4
Department of Biology, Faculty of Science and Arts, Eskisehir Osmangazi University, Eskisehir, Turkey.

2
3
= \= " <" " "@ *<
*@"@"@@@@{@\
"¤*¤\@==*@<<=\}
@"¥¦{ \@¤**@""<
\ * \@ = @ { #@= \@ @
"<=@}@@"@
<"*{ @ = * " =} = = *@<"@"<\@@@*@"""{@@"=
\@"*=@"
@"# ^=§"¢{*@""ª
@\@¤"@@"@@@\@
@"*<*@@}@@@"@@
<"\@@"\@@{
@@"# ^# ^# ^"{@½
@¤\{\¤<={@@"*<*<*
";"@@"@@=@@@=©<<
< = = >΍{ ! @" " ""
\ *@ @ " @ = " @ "*"
={ ! " = * @ \ < " ¤ | \ @ª§{§{ @ = \ " \@ @ #*{ = ¥¦ \ * @ <" @ *
"{!~>!\"@\@¤{
In the current study, the bioplastic production capabilities of Halomonas organivorans DB4 were investigated
[Accession Number: KF668255]. The bioplastic production capabilities of Halomonas organivorans DB4 were
determined by the amount of poly--hydroxy butyrate produced per cell dry weight and in consequence % 78.60
– 94.33 PHB yield was observed in proportion to cell dry weight [1]. The effects of different carbon resources on
PHB production were researched and in this study it was determined that the carbon resources which can be best
metabolised by Halomonas organivorans DB4 was glucose. The Polymer medium was optimised by using
Plackett Burman experimental design to avoid from the fluctuations occurred in the production percentage and to
obtain high biomass and PHB yield. FTIR analysis was carried out to determine the chemical structure of
biopolymer and NMR spectroscopy analysis was carried out to find out the molecular structure of biopolymer. In
consequences of these analyses, it is observed that the synthesised biopolymer has the same chemical and
molecular structure with the commercial PHB.
Keywords: Halophilic bacteria, Bioplastic, Poly--hydroxybutyrate
Acknowledgement: This study was supported by Eskisehir Osmangazi University Scientific Research Project Comity
(Project Number: BAP-D-2013-143). Also the results of this project were submitted to Turkey Patent Institute (Patent
Number: 2013/15639).
References:
[1] Çabuk, A., Güngörmedi, G., Denkba
, E.B., Çnar, S., Demirbilek, M., Mutlu, M.B., "A Method for Poly-hydroxybutyrate Synthesis", Turkey Patent Institute, Application Number: 2013/15639, Publish Date: 21.07.2015.
@ @ <* " # ^ # ^ \ { { ;
<= @= @@ @ @ # ^ { ;{ " @ @ "=
@"@@<*\<=
"{;=<"¨{{@"@{
¢{ ¢{¢ @ @ \@ { {¢ { @ # ^ # ^ # ^
<=\=<"{{{!@@"
*\ { { © @ @ "" @ * @
@@<"@""{!=
\ # ^ # ^ # ^ <= \ =} *= ={ ! =
<=\\@@@{@*"@
@"@"@"=@@"@\@@"*
@\@@\@@@=\"{@@"=<"*\{{{!@"@
@"@<@""@"
*=@@\@¤<"{
"#"\@¤=}=@
*
¥¦* <#!^¬*@""@\@
= = < " " "*"{ !@< #*=>{ª{¢{
¥¦=*!!=@*\@{|"
#*={
210
211
Improved growth and use of maltodextrin as a cryoprotection and preservation in
Lactobacillus plantarum CECT 8150 strain submitted to freeze-drying process
.
&
-
-$
$&#
R. Vera1, E.L. Arosemena1, A. Calvo2, J. Marcelo2 and M.A. Calvo1
!4<<&%'03<
%',)%' 4( *%
1

@=@;<=®^"#"@
^¢^}
@=@;<=^¶@¤^^
^}
Research Group in Applied and Environmental Microbiology, Animal Health and Anatomy Department, Autonomous
University of Barcelona, 08193 Bellaterra, Barcelona, Spain
2
Cal Jep, Heliciculture Center, Castellfollit de Boix, Barcelona, Spain.

Obtaining cultures with high biomass and choice a cryoprotectant adequate before lyophilization process is very
important to ensure correct cell viability during the conservation or storage time of bacterial strains with
probiotic properties. The modification of growing conditions as culture media and condition of incubation, can
permit increase the concentration of final biomass after freeze-dried process. Also, skim milk is used commonly
as carrier of congelation in the lyophilization process, however the use of cryoprotectant and conservant of nonanimal origin as the polysaccharide maltodextrin, could be suitable if subsequently this freeze-drying samples are
inoculated as probiotics to animals or people susceptible to allergens in cow’s milk.
@ < @ " =@ \ = @ @"
@={!*@"¥¦@"""3=@}
=@ ^ @} "{ | ¤\ @ @ \@
@ "" " " * " "@<"@"@=@}*=¥¦{@"
<"*"@=@*""@<\@@
*ª*"<=@\*@"\
"{ | \= <* * " " @ *"}"@\¥¦{|@\¤\<@"^*=
3 " @ "* " = *\@=³"¢
@<^"*{@"=\""
¤\@"*@¤"±@"
@@"{"*\"*=^^*=<=@
={@"@\@""@@@\@{@@@^
" { \@ @@ "* ³ <= \
={ | @ "* < @ \@ ^ @\<³@^"\@"
"¥¦{"="^{\*\@"*
³{\<@@@*{\*=
³{ ;¤ @ *< " \@ =\ " "*@ @ "
@ " < @@ ^ " "* { @
"< *@ @\ *@< @ "*" = {{ \
<@@"\*="@"<"=
@@"\*="@"<@=\@={|
\ " @ @ "" " "= \ " ^ " = *
""@"@<@\@@"*"{|\"@*
= = "* ^ " *= @ "" 3 *" "<@@@\*@<
\@@"\@"@<"*{|\@=@
@@"@"@*@<"
@ { | = "= @ " = < @
@*"{
In order to obtain lyophilized cultures of a probiotic strain of animal origin (isolated from terrestrial snail Helix
aspersa) that are stable over time, this study was conducted at the laboratory of parameters that influence
bacterial growth, and others who intervene in the survival and conservation of the strain Lactobacillus plantarum
CECT 8150 during the lyophilization process.
Our results indicate that the absence of Tween80® in the growth medium, and the conditions of incubation under
aerobic conditions permit higher concentration of strain evaluated (11.9 log ufc/mL) than in other condition
assayed (9.6 log ufc/mL) (Table 1). When the maltodextrin used the results indicated that post-lyophilization
process show high cell viability finalized the 60 days of the study, one logarithmic cycle decreases at the
beginning of the experiment, then strain remained stable over time, reaching concentrations above 9.0 log cfu/ml
in room temperature condition, and above 10.5 log cfu/mL in refrigeration condition (Table 2).
We conclude that changing some simple parameters of incubation is possible increase significantly the count of
final biomass, and the maltodextrin could be a suitable substrate for the protection and preservation in time of the
L. plantarum CETC 8150 strain when subjected to freeze-drying process. This would ensure at least sixty days a
good cell concentration for administration as a probiotic, guarantee the long-term delivery of sufficient active
viable functional cultures to the use.
Keywords: probiotics; lyophilization
Table 1. Biomass count (log ufc/mL) in different condition of incubation after 24 hours to 37ºC.
Culture condition
Aerobic
Microaerophilic (5 % CO2)
9.62
9.62
Whit Tween80® in growth medium
11.74
11.99
Without Tween80® in growth
medium
Table 2. Biomass count (log ufc/mL) in different condition of storage after lyophilization process.
"#=@" =~"3
Storage time (days)
Refrigeration
Room temperature
0
11.21
11.03
*
¥¦;~!#{ !{ !{;#|~!{!{|!~>{ {!>>{ {#!$;^{{>~!{!{|{
> { { °° { { { °!^ ~{ !>! !{ #{ " ë¢ª
" @* ##^|ª " " ¤ @=
<<={"|"#*=@=<{{{«{{
¥¦!>!!{#{;~!^{{{^| !>#{#{|!#{{{^"®È¹
ç{¶ªð<{{{
¥¦>!>"""¤>!"">}@;~{>
^"*@{!<*ªË@ª\\\{"¤{{²{!ª§@{
60
10.47
8.97
212
213
.
$$
$& >3 ,@ ((
&
$4$:>4NPRR;
"
)8'))E!')3
!!!
3
!%'(')**&
-(' 0('@ ,%'('7*/43%'/6
,Z%'
, 4$<BB(
@=@;<=®^"®^"}{
#"@^¢®^"}{

!*ð;<^*"{!<{^{#
^¢;<¶
$"¹~ç^"ð!*;<^*"{"
^¢{{^ª^

@ " @ * * @
@ * < @ * " §" @
@{ @ @ " @ =} @ \ ¢ @
" "* \@ @ " @ <*=
*@"=""" @@=¥¦{
!@"@@""*<"=@@" @ @ " "} " @" @== \@@@ = "{@ = @
*<*="="@"@==¥¦{
| @ @ "= =} @ " " " #>{> >
;³^~>°^>@"*
@" @== *= ;# #{ @"@ @"@"{@=\
= ¤ " * @" @== ª = { " ¢{ * ¢{ " @ { @
¤\"\@{=@¤½
"¢@{@""#>{>;^~>
{{{{<="@"@"{={¢
<" "<= { @{ ~< = = } !}
@\@"}""@"
@=={@"<"\*@*"
@<@"@<@""*{@"@
@¤\ @ ~^ !^ !^^¢ ¢ @
"@\¤{
< " " @ " "" @ " " @
* @ < "{ #< \ = @ " \ <@*¥¦{|@@"*="*"
* "{ " = @ "" = © " @ @ *= \ @=@* "* ¥¦{@"@ *§< @ "=
\=}@""¤;^=@"@"
\ "* = =* " " @ @\@"¤@={@=\"*@³#!³#!""
" " \@ = =* " " " \@
@@{@<<*£\
© *@ " "* ± " \@ " ¢ @"{ | @
=\@"¤""\"{|
\"@@©©"==*"@
\""@=""££@@{@
@*"£££\@<\@@""©
=©@\@""\@\@@=@º"{
"@\*<@@@@©"=@@{
@ * " @\ @ *= ;^ " \@ *@
*"{
"ª"=*"¤
*
¥¦!{ { "} { #{ ^ {{ @
&
$/
==¢«{
¥¦ " !{ ~" #{ " $ & $ &
$
!#*@ª«¢{
¥¦^{"}@{°¤@<{^!¤|{
$
{"@={{{
"#@@"@=="*{
*
¥¦ @ { " {{{{ !" {!{{ @ !{°{ # {{{ #{ {!{ < {{
< " " | "* ^"{ |ª @ !° < { "* " @" ! }
ª|@{
¥¦¤~{ @@{°{§{!¤°{@"""\ª!<<\{\*
=ª{
¥¦ ¤ {{ "@^ { "}"} ^{{ {!{ !="* #{!{{ @
"" # { | =@ " @"
@=={"@ª«{
214
215
0
&
":
;
&
&$#
$
$$
7)%'@
A
1
%'!A %'A E%'7
%'*
&%'(
-
*B'.)'7
'3$3$'*
B
|"#*="!=Ê!{ {@<¿{¤¢"{
%
*=#*=;<=¢@~@
*^"^{>{!! @@~@
(
""\\@@@""@\*
"{ @ " * @ * " < <{<\@@@"@"
"*@""={!""@
*@}=*¤\"
"\@@=@{!}=
}= " * " }{ ! " " @"= " \@@ \" \ @ "" " }={@"\"*<@"=}=
" @ ^ { ;"= "@ " <*
={@\@<@@"=*<
=*"{@@<*
"*§"@<}@}=@=={
>*§<ª
! @ * " @ <"{ #¤ < @ * "= = @ <@
"@=@=@{
@"*@@@*<"@{@
\ ¤ < * \ @= \"*={"@*\@"<=
@"{
#@ª
* @ " @< * @ @ * \= @
*=@ \ *= " \@ @{
<"=@@"<@@"@<
*{
""ª
"#*"
@ < @ <<\ @ \ ¤ { ! @< < < @ @ " @ |" #*="!="}{|<*
"*"=<"\"""
="@*==}{<@<*@={{
<*""@"@
*< "} { = = = *@ *@*@\@@"<="
"< @ " *@ @ < " @ @ @=
"{
*
#
¥¦@¬{{@"¤@~{@"{@³{{^{#*{{¢{
¥¦³{{°<|{@{{~{{@¤{{¤{<#{@
{!#{{{!{<{#*{¢¢{
" " @ @ @=
"{
"#!*@"<{
*
¥¦"@*°""@@°@}"}{{@"
<<ª""{!{#*{@{¢ª{
¥¦@{{|""*==*{ª{
¥¦ ^ #û¤ @ !@ #{ { @ "" ={ { |ª
!<@@=#ª{@ª{
¥¦ # |¤{ { ! " { |ª !< @ @=
#ª{@ª
216
217
$01
1
&
&
$
$-
!>B%'F
(!F%
4%'!%E B(

"=!@"!*|}}=;<= ¤=
"""¤=

"=;<==¢!¤"¤=
#*=#@@=;<=@¤=|
=#@@=;<=@¤=|{

@=<"*""\"=
"={ @ @ * <" = * _ \@@ *"<"*"¥¦{|@"="_°
¢\""§"*"{
"**=@=\<{!\@"
<<\@"
" " "{ ^ * " *=" " ^ \ " " @ "{ @=
\"\@@{\"\*@
@¤""¤"{
\"@=*==@=@{#*\@\"
*=="*{|\"@@@<*"
"**="{!@!~>!"@\
" {@ "* ^ \ " <="{|@*\@<*
\ @ *\ " " \ " @
={ #" \ <= @@ "
@@ <" *" <= @@ <" ^ { @
"="@"§"\^"{
@ @ @ *<= " "{ @
" = " @ " }= "{ " =
@ * @ "= }= "{ " = "" \
* < "@ "" " = |{!@""\"<="=
" " ~^ ¸ "= }={ @
<""@"*\=*= |@*@"
,\*"#{"@"@¤"@
< - - \ {
@ @ }= " \ " *@ = \ " " "\@*"*{>@*@}="
#,\""={
"#"=}==|
"#_§"
*
¥¦ @ ° # = { < *" <={
@ª{
¥¦=\Ú¤!=\}{@="*=³\==
*@*{|#*@ª{
218
219
$&$
&
(
B
Partial characterization of xylanases from Bacillus oceanisediminis SJ3 isolated
from Algerian soil
/
,+,
60
.3 E!& 6
Boucherba Nawel 1, Messis Abdelaziz 1,2, Bouanane-Darenfed Amel 3, Bouacem Khelifa 3, Marie-Laure
Fardeau4, Bettache Azzeddine 1,2 and Benallaoua Said 1
|!@|<{
1-
"@@"*""{@@=
\="\"@"
"{ @ = " " @ @ " " "* <{ | *" "< " "
*=\\@\=***=@*=*""
\*"¥¦{
!@"@""=*=@"
\@@=\@"*{@@@\¤\"
*" " * @ "* *
\@@\@@@{
¤ < " * \
@¤ ¤ " "*" @ @=@ @=@* *
"{@"*@@**""<\"*"="
"@*"**{!=*@""*@=\
<}{@"<\*\@@@=@*"*\
@ ¤ @ @ @ @=@ " "*"{ = *
<=@*"\"<@\=
<*\@@\"\{
Laboratoire de microbiologie appliquée, Faculté des sciences de la nature et de la vie, Université de Bejaia, Targa
ouzemmour 06000, Algérie,
-Université de Bordj Bou Arreridj, Mohammed El Bachir EL Ibrahimi, El Anasser 34000
3
- Laboratoire de biologie moléculaire et cellulaire de l’USTHB
4
- Laboratoire de Microbiologie de l’institut méditerranéen d’océanographie de l’université Aix Marseille.
2
A new Bacillus oceanisediminis SJ3 strain which produces thermostable xylanases was isolated from Algerian
soil, it has been selected as a promising strain for xylanase production. This latter was 20.24 U/ml after 2 days in
the presence of oat spelts xylan. The xylanase activity was characterized in terms of temperature and pH profiles
and thermostabiliy and effect of the metal ions and solvents. The results indicated that the enzyme was optimally
active at pH 7.0. The optimum temperature for xylanase activity was 55°C. At this temperature, the half life was
of 22 h and the enzyme retained 50% of its activity after its incubation for 2.67 h at 100°C. These properties
qualify the enzyme to be highly thermostable and potentially important for application in some industrial
processes such as bioconversion of lignocellulosic materials into fermentative products. The detergent SDS and
the -mercaptoethanol were strong inhibitors, while all the ions tested do not affect the enzyme activity.
Xylanases are, at least, stable in all organic solvents tested except for propanol where a reduction of 46.5% was
observed. Zymogram analysis and SDS-PAGE of the culture supernatant indicated the presence of four bands
suggesting the presence of four isoenzymes (xyl a, xyl b, xyl c and xyl d) with respective molecular weight of :
162 ; 117,5 ; 83,7 and 59 KDa.
Keywords: Bacillus oceanisediminis SJ3, thermostable, xylanase, oat spelts xylan.
"#*""*@*
*
¥¦ |# #* " " @ { #*{ #{ { <{
¢ª¢{
¥¦ #"@"= ° ¤@ °@"= <@* ^ "ª "{"{{|¢{
220
221
Pigment production by Penicillium spp isolated from Caatinga-Brazil soil using
different carbon and nitrogen sources
Poly--hydroxybutyrate production in Azospirillum brasilense strain Sp245: phbA,
phbB and phbC cloning and overexpression genes
A. de Araújo Alencar1,2, C. A. Alves da Silva2, J. C. Vilar Junior1,2, A. Elesbão do Nascimento2 and G. M.
de Campos-Takaki2
Antonio Gamaliel Aguilar García+, Lucia Soto Urzúa and Luis Javier Martínez Morales*
1
Doctorate in Biotechnology, Northeastern Netword Biotechnology (RENORBIO), Federal Rural University of
Pernambuco, 52171-900, Recife, Brazil.
2
Nucleus of Research in Environmental Sciences and Biotechnology (NPCIAMB), Catholic University of Pernambuco,
50050-900, Recife, Brazil.
The synthetic artificial dyes, widely used in the food, cosmetic and pharmaceutical industries, are considered
undesirable and harmful once may cause allergic reactions and intolerance. Therefore, there is a global interest in
developing processes for the production of natural origin pigments, less harmful to the environment and human
beings [2]. Filamentous fungi are metabolically active organisms, commercially exploited for the production of a
variety of metabolites, as well as pigments. Such production is still a growing area, presenting a very attractive
biotechnological potential [1]. The objective of this study is to evaluate the pigment production by fungi of the
genus Penicillium, isolated from Caatinga soil in the state of Pernambuco, in cultures containing different carbon
and nitrogen sources, under different pH conditions. For inoculum preparation, the fungi were incubated in Petri
dishes containing Sabouraud Agar for 5 days. Discs measuring 0.7cm2 were removed from the outer zone of the
colony, with the assistance of a sterile cutter, and transferred to Erlenmeyer flasks (100mL) containing 50mL of
the various culture media. For each Erlenmeyer were transferred two discs. For composition of the culture media
were used different carbon sources (starch, maltose and glucose) and nitrogen sources (peptone, tryptone and
monosodium glutamate), at a concentration of 2%. Each of the carbon sources used has been combined with the
different nitrogen sources in the ratio of 1:1. Submerged fermentation was performed in orbital shaker at 150rpm
and 28ºC, for 7 days, at pH 4.0 and 6.0. After the fermentation process, metabolic liquid was centrifuged
(3500rpm/10min) and filtered on filter paper Whatman nº 2. The pigment production was indirectly evaluated by
measuring the absorbance of the filtrate by spectrophotometry at 400nm (yellow pigments) and 530nm (red
pigments). Biomass was subjected to drying in incubator at 50ºC for 48 hours to determine its production. The
final pH was determined in a digital pH meter. In the analysis of the yellow pigment production, absorbance
values (400nm) ranged between 0.027 and 3.385. The production of red pigments showed a little lower and the
absorbance values (500nm) varied between 0.005 and 0.978. Was concluded that the culture medium formulated
with glucose and tryptone demonstrated higher potential for the pigment production. The tests performed in
initial pH 4.0 demonstrated the highest potential for pigments production. Thus, the results demonstrate the
potential of the Penicillium spp isolates for the production of these compounds and the role of nutrient sources in
the growth and metabolism of fungi.
Keywords: fungi; nutrients; dyes.
References
[1] KUMAR, A. et al. Microbial pigments: production and their application in various industries. International Journal of
Pharmaceutical, Chemical and Biological Sciences. v. 5, n. 1, p. 203-212, 2015.
[2] GUNASEKARAN, S.; POORNIAMMAL, R. Optimization of fermentation conditions for red pigment production from
Penicillium sp. under submerged cultivation. African Journal of Biotechnology, v. 7, n. 12, p. 1894-1898, 2008.
222
Posgrado en Microbiología+, Centro de Investigaciones en Ciencias Microbiológicas, Instituto de Ciencias, Benemérita
Universidad Autónoma de Puebla. Edif. 103J, Col. San Manuel, C.P. 72570, Puebla Pue., México.
Azospirillum brasilense has the ability to accumulate insoluble granules of poly--hydroxybutyrate (PHB), which
favors its establishment and survival under stress conditions. The latest research focus its attention in the
optimization of the crops parameters, as the generation of strains that have been genetically modified in their
metabolic pathways to improve the PHB production. The three genes that are considered to be essential in the
PHB biosynthetic pathway: phbA (-ketothiolase), phbB (acetoacetyl coenzyme A reductase), and phbC (PHB
synthase)1. The goal of this work is to overexpress these genes that had been identified, cloned and sequenced in
A. brasilense Sp245 strain.
A. brasilense Sp245 has multiple copies of the genes phbA, phbB and phbC, as well as in the chromosome as and
in the plasmid. The bioinformatic analysis was to determine the genes that would be used for cloning on the
pMMB2062 expression plasmid; this way the genes are under the control of the promoter TacLac, which has the
characteristic of being a strong and inducible promoter with IPTG. The result of this analysis showed that the
phbA (1164 pb) and phbB (2334 pb) genes located in the plasmid one and that are part of an operon. These genes
were amplified together, including the base pairs upstream the phbA gen, the intergenic region and the base pairs
downstream the stop codon of the phbB gene, having a total size of 3618 pb, and cloned on the pMMB206
plasmid, and this was conjugated in the A. brasilense Sp245 strain. This transconjugant was designed A.b.p245phbAB. The phbC gene located in the chromosome, was amplified having a size of 1971 pb, and cloned on
pMMB206 expression plasmid and conjugate in the A. brasilense Sp245 strain, the transconjugante was called
A.b.p245-phbC. Finally, the phbC gene was cloned in the A.b.p245-phbAB construction, in phase and under the
same promoter, thus the three genes are transcribed as an operon. This construction was designated as A.b.p245phbABC. The constructions were verified by restriction pattern and were sequenced. The quantification of the
PHB production in these transconjugants is being determined. The relationship between these genes (phbAB,
phbC and phbABC) and the production of PHB in the strains of A. brasilense Sp245 will be reflected on the
overexpression of these genes expecting to see an increase in the polymer production.
Keywords: Azospirillum brasilense; poly--hidroxibutirato (PHB); phbA; phbB; phbC; pMMB206.
References
1.- Kadouri D., S. Burdman, E. Jurkevitch, and Y. Okon. 2002. Identification and isolation of genes involved in Poly(Hydroxybutyrate) biosynthesis in Azospirillum brasilense and characterization of a phbC mutant. Appl. Environ.
Microbiol. 68: (6) 2943-2949.
2.- Morales V.M., A. Blckman and M. Bagdasarian. 1991. A series of wide-host-range low-copy-number vectors that allow
direct screening for recombinats. Gene 97: 39-47.
223
$
$
$&
:!.!N;&
&
340
%'!
%'4*(',4
%.40
%
<4!%'<
%'34('!4!
(', 4$<BB24
!2
ü!"¶;<# !<^!ø
¢¢^"@}# {
µ#*|"ð;<# !<
^!ø¢¢^"@}# {

|®¹~^;~|!^;<^*""^¹¢
^^*"{
#<<^!*;<^*""^¹¢
^^*"

~ç^"ð!*~^|!#;<^*"{
^¹¢^}

" < @ * < " " " *=
\ ¤{ @ " <" @ =\@@\@"}@@<\"="\@@
" @ *¤ "= @ "" *" } @ *{ @ "
< *¤ " " @ @" * <*= \@
{@*§<@\¤\""<@
" ""{ @ * ! @ = \ "=*=@^=@^<=
# } " " < @ "{ 3 3
" \ @ < { 3 3 @@ = " @\ = <={ " "" \ ª 3
3"""@!\@"{@=\"
"©<@@\""={
\¤ \¤= @=@ * = * \@
"@"{@!<*@"@"@\@\@@=
={@¤=@\<"@@@={@"<@
* \@ 3 "" @\ @@ = "*@@{@*\@
@ " @" < * <= @ <*= ""{ 3
@**""@""@"
""@""<@{
#* }= *@ " @ " \ " @ *
¤@"@@@*@<=}=<="*
="*¥¦{@=}=@=}="
"=\\<=<@=@@<""<"
"¥¦{@#"""@@@*@
¥¦{@"\"""@<*ª
==\@"*@*}="
{ != \ *= "* @" ± \@ \
@ < }= "{ ! * @ * < " \ ª ¤ " = " " @ @{@"@\@@*@\@
¢ \@ @ @@ * ¢ @" \ { ;{ @ << @
"<@*"\*\@"=*"\@@
* <= ¢{ ; @ " " \ @ * *@"*<"@@"\@{
"#*}==<=""
"*=||>!~^!^!^;~|!^{
"#"<@""
*
¥¦{{!!{{{{#*}=ª*@{"{ª{
¥¦{{{#*}=@|"{!#*={{
¥¦{#=#{={{#\**"\
={#={¢¢ª{
!$$#!^~^{
224
225
!
$
"
#
-
$
-
Study of the effect of RsmA on the expression of the algD gene in Azotobacter
vinelandii
!&%'F&%',('@%
María Eugenia Valentina García Aguilar, Liliana López Pliego, Cinthia Nuñez López, Miguel Castañeda
Lucio

;<º~|*!=º"º!"{

;<º@*^"
^º@}"="{
Laboratorio de Genética Molecular Microbiana, Centro de Investigaciones en Ciencias Microbiológicas, Benemérita
Universidad Autónoma de Puebla, Edif. 103J, Col San Manuel C.P. 72570, Puebla Pue., México
@"=<"@""}="*=
< = \ ^ @"
<@\{>}"@"}={Á\*
= "* ^ \@ \ \< ±{ !\ ^ \
*= @ " }= \@ = "= "= < @
"*§ @ { @ < " " }
"}=""<@\ª¨¨±
}= ¨ \< ^ " } *\ { { { = <= \
= @@ \@ " " }= @ " { ^ }= @* \" <= < * @ ^
=\@@{@*"="@"}=
<<\"\{
"#\^"}=
=}={
Azotobacter vinelandii is a Gram negative; this is a free-living soil bacterium, which includes several interesting
characteristics. It is a polyploidy bacterium getting to have 80 copies of its chromosome. Besides, it is capable of
fixing atmospheric nitrogen in aerobic conditions. Also, A. vinelandii has the ability to produce two polymers of
industrial interest: the extracellular polysaccharide alginate and the intracellular polyester poly beta
hidroxibutirate (PHB). The alginate is an important polymer because of its viscosifier and gelling ability, and the
PHB is a biodegradable plastic accumulated by the bacteria as a result of carbon and energy reserves.
GDP-mannose dehydrogenase is an important key enzyme for the alginate biosynthetic pathway, the gene
encoding for this enzyme is algD. The expression from the algD promoters are under control of the twocomponent system GacS/GacA (Castañeda et al., 2001). In many -proteobacteria, GacA homologs control the
expression of small regulatory RNAs of the RsmZ/Y/X (CsrB/CsrC) family, which interacts with RsmA (CsrA)
proteins. This protein binds their target mRNAs by acting as translational repressors. The interaction of Rsm/Csr
small RNAs with RsmA/CsrA counteracts its repressor activity. In A. vinelandii mutations in the gacS/gacA
genes appeals the alginate synthesis, this can be explained by the control that GacS/A has on the expression of
the algD gene. Our research group has demonstrated that RsmA protein binds the non-coding region of the
messenger RNAs algD gene; this suggests that the expression of these genes is regulated at the posttranscriptional level by RsmA.(Manzo et al., 2011) Beside, it has been found that overproduction of alginate
makes unfeasible mutants with total removals of gene rsmA.
The present work studies the regulatory effect that RsmA has on the production of alginate. To achieve these
results, we proposed as strategy both gain and loss of function. We are determining the rsmA gene
overexpression effect on the expression of the algD gene for gain of function; and the effect of the rsmA gene
mutation on the expression of the algD gene for lost of function. We constructed two algD-gusA chromosomal
fusions using two loci to recombinate the gene fusion. On one side, we use as a neutral recombinatory locus a
transposase gene. On the other hand, we select as a recombinatory locus the algD gene itself. To determinate the
overexpression effect, we used chromosomal fusions in the transposase and a plasmid in which the rsmA orf is
under control of a constitutive promoter. In the case of the loss of function, we recombined the algD-gusA fusion
in the algD gene. So while we generate a chromosomal fusion, it was also generated a non-producing alginate
mutant. In this genetic background we are working on generating rsmA gene mutation. We are trying to generate
the mutation in two ways: via an insertion located at codon 51 and by a deletion/insertion from codon 51 to the
stop codon. Both ways, we expect to see the effect of RsmA on the expression of algD gene reflect on enzymatic
activity.
Keywords: RsmA, algD gene, chromosomal fusion, alginate, Azotobacter vinelandii
References
Castañeda, M., J. Sánchez, S. Moreno, C. Núñez and G. Espín. 2001. The global regulators GacA and s form part of a
cascade that controls alginate production in Azotobacter vinelandii.
Manzo J., Cocotl-Yañez, M. Tzontecomani, T. Martínez, V. M. Bustillos, R. Velásquez, C. Goiz, Y. Solís, Y. López, L.
Fuentes, L. E. Nuñez, C. Segua, D. Espín, G. and Castañeda, M. 2011. Post-Transcriptional Regulation of the Alginate
Biosynthetic Gene algD by the Gac/Rsm System in Azotobacter vinelandii. J. Mol Microbiol Biotechnol.
226
227
Synthesis of amides and peptides using new enzyme function
Michihiko Kobayashi
Tannase production by Penicillium chrysogenum (SIS 25) through submerged
fermentation using alternative media containing agro-industrial residues
Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba 305-8572, Japan
C.M. R. Moura1, B.F. Lima1, J.F.Silva1, G.K.B. Silva1, M.C. Sá Muniz1, N.R. Andrade Silva1, M.A.B.
Correia1, D.K.S.T. Maciel1, E.C. Vasconcelos2, G.M. Campos- Takaki2 and C. A. Alves da Silva2
We have extensively studied microbial metabolism of toxic compounds with a triple bond between carbon and
nitrogen, such as nitriles [R–CN] 1). In the Pseudomonas chlororaphis B23 strain, nitrile is hydrated to amide
by nitrile hydratase (NHase), followed by degradation to acid by amidase. This strain’s NHase was previously
used for the industrial acrylamide production and is now used for the production of 5-cyanovaleramide, we
clarified the NHase gene organization2) composed of seven genes (oxdA, amiA, nhpA, nhpB, nhpC, nhpS and
acsA; e,g, OxdA is aldoxime dehydratase3,4); AmiA is amidase; NhpA is NHase alpha-subunit; NhpB is NHase
beta-subunit; AcsA is acyl-CoA synthetase5)).
1
During the nitrile studies, we found AcsA shows a unique activity. Although AcsA ligates acid with CoA: a
carbon-sulfur-bond formation, N-acyl-L-cysteine can be surprisingly produced when L-cysteine was used as a
substrate instead of CoA6). This finding demonstrates that AcsA synthesizes an amide bond comprising the
amino group of cysteine and the carboxyl group of the acid. AcsA formed a variety of N-acyl-compounds, when
various acids and cysteine-analogues were used as substrates.
AcsA belongs to the adenylate-forming enzyme superfamily. Therefore, we investigated whether such
superfamily enzymes show the similar activity or not. We discovered that an adenylation domain of
nonribosomal peptide synthetase, which belongs to the same superfamily showed the peptide-bond synthetic
activity. We investigated the substrate specificity of the enzyme in detail. Various dipeptides and oligopeptides
can be synthesized by the adenylation domains. Here, we would like to propose the reaction mechanism
underlying these new carbon-nitrogen bond synthetic reactions by the thioester-bond-synthesizing enzymes.
Keywords: amide; peptide; enzyme
References
[1] Zhou, Z., Hashimoto, Y., Shiraki, K. & Kobayashi, M. “Discovery of posttranslational maturation by self-subunit
swapping" Proc. Natl. Acad. Sci. USA, 105, 14849 (2008)
[2] Sakashita, T., Hashimoto, Y., Oinuma, K-I. & Kobayashi, M. “Transcriptional regulation of the nitrile hydratase gene
cluster in Pseudomonas chlororaphis B23" J. Bacteriol., 190, 4210 (2008)
[3] Nomura, J., Hashimoto, H., Ohta, T., Hashimoto, Y., Wada, K., Naruta, Y., Oinuma, K-I. & Kobayashi, M. “Crystal
structure of aldoxime dehydratase and its catalytic mechanism involved in carbon-nitrogen triple bond synthesis” Proc.
Natl. Acad. Sci. USA, 110, 2810 (2013)
[4] Konishi, K., Ohta, T., Oinuma, K-I., Hashimoto, Y., Kitagawa, T. & Kobayashi, M. "Discovery of a reaction
intermediate of aliphatic aldoxime dehydratase involving heme as an active center" Proc. Natl. Acad. Sci. USA, 103,
564 (2006).
[5] Hashimoto, Y., Hosaka, H., Oinuma, K-I., Goda, M., Higashibata, H. & Kobayashi, M. "Nitrile pathway involving acylCoA synthetase: Overall metabolic gene organization, and purification and characterization of the enzyme" J. Biol.
Chem., 280, 8660 (2005)
[6] Abe, T., Hashimoto, Y., Hosaka, H., Tomita-Yokotani, K. & Kobayashi, M. “Discovery of amide (peptide) bond
synthetic activity in acyl-CoA synthetase" J. Biol. Chem., 283, 11312 (2008)
228
Mestrado em Desenvolvimento de Processos Ambientais (MDPA), Universidade Católica de Pernambuco, Rua do Príncipe
526, Boa Vista, CEP 50050-900, Recife, Pernambuco, Brasil.
Núcleo de Pesquisas em Ciências Ambientais e Biotecnologia (NPCIAMB), Universidade Católica de Pernambuco, R. do
Príncipe, 526, Boa Vista, Recife, PE, 50050-590, Brazil.
2
The use of mathematical resources such as factorial designs in fermentation processes, have facilitated and
reduced the amounts of experiments, because the results can select the best production conditions through the
influence of the variables favoring the studies involving production of metabolic high added value [1]. Tannin
acyl hydrolase (E.C. 3.1.1.20) or tannase is an enzyme which catalyzes the breakage of ester linkages and
depsidics hydrolyzables tannins and gallic acid ester is an extracellular enzyme produced in the presence of
tannic acid for filamentous fungi, bacteria and yeasts [2]. It has a number of industrial applications in the food,
leather, pharmaceutical and chemical. In the production of drinks tannase can be used to reduce turbidity
formation of phenolic components [3]. The filamentous fungi are produced by glycoproteins and protein
structures have high molecular weight and are produced in the presence of tannic acid is usually the inductor and
may also be in the composition of the production medium. The Penicillium genus is described as the largest
producer of tannase [4] The production were carried out using media prepared using grape waste, coffee ponds
and orange peel. Assays were carried out in submerged cultures at 150 rpm at 144 hours, 37 °C, pH
being determined, biomass and enzymatic activity through a full factorial design with four center points
23, totaling 12 assays. The results showed that the assay denominated 3 presented an adaptation of the
microorganism phase which is the synthesis of the enzyme and other cellular components necessary for
absorption of nutrients present in the middle, with growth occurring rapidly reaching a production of
biomass (0.0938 g/L) and enzymatic activity (0.210 U/mL). The use of agro-industrial waste in the
development of the media of production in biotechnology, emerges as a viable alternative for reuse of nutrients
that would normally be discarded in the environment.
Keywords: microbial enzymes, tannase activity; production media formulation
Support by SISBIOTA-CNPq, FACEPE, CAPES, UNICAP.
References
[1] D. Omay, Y. Guvenlir (2014). Lactic acid fermentation from refectory waste: Factorial design analysis. African Journal
of Biotechnology. 11(30): 76936-7700.
[2] M. Chávez-González, L.V.Rodriguuez-Durán, N. Balagurusamy, A. Prado-Barragán, Rodriguez, R., J.C. Contreras, C.N.
Aguila (2012). Food and Bioprocess Technology. 5(2): 445-459.
[3] R. Belmares, J.C. Contreras-Esquivel, R. Rodriguez-Herrera, A. R. Coronel, C.N. Aguilar (2004). Microbial production
of tannase: na enzyme with potential use in food industry. Food Science and Technology. 37(8): 857-864.
[4] T. Matsui, Y. Dekishima, M. Ueda (2014). Biotechnological production of chiral organic sulfoxides: current state and
perspectives. Applied Microbiology and Biotechnology. 98(18): 7699-7706.
229
The interaction in vivo between sensor kinase GacS/RetS and GacS/LadS mediates
the increase of Alginate production in Azotobacter vinelandii
<$
0&
L. López-Pliego, Z. Sánchez-Cuapio, M. Castañeda Lucio
<BB
%'('@B<
% B.%'(
Laboratorio de Genética Molecular Microbiana, Instituto de Microbiología- BUAP.72570, Puebla Pue.

@|"|<<@=@@°}"\°}"\°=¢
"@~|"@=¢
¤=|¤~¢

Azotobacter vinelandii is a soil bacterium which produces two industrial interesting polymers: Alginates and
Poli--hidroxybutirate (PHB)1. The first one has applications such as: acting as stabilizer; thickening; acting as a
gel or film-forming agent in various industrial fields. The second one is a biopolymer with plastic characteristics
usually used as a replacement of petroleum derived plastics. The two polymers are controlled by the GacS/GacA
two component system, and the Rsm posttranscriptional system2.
#<!*\@@@ £~!{|
@ @= " \¤@ " { < * # " \ * "} "*
" " = *{ ; @ "" "= = " * # @@@ <" \
}"}""<<="¤{="
""@#!\\**""¤
# ¤ @ " "} @\={ @ " * *"}{""!"@
%{@**}}=<=*
*"¤ *"@@ { * =
% |= "{ | \ @ @ @ "@*""*=<%{|=@
"=@@*"}\"@<@*
@@~!*<=@!{\@\@!*
¢* " " " " \ " { @ " * <= ! *< @ *{ @
! * " < @ @ < #
{ @ "
@!#
%@*
"<@!"{
In Pseudomonas aeruginosa, the LadS, RetS3 and the GacS/GacA control the expression of genes encoding for
virulence factors involved in the development of acute or chronic infection; LadS accompanied with GacS,
results in promoting the production of secondary metabolites; the RetS heterodimer formation with GacS
produces the opposite result.
In this work we studied the A. vinelandii genes homologous to retS and ladS of P. aeruginosa. Search for
homologous at nucleotide sequence level reveals a gene that showed 48% identity with the P.aeruginosa retS; we
did not find any homologous for ladS. However searching by the aminoacid sequence we found a protein with
57% identity. In order to establish if interacts with LadS and RetS We carried out a two-hybrid essay. The result
showed that cytoplasmic region of RetS was able to interact with GacS; but didn’t GacS with LadS.
Furthermore, ladS::Gm and retS::Gm mutants were obtained and alginate production was determined.
Unexpectedly both mutations, retS::Gm and ladS::Gm, cause overproduction of the polymer.
The data suggest that LadS and RetS have a negative effect on the GacS function. This regulatory effect
generates a blocked signaling network where GacA cannot activate the transcription of noncoding sRNAs
RsmZ1-7 and RsmY allowing the repressor activity of RsmA over alginate synthesis.
Key words: Two component system; Alginates and posttranscriptional regulation.
References:
1. Galindo, E., Peña, C., Núñez, C., Segura, D. & Espín, G. Molecular and bioengineering strategies to improve alginate
and polydydroxyalkanoate production by Azotobacter vinelandii. Microb. Cell Fact. 6, 7 (2007).
2. Manzo, J. et al. Post-transcriptional regulation of the alginate biosynthetic gene algD by the Gac/Rsm system in
azotobacter vinelandii. J. Mol. Microbiol. Biotechnol. 21, 147–159 (2012).
3. Ventre, I. et al. Multiple sensors control reciprocal expression of Pseudomonas aeruginosa regulatory RNA and
virulence genes. Proc. Natl. Acad. Sci. U. S. A. 103, 171–176 (2006).
230
231
>
-$&
!F
"=!@"!*|}}=;<= ¤="
""¤=
¬=<*"@@"="\<""
@" "= *" "*= * *\{|"*=*@""=""=\\@@
" @== * = "*{ < = " @== =*="*#¥¦{
| @ "= @"@ \ " " = " =
"{ " \ @"@ @== <""
<""@"<@"¤
{¬="\##\<
@"@@==={\
\@ = "{ ¬= \ " @= *= "
}= ¤{ \@ \ " *= = "{ #" = \<=*{{=@##
<={#"<=@@"={¢
#{@"={*@@@"
\*<"{|@@"="
="*=#\<@"={^=
""@"@\"@"{
{#"=\<=\\@=
\@ " = \ " { \@ " @ \ " "{ | " \ " @ @" @ @== " * " =
" @ " \@ " @ \" * *@@=={
"##"*
*
¥¦°\"@{{{!{<{#*{
¥¦°"{{{¢
"ª=@"@@==
*
¥¦"|#¤@!##{^@"=<\{<|ª¢{
¥¦ ;@ #"@ @ ! #"} #! { ¬= <\ *" @@*="{<{
232
233
>
&$& >45A344%P
3
'09'<
-
'0 9'
'<9'!'69' *H
')?'2'
'*3!2
I1'@A49'3
'A694$<BB', £

;<=^¹* ^*}
;<=^*"¢^*"}
~""@<@=@;<=^*"
^*"}{

""@<*"*§@*@=@{@=
@@"\@@=@*@=@\@@"<
"@ * = "{ " @< * " "*" =@
" @= ** \ = " \* \
"{@"@=@<==""=@"@@="
@""=@¥¦{|@"=\<"@"
*"*=@*";^@"@"}"{
^"\"""*"\¤"*
@\<½"@¢@{@*""
\ <" *= @ " " " @=@* "*
"@\¤"\{!\""*"
¥¦{
Medical, veterinary and
pharmaceutical microbiology
@*""~\\¢@""<"
©"*©\¤\@""{\<@*"
@"|¨©\¤\*"*=©
"*©\¤@""<{"@@"*"
@*©*"\{@"@*=
;^"*"\@"=
\@ \ \* " " "" " < @ " = @ <{
"#*"""*
*
¥¦@{{} !{<#{ |{{{|" *"{|ª"ª^";}æ^@{
¥¦#¹"}{!{{*{{{"**"{{!{!ç§{{
¤¤ {#{{^" <<;"^"*=
;^\#"{|{{"{#*{!{¢{
234
235
$
&
"
"
$
0.!
-
&
B
@FB'<F'* B' .
@0BB%,
(

<"@"=¤@\|">"|
@=<@<*@ \|
!#<<~!>|"<¤ |¤
"¤"*|*¤

"@@"<@Ǧ<ǦǦ@*"@
= @*<" <¤ \ { " " @ @"@ \@ @ " " " { !@"@ @ "* @ @<""*@@*<<"\@@
@"\@"<\@\{|@@
<¤"@\""@<{\<*"
"* = <* "{ *
=@"@"{
#*"#<*<@""==
\\ { | # \\ } *= * " *
@ " @ " \@ { @ \ ""\@=@@*#¥¦{\"
#@\\\<¥¦{@
""\\{!=\*="*"
*= @ * @{ *@ *
| @ "= Ǧ"* "< |! \ < @" @{
"<"*@""{!Ǧ<^!
| \ *= <" |! " @" " ¢ @@=
@" ^! < <" ¢ @ { @ |!
"\@@"*=<"@\*<=={!=
<==<<<<"\"*©{@<=
"*<=""@@"{
"@"@}=¤""*=<{
*
#
{ @@~{ !{°{!Ǧ<| }=Ǧ¤"*=""
@|{|"ª«{
{<{!{@{\Ǧ¤{¤{@{{\#{#{={@{\
~{{{^~{!{{$"{^{@
"<}=¤"*=|!@"Ǧ^!| {|"#@¢ª«
{
*"@ \ " @ *= { @ * * \
*¤\@"{@<«{@#
"\@*"@{@@"\=@@
@ \@ @ @ { =} @ @ # "*\\\*¤@
#\@*"@\@*¤{@#<@@=@
\\¢«""\=@{
@"<¤\\\@@*=@\\\
«\@=@{
. \= *< @ * " = @
¢~!"{
"#@"=*"\\
*
¥¦ { " ^" = " \\ " @* * " ,
¥¦{³@<" <= *= " *"
\\,
236
237
!¤\%' \(',)
%',,_%//(
6*W
'*,H*
' *
'@
8
' ,8

<="==!¤;<=!¤"¤=

^@"#*="=^@=!¤;<=!¤"¤=
¹#º=º"{|<=!¹=Å
|!{!<{~{~ "§{#º{
@<@<*<@<\=
"=¸={!@*@"<@
@ < = { \@@ ""\*@*@*"
*@{@"@"=\<@@
<@<{
(
" * @ * << = * * "= " } "} » " { @ <= * \@ < *=
@**@"**"*"=\@@@*
¤<@"{@"#*^§"
¤# ; ;< =ö ¬ ¤# \*
¤#;\*<<"\"@
"={^=="{@\"\@{
@°"¤"<"@*\"<©{
@\ @@ * @ <" \@ @\ \ * @ "{¸*@<"\=@@@@
"Ë{@\*\
@"²{ \*@=@@*
@<"@@"Ë{
| " \ " @< @ @ @ @ " @=@*={
"#*@<
*
¥¦"#< }} # }@ ^
!{<"*@<{
ª¢{
¥¦ " " @@ * @ # @ { @<\@¤*<{#ª¢{
@""*"\@=*
@ * = " *{ ^* *
" " = " @ <= @ " * ={
* *=#=»\
| |! "@ # ,: 8 < & @< * " @ "" * { ! |! @ !" * | =
!|@*=""@="
}="*{
!< " ! \@ =} \ <" *= * (<"*"*3!!3"'
@@3#!!'{!@\"#*@
*@="\@\<<"\@^*<*\@{!
@@\*\" <"{
<" *= " *<*= * ! \@
^Ë^²!|""{
%
! <" @\ =}{ !
@\**{!"@¤!\@*
*=@@*=<="\@<="*
*@@"<@@@{ *»*{
! \@ ^Ë <" @\ Ë{ @ "*<*=!|@{@"
" ! \@ ^Ë * "" = \ *< *= "
"{@ #»^
|@@@!\@^²\""@!
" 3 !| { !
*<*==@\@@"*<*=*@={
@""!\@^²*"""*@@{
"#!<"=}"*{
*
#
* {{»*#{{{="@@"*ª{+5{
* #{ * { { = { #= !{ { » \ |{ { ^* ª * @@
*{+5{
}³{"}!{»"{{|" ** = *{
`{
@#{#{ ^{{#³{#{»^ {#{{}\=ª>""
@={+5¢{
@"#*^§"{{"""<=@@@=@" *{5
{
238
239
α−Glucan administration enhances disease resistance in European eel (Anguilla
anguilla)
&
$
'&
$$
&
:;
06,
%'('2' ,%'2'/)%'2'/73
8
%'2' %'2' +%'('2''
6!
%'2'36'.3' !4('2' 7%'2

C. Esteve1, E. Alcaide1, J.M. Tomás2 and S. Merino2
1
Departamento de Microbiología y Ecología, Universitat de València, Avda. Doctor Moliner 50, 46100 Burjassot, Spain
Departamento de Microbiología, Universitat de Barcelona, Avda. Diagonal 643, 08028 Barcelona, Spain
2
Several substances have been found to be useful in fish culture because of their properties to enhance disease
resistance in fish. Among them, β-glucans (derived from Saccharomyces cerevisiae) enhances disease resistance
in fish by potentiating innate immunity [1]. However, the scientific reason for this behavior is unknown, in
concrete, the relationship between bacterial virulence and the β-glucan [1].
We previously reported that A. hydrophila strains produce a cell-surface polysaccharide (α-glucan) which clearly
has a role in biofilm formation [2], suggesting the use of α-glucans to enhance fish resistance to Aeromonosis.
The aim of this work was to investigate the effect of intraperitoneal injection of α-glucan on European eels,
experimentally infected with bacterial pathogens, by examining the survival outcome in α-glucan-treated and
infected eels. Bacterial strains used were midly- (A. hydrophila AH-1; LD50 = 3,98x105 cfu/fish [3]) or highly(Vibrio vulnificus serovar E CECT 4174; LD50= 3,6x102 cfu/g fish [4]) virulent for European eel. Recent results
from our group show the presence of α-glucan in some Vibrio strains like vulnificus.
European eel juveniles (elvers, 6-9 g) were anesthetized with benzocaine. Elvers were intraperitoneally injected
(i.p.) with 0.1mL of α-glucan solution at a dose of 50-80 μg/g of fish (“α-glucan” group n=125 fish) or with 0.1
mL of sterile saline (“saline” group n=125 fish). Four days post-treatment, elvers were challenged with A.
hydrophila and Vibrio vulnificus, respectively. Twenty-five fish were injected per bacterial dose, or injected with
0.1 mL of saline as natural mortality control. Mortality was assessed for a 7-day period, and was recorded when
injected bacteria were re-isolated from internal organs of dead fish.
Cumulative mortality of fish challenged with A.hydrophila AH-1 at a dose of 100xLD50 was 74% in the “saline”
group and 42% in the “α-glucan” group, and the corresponding relative percent survival (RPS) in α-glucantreated and infected eels was 41.6%. Despite of elvers challenged with a dose of 10xLD50 of A.hydrophila AH-1
showed unexpected low cumulative mortality (38% in “saline” group”; 17% in “α-glucan” group), a RPS of 55%
was found at this A. hydrophila dose. In contrast, cumulative mortality of “saline” group elvers challenged with
Vibrio vulnificus serovar E CECT 4174 at any dose was really high (80-100%). For this highly virulent pathogen,
α-glucan-treated and infected eels showed a RPS of only 20% at challenge doses of 10x and 100xLD50, and of
0% at a challenge dose of 1000xLD50 of V. vulnificus.
Our results indicate that the mortality due to infection with A.hydrophila AH-1 decreased significant by injecting
α-glucan 4 days prior to challenge. In contrast, protective effect of α-glucan treatment is less evident when fish
are challenged with highly virulent pathogens as V. vulnificus serovar E.
|<!*§*!{¹{"
=~"{;<#^{"~<¢#^{"!{
!{

$"¹{"=~"{;<#^{"~<
¢#^{"!{!

§~|<¹=º>~|!<{<<"!!{

|<¹<"!|¢=^
"!!{

!}^<;<ì"|
|={
" <*"@"<!"*
! @ " "< * @=* { >= @"\@@<@<@{!=¤\*\@<
*< \@@ = \@ " @=* *= " *
={!=<*@<@<<{@
= " *= " @ " @ <" @= \"{@@\¤\"=@"
@< <" @ @@ * @= <"
\¤*=<{!@@\\@
<@<@<"{@@""\@
@""<@<@"@{|@@@\
=!@<"**\=@@@{"{@
@@= = \ ¤ " \@ < = ! \ "{ ~ @ \ *< @= " @ <" < ¤ * " = \@ "" " @< "{ @ @@ " @ @ @=@ @
<@@=@=@**=*=\@*
""\@@=}<{~"*@@\
*@<**=@="
"{ @ \¤ " @ "= ¤ @ ! \@ * " <"*"{
"#"O@=
Keywords: α-glucan; aeromonosis; vibriosis; European eel
References
[1] Rodríguez I, Chamorro R, Novoa B, Figueras A (2009) β-glucan administration enhances disease resistance and some
innate immune responses in zebrafish (Danio rerio) Fish & Shellfish Immunol. 27: 369-373.
[2] Merino S, Bouamama L, Knirel YA, Senchenkova SN, Regué M, Tomás JM (2012) Aeromonas surface glucan attached
through the O-antigen ligase represents a new way to obtain UDP-glucose. PLos ONE 7(5): e35707.
doi:10.1371/journal.pone.0035707.
[3] Mittal KR, Lalonde G, Leblanc D, Olivier G, Lallier R (1980) Aeromonas hydrophila in rainbow trout: relation between
virulence and surface characteristics. Can.J.Microbiol. 26: 1501-1503.
[4] Biosca EG (1994) Serología y Virulencia de Vibrio vulnificus biotipo 2. Doctoral thesis.
240
241
*
B"%'
#'
Anti-hyperglycemic potential of lactobacilli fermented milk components
Samlesh Kumari, Anil Kumar Puniya
!@
3*)7.)1!)>/
*=!#*=#*="=~";<=
!{#|!º§¢!
National Dairy Research Institute, Karnal, Haryana (132001), India
!¤\@\@3\=\@@
¤\@@@==}*º{|@<"
@"*@\<\ª<<*
\@@"\@@\*"\@
<<}=@@@*@*\@
© @ @ = { \< " © = \ * \@ @
@==} " \ *< \@ { | @ @" " {© \ ¤ @ ¤ \@ ""{ !
= © \ @ @ < { " !" @ @\@*=*@"<<=@
\ @ *@ # * @@ @{ @ "=
@¤\@\@3@@@
"#¤3|@{
Hyperglycemia cause damage to many parts of body and also plays important role in development of type 2
diabetes and has been proposed as an independent risk factor for many life style diseases. The present study was
focused to evaluate the anti-hyperglycemic potential of bioactive components isolated from lactobacilli
fermented milk. Initially 21 lactobacilli cultures (NCDC-11, 13, 14, 15, 16, 19, 195, 695, 696, 697, 698, 699,
700, 701 and lactobacillus isolates from DH2, 25, MK1, MK2, MK4, MK12, MK13) were taken for study.
Further screened on the bases of non- alpha glucosidase producing (NAGP) potential and 6 lactobacillus cultures
viz; 16, 19, 695, 696, DH2 and 25 were found NAGP and these cultures were used for lactobacilli fermented
milk preparation in single and in combination. Different bioactive factors viz; fats, oligosaccharides and peptides
were isolated from prepared lactobacilli fermented milk. These isolated factors were analyzed for their activity
against baker’s yeast -glucosidase. The results indicated that fats and oligosaccharides isolated from lactobacilli
fermented milk prepared with selected cultures were not showing any inhibitory potential against baker’s yeast
-glucosidase but peptides isolated from 19, 695, 696 and DH2 fermented milk were efficient against glucosidase enzyme. These findings suggested that peptides release during fermentation process of milk is high
potential inhibitors of -glucosidase. NCDC 695 and DH2 were further used for anti-hyperglycemic fermented
milk based product development.
Key words: Hyperglycemia, lactobacillus, fermented milk, bioactive factors
242
243
& -$$$
Antimicrosporidian activities of lip peptides and sulphated polysaccharides from
algae and their potential to control honeybee nosemosis
%
M. Roussel2, A Villay1, F Delbac2, P Michaud1, C Laroche1 , D Roriz2, H El Alaouia2, JS Guez1 , M Diogon2

1
,+
@
8
'%,
4'( 4
H
'%<4!8
"""""¶;<~!"#º°{""¶
="*¶¬@{^{""¶|}#º#º{

"""|};<~!"#º!<~{
=|}{^{#º#º{
Clermont Université, Université Blaise Pascal, Institut Pascal UMR CNRS 6602, Campus des Cezeaux, 2 avenue Blaise
Pascal, TSA 60206, CS 60026, 63178 Aubière, France
LMGE, UMR CNRS 6023, Université Blaise Pascal, 24 Avenue des Landais 63177 Aubière Cedex, France.
2
^ * " * @ @ * =*=\}=@{^"""@
@* * " < =
@"\@<=<{@
@ " * *= " " @ @ ={ ^ \
< @ \ ª ^"* "} #º $"º
"§" !" #@¶ " " "
""¶¸;~!#={@\=}@@
" \@@ < \ < * @ @@
* <={ ! @ \ ¤\ @ " @ $" ! {
^¸ * " < \ <"{ !* <= \ *<
<*"@@*<\@
#| \ { = @* @ \@ !
""=@\@#|\{{! <*<#|\
{ " = **{ ^ " <= \ " " <= ª
@="#!""*@¤#
¤ * @{ | < \
< @= " "@ #! ,
# \@ #| \ { { ! #| \ " * { = " "@ # ! #! #! {
"=*
&"@*
@ * < *= " { ^ < @< @= \@ {
@" * \@ !"=¤= <" #° # *= < °= {
}}!{!@*"{
*" @< *ª @ " * " @ =@*<"}@"@
@=*""="=***{@"@
<@"*§@"@""*
"=<@¤{
^=;~!#^!^|||^|!^|^!^|#^{
The western honeybee Apis mellifera is widely recognized as a beneficial insect of agronomic and environmental
importance. However, in the last decades, bee colony losses have been reported worldwide at alarming rates.
While the causes remain unclear, they are likely to be multifactorial including pathogens and pests, invasive
species, climate change, decrease in food resources, fragmentation of habitat and pesticides. Nosemosis is one of
the most common diseases of the european honeybee and was long-time attributed exclusively to the gut parasite
Nosema apis. A second species named Nosema ceranae was more recently described and is now the predominant
microsporidian species in Apis mellifera. N. ceranae has more negative impacts on honey bees than N. apis and
some studies provided evidence of a role of N. ceranae in colony losses alone, or in combination with other
stressors. It has also been demonstrated that infection of honeybee colonies by Nosema may decrease the efficacy
of acaricide treatment used to fight the mite Varroa destructor.
Currently, the sole treatment to control nosemosis, fumagillin, is forbidden in the majority of EU member states
due to the absence of maximum residue limit (MRL) determination for honey. Alternative therapeutic treatments
have been experimented to control the disease, such as bacteriocin, itraconazole, benzoic and acetic acids,
thymol, resveratrol or Artemisia. However, all these treatments resulted in a small reduction in the number of
parasites but did not protect from nosemosis. It is therefore of high interest to propose new strategies to prevent
and control bee nosemosis. One strategy to prevent the infection would consist in the blocking of the invasion
step by inhibiting the adhesion of the microsporidian spore to the host cell using mimetics of extracellular
glycosaminoglycans (GAGs) located at the host cell surface. Indeed, spores need to be close to host cells in order
to allow their polar tube to pierce the cell membrane and inject the spore contents. Like many pathogens,
microsporidia may use specific receptors at the host cell surface for adherence that allows a successful infection.
In this work, 10 sulphated polysaccharides from macro_ and microalgae were evaluated for their
antimicrosporidian activity. They were first shown to inhibit the in vitro growth of the mammal microsporidian
model, Encephalitozoon cuniculi. The most efficient polysaccharides were then tested for their ability to inhibit
the growth of Nosema ceranae in experimentally-infected adult honeybees.
An additional and prospective strategy to prevent the infection is to test the presumed antiparasitic activity of
lipopeptides. One have shown that surfactin could be considered as a molecule capable of reducing parasitosis
development, acting either by direct exposure to spores or by its incorporation in the luminal of bee midgut.
When exposed to surfactin, the spores of Nosema ceranae indeed revealed a significant reduction in infectivity.
Moreover, when surfactin was administered and was introduced into the digestive tract of a bee, it also led to a
reduction in parasitoids development [1].
Our results are promising and suggest that algal sulphated polysaccharides and lipopeptides could be used to
prevent and/or control bee nosemosis.
"##*<=@{
*
¥¦{<{{"N!-!
ª!<\{<§"{@ª\\\{*
@{
¥¦!{"}¶@}^!{ ¹|{}#{!"#¹}{^º}!{Å>}
;^@=#K+<

{
¥¦ #{ }¶} ç"} #{ "¶} #" { ¹} #} |{ ¶ # !{ "}
¶@} ^< #° !"§}¤=¾ <"
"*<"{+,!
ª¢{
¥¦#{$"#!{Å>}|{¶ { ¹<{# {^
!{ "} ¶@} {"" ! " " *= # ^{ # #N # # !{ #}
#*=¤~"*@§}¢
244
Keywords: Apis mellifera, honeybee, Nosema ceranae, polysaccharides, lipopeptides, antimicrosporidian activity
References
[1] M. P. Porrini, M. C. Audisio, D. C. Sabat´e et al., “Eơect of bacterial metabolites on microsporidian Nosema ceranae
and on its host Apis mellifera. Parasitology Research.2010
245
$
$
$$
$
$
6
B
-!.
¨B!
"B%' B%' ©
B%'6A
&
)ª&"B%'('* «&B%'('2'
A3%'('*=¬('!"B('7|B B%',=B%'('2

@0BB%,
(
<"@"=¤@\|">"|
@=<@<*@ \|

*=@"\¤}|"|"=@=||^@
!={\^
^@@=;#@"\¤}|"|"=@=||
^@!={\^

|"=|"#;<=\~\}¤¢
\^
6Bª"@@"<@ <"
@ " *"{ "" @ "* @@ <""|{@<"{@"\¬>
¬> = @ " <={ = < <{@\@*@@<*{@
@ @} {" @ @< @ ¤ |{

@@"=\*=@=@@@=
^ @@= <"{ \@ * < ^ = # @
¤¨@¨=#@¤¨@
¨==#@¤¨@¨¢@^@@=
; \{ ^ @ = " * * { @ # @ ¤ @ @ ! ^¢ ¢¢ < {© @ { @@= <" \ @ *= "} ÿ¢ @ ¨ @ # @ ¤ ¨{ @ @
<=!!\@@<°""±
@ \@ " " ! ^<} {{ @< !! "
"Øª\\@°²"<!\@°¨\<!!"
"åª\@°Ë{¤!!@@=<"ÿ¢@\*<
° \ {Ñ{{ ! \¤ "} @ # @ ¤ \
*<@@=<"°\{Ñ{¢{^*^<@
#@¤====@<=\¤!!°<=\{Ñ{
{Ñ{ {Ñ{{ ^ * ^ < = = == @ <=
\¤ !! ° <= \ {¢Ñ{ {Ñ{ {Ñ{{ *< @@ !!
°¨{¢Ñ{ ¢{© " " @ # @ ¤
"^=^{@!!°¨{Ñ{\*<{©
¢""@"^¢=^{!
<=@#@¤¨@¨@\!!
°<=\{Ñ{{Ñ{{^<==@#@¤
¨ @\ !! ° \ {Ñ{{\ " ¢ {© < ==
@@@@!!°\{Ñ{¢=^{@°
="^^Ë{<@#=
=={ @ \ = #@= ; @ ° *=*=@#@¤\@@<=@<"@
! \@@ \ @ = @ @ ¤ @ " = @@
@@@¤{\"\@@@!!"^
" @ # @ ¤ @ < " \@ " \@ @@ !!
"^"@<"{@=
@ ¤ " @@ < "} * ¢{© \@ @= = {© { >" " = *" " @ *= ^ = <=
\@@<@=¤@{@""*"
@<^{
#@*\@¤*"*§*@
* @= @} ¢ ~! "{ ^ < ^!
\*=^{@@\\@@{@
{"{
*
# = { @ @ \ @= { >@
@=@¢~!"#@*{"
"{ = ^ @ \ < ^! @ ¤ { @{
!@@¤@*{@{
4#@*@<<{"""@¤{
@ < * @ "" \ < @ " \@@ \@@=*"*@@{
"#"""!@^<¢"
*
#
{!@{{!{\#{@{¤*#{{{{<="@
""@*<¢~!{|{{={{ª¢{
{{{¢{""Ê@¿@""{!{{#{ª{
@\¤\"@§^>| {{{{
"#@"}@=@"@@=
*
¥¦!#{#@"=*<"{|ª@|^"*@~\³¤;!{
{{
¥¦^<}#>@>@# ^°""@# *"
°¤=*!{"*@"*="{!=
|"{ª{
246
247
Bacteria as resistant microorganisms in decomposition of mummified human
remains
Blood biochemistry, haematology and leukocyte phagocytosis after application of
probiotic bacteria and chlorophyll in dogs
H. Vojtková
I. Kubašová1, V. Strompfová1, J. Farbáková2, D. Mudroová3, A. Lauková1
Institute of Environmental Engineering, Faculty of Mining and Geology, VŠB – Technical University of Ostrava,
17.listopadu 15/2172, 70833 Ostrava – Poruba, Czech Republic
1
Institute of Animal Physiology, Slovak Academy of Sciences, Šoltésovej 4-6, 040 01 Košice, Slovakia
Small Animal Clinic, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice, Slovakia
Department of Microbiology and Immunology, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81
Košice, Slovakia
2
3
Human remains have recently become very interesting grounds for palaeomicrobiological interdisciplinary
studies on the boundary of molecular archaeology and microbiology as the analyses of their microorganism
diversity are immune to time. In particular, microbial DNA associated with human remains can provide direct
evidence of the occurrence and frequency of infectious diseases in historic times, or their contribution on the
decomposition and acceleration of the processes of microbial degradation. Despite the advances in the field,
studies documenting various properties of the microbial diversity are rare because the study and identification of
old microbial pathogens in human mummies bring significant sanitary risks.
This study has observed the bacterial microflora of naturally mummified human remains found in the crypt of
Kuffner Family in Sládkoviovo, Slovakia. Out of the Kuffner Family remains (baron Karl Kuffner de Dioszegh,
baroness Maria Franziska von und zu Firmian and their daughter-in-law Cara Carolina von Haebler) we
identified 95 bacterial isolates, among which there are a number of resistant bacterial pathogens.
The isolated bacterial strains make part of more extensive studies of microbiota isolated from different kinds of
human remains and air surrounding the samples inside the Kuffner's mausoleum and crypt. The obtained data
provide important information on the resistance characteristics of microorganisms that accompany the processes
of microbial decomposition of human remains.
Keywords: bacterial strain; crypt-environment; human remains; decomposition; resistance
During last years a lot of nutritional health supplements are used (alone or incorporated in pet food) with aim to
maintain general health of dogs. The most frequently used supplements are vitamins, enzymes, probiotics,
antioxidants, fatty acids, minerals, kelp, chondroprotectives and plant components. Effects of some of these
supplements were not studied in dogs precisely and are often included only because of beneficial effects
observed in humans. Application of probiotic bacteria may be useful to restore microbial balance especially after
destroying of this ecosystem e.g by poor diet or by drugs. In adition, long-term probiotic supplementations could
enhance humoral and/or cellular immune system in dogs [1, 2]. However disadvantage of this long-term
application is overproduction of organic acids in the gastrointestinal tract increasing risk of acidification of
organism, therefore our intention was to test an additive with possible pH-restoring capacity to prevent this
consequence. For this reason, the possibility of combining copper chlorophyllin with probiotic strain
Lactobacillus fermentum CCM7421 was evaluated in healthy dogs (C-control, CH-chlorophyllin 60 mg/dog/day,
LF-L.fermentum CCM 7421 1.3x108/dog/day, CH+LF –both additives, 10 dogs in each group). Dogs were
administered the additive daily during 14 days. Blood samples were collected at days 0, 14 and 28.
Haematological parameters were analysed using Cell-Dyn 3700 (Abbott, USA), blood biochemistry using
Randox kits (UK). Phagocytic activity of monocytes and neutrophils was analysed using Phagotest (Orpegen
Pharma, Germany and flow cytometry (BDFACSCantoTM, Becton Dickinson Biosciences, USA). Statistical
analyses was performed using repeated-measures analysis of variance (ANOVA, Dunnetts post test). While
a significant decrease of serum albumin (P<0.001), urea (P<0.05), glucose (P<0.01) and partially also of
cholesterol (P<0.09) was detected in CH group, values in CH+LF group remained stable during experiment.
Similarly, levels of AST which were significantly higher in CH group (P<0.01) remained in CH+LF dogs
without changes. An important result is stable value of serum calcium throughout the experiment in combinative
group CH+LF because it was lower in the LF probiotic group at day 14 (P<0.05). The total phagocytic activity of
leukocytes was higher in all groups after the 14-day treatment. The highest significance (P<0.001) was observed
in the CH group for both cellular fraction-neutrophils and monocytes. Haematological parameters were not
affected significantly except for the concentration of haemoglobin. Only dogs of CH group had levels of
haemoglobin above the reference values at day 0 (from unknown reasons) which were significantly decreased
after the application of chlorophyllin (P<0.01). It means levels of haemoglobin were normalized to levels
detected in other groups. According to results obtained also for faecal microbiology and faecal concentrations of
SCFA [3] it seems that addition of chlorophyllin to the diet of dogs (at a dose of 60 mg/dog/day) together with
probiotic strain (L. fementum CCM 7421) could prevent bacterial intestinal infections (reduction of clostridia and
coliforms simultaneously detected) without negative impact on acid-alkali ratio in the body. This study was
funded by Slovak Scientific Agency VEGA (project no. 2/0056/13).
Keywords: probiotic; chlorophyll; blood biochemistry; haematology; leukocyte phagocytosis; dog
References
[1] Baillon, M.L.A., Marshall-Jones Z.V., Butterwick R.F. Effects of probiotic Lactobacillus acidophilus strain DSM 13241
in healthy adult dogs. Am. J. Vet. Res. 2004, 65, 338-343.
[2] Benyacoub, J., Czarnecki-Maulden, L., Cavadini, C. et al. Supplementation of food with Enterococcus faecium (SF68)
stimulates immune functions in young dogs. J. Nutr. 2003, 133, 1158-1162.
[3] Strompfová, V., Kubašová, I., Farbáková, J. et al. Experimental application of Lactobacillus fermentum CCM 7421 in
combination with chlorophyllin in dogs. Appl. Microbiol. Biotechnol. 2015, DOI 10.1007/s00253-015-6724-9.
248
249
6
4
>0)F*>6/0. @ )
A
%'<¨«('6"!
"B%')"/"B%
*==;<=!**!

"""*="¤"*{|<
*" = \ \ ! < @ "= ¤ ¤
" \ " \ "@ @ " * *= <"
"@={ @ \= # } {
@@""@ *" ! @ @ }=
"= |!{ ! "* = \ *= @ { | @
\=#"\=<*="@ !
" @ |! { | @ "* = \ \ ¢{
>=\*=<!*"@""}=<{!
*< \ \ }{ | @ < "
|!{ @ @ \ <{ | " \ =
<\**=|!{

*=*|"=@=;<= Ú¤#
;<= Ú¤°¤ Ú¤^
*=#"=|"=@=;<= Ú¤#
;\= Ú¤*¤ Ú¤^
@"}<""@@<=*=@"@
\*<*\\{"@"}<"@<@
< < <{ # < \ < @ *= " @
" "} * @" ! " ~!{ \<
*!~!<*"<"{"@"
@@"<"@"<"<{
!@"@ @ = <* < * " "}
*"""<"{
|@\¤\<"@*"@"}!
@"<{
@"* "@@ @@ "= @"
@ @ "" *" < \@" @*"
{ @ |! @ * <= @ = \ " < *= @ " @ ! *" <
\ *=|!{ !\@@@< <=@ |! @< @ ! \@ @ ! < @ |! { @ }
@\!\@<{©<@"@@"@|!
@<=}{
!<"}\"\*=@"
*=@"*{
!"\"*@"<"}!
<"{!@"""}{
@ @ * " \¤ *" @ < < < "} <" " < " " " §"<{
"#"="}<"<
"#""=\!|!
250
251
Characterization of microbial community structures of cow rumen and manure by
pyrosequencing and Q-PCR
4
&,0%$/4.@S%D
G. Ozbayram1, O. Ince1, Ç. Akyol2, S.Kleinsteuber3, U. Bakirel4 and B. Ince2
'*
B&
~=@|"°=|
*
=@= !!;"@|
1
Environmental Engineering Department, Istanbul Technical University, 34469, Istanbul, Turkey
Institute of Environmental Sciences, Boaziçi University, 34342, Istanbul, Turkey
Department of Environmental Microbiology, Helmholtz Centre for Environmental Research - UFZ, 04318, Leipzig,
Germany
4
Veterinary Faculty, Istanbul University, 34320, Istanbul, Turkey
2
@"*<@"@@
"={@""*"<*@@@@
"={=*@
"@"**"{{@@@@*
@ "{ "@ @ * @ *
@ " @=@*= @== }= * @= <=
< { * * @ *{ @ "= \ "=
@ * *"* @ * " @ =
"@*={@\=="
@} @"@ \ *= ^ " "
{*{{<@"|=#|@¤@
°|\"*§**"{"<<"^=\@#*@
{@@"""@\@@"<<
*<@\@@@|¢{"°|{¢"
{"@=@*=@*@*=@@@=@*¤
\<{¢{©{||°|@\*<
@{ ! | |¢ | °| \ < *{ | \ " @ < " ! = \@ @* {{©{;<<"*|¢|#|°|\
"@@=*=@\@@"
~|¢!{@ ^@@\{Ñ{\@|
\@"*""{><@=*=*@*@*"@<
@"@""@@@*{
3
Biogas production from animal manure by anaerobic digestion is a sustainable approach both for waste
reduction and energy recovery. However, hydrolysis of manure is a rate-limiting step regarding to low
degradation rate of cellulosic materials. The fermentation of organic materials in ruminant animal’s
digestive tract system is similar with anaerobic digestion process Ruminants have unique digestive
system in which there is a symbiotic relationship of microbial communities [1]. Plant polymers are
degraded through this complex relationship in which microorganisms release necessary lyric enzymes
for fermentation process and convert them into short chain fatty acids. Thus, ruminants can produce
energy. While an inocula selection has a major importance in start-up period of anaerobic digesters,
using of rumen fluid is considered as a promising application for enhancing biodegradation of cellulosic
materials. In this study, the aim was to analyse the microbial community structures of cow rumen and
manure and reveal similarities and differences between these two bacterial populations whether it is
appropriate to use it as inoculum in anaerobic digesters. In this scope, triplicate samples were taken
from rumen fluid and cattle manure and genomic DNA’s were extracted according to the
manufacturer’s instruction (Fast DNA SPIN Kit for Soil, MP Biomedicals, Germany). Bacterial
community compositions of rumen and manure samples were investigated by 454 pyrosequencing of
16S rRNA gene sequences. 454 pyrosequencing was applied as described by [2]. The quantification of
total bacteria and three fibrolytic bacteria, Ruminococcus flavefaciens, Fibrobacter succinogenes, and
Ruminococcus albus, were carried out by StepOnePlusTM platform (Applied Biosystems, Life
Technologies). The number of assigned reads of the rumen sample was 17141. The bacterial sequences
were represented by 16 phyla with dominating Bacteroidetes (54.4%) and Firmicutes (30.7%) in which
they represented more than 85% of total sequences. The remaining phyla represented by <15% of total
bacterial sequences composed of mainly Proteobacteria (5.8%) and Fibrobacteres (2.9%). On the other
hand, number of assigned reads of the manure sample was 24120. Eighteen bacterial phyla were
represented with Firmicutes and Bacteroidetes which are the most predominant phyla, accounting for
68% and 16.2%, respectively. According to the Q-PCR analysis the abundance of total bacteria was
measured as 1,22x1010 copies/mL in rumen fluid. The number of Ruminococcus flavefaciens was the
highest in the rumen fluid (1,0x105 copies/mL) than that of other two cellylolytic bacteria. The
abundance of Fibrobacter succinogenes and Ruminococcus albus were found as 3,5x103 copies/mL,
and 1,9x102 copies/mL, respectively. The abundance of total bacteria in manure sample was almost the
same with rumen sample (1,01x1010 copies/mL). However, the numbers of cellulolytic bacteria are
accounted lower than rumen sample. The numbers of these bacteria were in the order of: Ruminococcus
flavefaciens>Ruminococcus albus> Fibrobacter succinogenes. Molecular analyses showed that high
abundance of cellulolytic bacteria in rumen fluid can be a promising solution for the overcome of
hydrolysis limitations during the anaerobic digestion of cow manure.
Keywords: manure, pyrosequencing, rumen, q-pcr
References
[1] Hungate, R.E., 1966. The Rumen and its Microbes. Academic Press, New York. 533.
[2] Ziganshin, A.M., Liebetrau, J., Pröter, J., Kleinsteuber, S., 2013. Microbial community structure and dynamics during
anaerobic digestion of various agricultural waste materials. Appl. Microbiol. Biotechnol., 97, 5161-5174.
252
253
4
&
"
'$&
$&
#
Comparative study of enzyme linked immunosorbent assay (ELISA) and rapid test
screening methods on HIV, HBsAG, HCV and syphilis among voluntary donors in
Owerri, Nigeria
1,*
1
1,
1
<.%'('<
%'( !%'2
2

Okorie, H. M , Nwanjo H. U. Dike-Ndudim, J. N. Igbudu, O. F. , Ohalete, C. N.
!#*=;<=§§!
*=@=<@;<=§§!
*=#"=;<=§§!

1
Department of Medical Laboratory Science, Faculty of Health Sciences, Imo State, University Owerri, Nigeria.
2
Department of Medical Microbiology, Faculty of Sciences, Imo State University, Owerri, Nigeria.
*Correspondent Author:[email protected]
A comparative study of Enzyme linked immunosorbent assay (ELISA) and rapid test screening method on HIV,
HBV, HCV and syphilis among voluntary donors was investigated on 350 subjects in Owerri. They were 250
males and 100 females, all ranging from the age of 21-50 years. Transfusion transmissible infections (TTIS) are
the major problem associated with blood transfusion. Accurate estimates of risk of TIIS are essential for
monitoring the safety of blood supply and evaluating the efficacy of currently employed screening procedures for
immunodeficiency virus (HIV 1 and 2) hepatitis B virus (HBV), hepatitis C virus (HVC) and syphilis using both
enzyme linked immunosorbent assay (ELISA) and rapid test screening method. For HIV 1 & 2 screening test, the
female donors show significant increase (P<0.05) between the ELISA and Rapid test method while there is no
significant increase (P>0.05) between the ELISA and rapid test method for male donors. Hepatitis B virus
screening test shows a significant increase (P<0.05) between ELISA and rapid test method for female donors,
while there is no significant increase (P>0.05) between the two methods for male donor. Also hepatitis C Virus
screening test shows a significant increase (P<0.05) between the two methods for the female donors and shows
no significant increase (P>0.05) for male donors. However, there is significant increase (P<0.05) between ELISA
and rapid test method for syphilis screening test among female donors while there is no significant increase
(P>0.05) for the male donors. This study shows that there is a difference between the two test method, hence
indicated that that 30(8.57%) infected units of blood would have been transfused due to false negative results
with rapid test method. It was found in this study that prevalence of TTIs were high in females than the males.

!@*@@@
*{ " *\ @ *= @=@*= ¸ @ * \@ @@ " *= @\ @@
@=@*={
*"@*\@=@*=@@
@@@\3\"{
@"@@="@=@*=*"=
@@*={@"@\<Ë{*\@
@=@*="@@¸@@@=}=
@@*@^²{{
"#3@=@*=@
Key words: ELISA, Rapid test, HIV, Hepatitis, Syphilis, Blood transfusion.
254
255
Current diversity of infectious hematopoietic necrosis virus (IHNV) in Japan
Detection of bacteriocin structural genes in faecal enterococci from dogs
Aki Namba1, 2, K. Minakami1, T. Takee1, N. Mano1 and T. Nakanishi2
I. Kubašová, V. Strompfová, A. Lauková
1
Institute of Animal Physiology, Slovak Academy of Sciences, Šoltésovej 4-6, 040 01 Košice, Slovakia
College Bioresource Sciences, Nihon University, Fujisawa, Kanagawa 2520880, Japan
2
JSPS Research Fellow, Chiyoda-ku, Tokyo, 1020083, Japan
Infectious hematopoietic necrosis virus (IHNV) is a Novirhabdovirus that causes significant mortality of
salmonid fish worldwide. Originally enzootic in western North America, IHNV has spread by the movement of
salmonid eggs to European and Asian countries. Depending on the species of fish, strain of virus, and
environmental conditions, outbreaks of IHNV may result in losses of 80–100% in a fish rearing facility.
IHNV has been subdivided into five major genotypes: three genotypes were identified as upper (U), middle (M),
and lower (L) for North American isolates, a fourth genotype was identified for European isolates sharing a
common source with genotype M, and a fifth genotype was identified for Asian isolates sharing a common
source with genotype U [1]. Furthermore, IHNV isolates in Japan were classified into U and Asian isolates
including two lineages, JRt Shizuoka and JRt Nagano [2]. Since IHNV isolates from cultured salmonid fish in
Japan exhibit wide genetic diversity compared with those of other countries, some researchers suggest the
diversity of Japanese IHNV continued to increase with changes of its virulence in salmonid farm environments.
However, knowledge regarding the temporal shifts in relation to genotype/lineage and pathogenicity of IHNV
isolates in Japan is limited. Therefore, we collected IHNV isolates from diseased salmonid fish at some fish
farms in the north Kanto area of Japan from 1981 to 2013, and analyzed the G-protein full-length nucleotide
sequences of each isolate. Phylogenetic analysis classified of all IHNV isolates into 3 genotypes/lineages (U, S
and N), and isolates from the 1980s to 1990s mainly belonged to genotype U and the S lineage. On the other
hand, most isolates after 2000 were classified into the N lineage, and the maximum nucleotide diversity among
the N lineage was 4.4% (Fig. 1). These results mean that we should recognize the current situation of
genotype/lineage of IHNV isolates in the whole area of Japan.
In this study, we report the phylogenetic analysis of IHNV isolates obtained from diseased salmonid fish in 16
prefectures of Japan after 2010s.
The genus Enterococcus belongs to lactic acid bacteria (LAB). LAB are part of commensal intestinal microbiota
of human and many animals. Strains of enterococci can produce diverse antimicrobial peptides – bacteriocins
(often named enterocins). Bacteriocins are ribosomally synthesized, extracellulary released peptides with
antimicrobial activity towards more or less related bacteria [1]. The bacteriocin-producing enterococci may be
isolated from many sources, e.g. food, feed, waste, feces, gastrointestinal tract of animals and human and other.
Most of the characterized enterocins are produced by E. faecium and E. faecalis strains, but enterocins have also
been isolated from E. mundtii, E. hirae, E. avium, E. durans. The present study provides a survey about
occurrence of enterocin structural genes A, P, B, L50A, L50B, AS-48 and bact31 in faecal enterococci isolated
from dogs. Enterococci were isolated from faecal samples of 90 dogs, 30 breeds of different age (4 months to 10
years). Dogs were fed with different diet. To detect numbers of enterococci, standard ten-fold dilution method
and selective medium M-Enterococcus were used. One hundred thirty three strains were isolated and these
isolates were identified using protein “fingerprints” determined by MALDI-TOF mass spectrometry [2]. They
were identified as follows: 74 strains of E. faecium, 30 strains of E. faecalis, 25 strains of E. hirae, 3 strains of E.
casseliflavus, and 1 strain of E. mundtii species. The DNA from identified strains was isolated by rapid alkaline
lysis method [3]. Thereafter enterocins genes were detected by PCR method. The highest occurrence of the
studied genes was observed in E. faecium strains. The structural gene of enterocin A was detected in 40 strains of
E. faecium and 1 strain of E. faecalis. The entB gene was detected in our study in 23 strains of E. faecium, 1
strain of E. faecalis and 2 strains of E. hirae. No enterocin structural genes (from those tested) were found in
isolates of E. casseliflavus and E. mundtii. The detected combinations of enterocins structural genes in our
enterococcal strains are presented in Table 1.
Table 1. Combinations of enterocin structural genes in faecal enterococci from dogs.
Combination of enterocin structural genes
entA + entB + entP + entL50 A/B
entA + entB + entP
entA + entB
entA + entP
No genes detected
Number of enterococcal isolates
8 E. faecium + 1 E. faecalis
23 E. faecium + 1 E.faecalis
32 E. faecium + 29 E. faecalis + 23 E. hirae + 3 E.
casseliflavus + 1 E. mundtii
In conclusion, the most prevalent enterocin structural gene was entA, especially in E. faecium isolates (54%).
The most frequent combination of genes was entA+entB (31% of E. faecium strains). This study was funded by
Slovak Scientific Agency VEGA (project no. 2/0056/13).
Keywords: Enterococcus; enterocin; dog; bacteriocin structural gene
Fig. 1 IHNV isolates from the 1980s to 1990s mainly belonged to genotype U and the S lineage. On the other hand, most
isolates after 2000 were classified into the N lineage.
Keywords: Infectious hematopoietic necrosis virus; IHNV; phylogenetic analysis; salmonid fish
References
[1] Nes I.F., Holo H., Class II Antimicrobial Peptides from Lactic Acid Bacteria. Biopolym. 2000; 55, 50-61.
[2] Bessède E., Angla-gre M., Delagarde Y., Sep Hieng S., Ménard A., Mégraud F. Matrix-assisted laserdesorption/ionization BIOTYPER: Experience in the routine of a University hospital. Clin. Microbiol. Infect. 2011; 17,
533-538.
[3] Baele M.,Chiers K., Davriese L.A., Smith H.E., Wisselink H.J., Vaneechoutte M., Haesebrouck F. The grampositive
tonsillar and nasal flora of piglets before and after weaning. J.Appl. Microbiol. 2001; 91, 997-1003.
References
[1] Nishizawa et al. (2006) Diseases of Aquatic Organisms, 71, 267-272.
[2] Mochizuki et al. (2009) Fish Pathology, 44 (4), 159-165.
256
257
)
&)/&
4*
C
/
6!
'/
Development of a PCR for the detection of Demodex folliculorum infestation in the
periocular area
%
Alberto Tenorio-Abreu, José Antonio Gómez-Fernández, Juan Carlos Sánchez-España, Luis Arroyo
Pedrero, Bárbara Gómez Alonso, Esmeralda Rodríguez-Molins, Carlos Hidalgo Grass.
!!K'%4B'%)B"'%7"'(,"'2>'!.&'
!
=^"*@^<<#!@";<=^{#{{
°"~{
!=°#=!"~"@~{

*=#"==#!@";<=^{#{{
°"~{

#"==#!@";<=^{#{{°"
~{

;<=#""@^{#{{¢#""~{
Introduction
Demodex folliculorum is an ectoparasite of family mites living in the hair follicles. It is so saprophyte in a
significant percentage of healthy patients. Superparasitation can cause the appearance of some lesions such as
rosacea or chronic blepharitis. Currently it is studied for a possible role in the development of basal cell cancer
(BCC) lid.

<"*"@""}\
@"{|"*@@@{@"=\@
<*"@*^#~^@""@
~{ ! ^< "= \ " "@ @ @ * "@
{>@"\=©"@"*^#{>"@
{©\!<*=~{©\<
*=
^\@<<{¢©{©<={@@@<@
¢{¢¢© { © *= ~ {© {© *= ^ <= ²{ ¨{{
\<@\=Ë{ ¨{*\*@
{@"="@@"={©*{@<
*\@@"@*\@@""@\@*{
"#O
O5#O"%O"OT05
Objective
Design and development of a real time-PCR to detect parasite D. folliculorum in BCC biopsies.
Material and methods
Primers were designed using the Primer Express 3.0 software from 18S ribosomal gene database GenBank
(KF745889.1), whose sequences were: SENSE- CTCGTAGTTGTATCTCAGTTCAT and ANTISENSEACCCGGTAAAGAGCATCAGA. To determine the sensitivity of the technique amplicon dilutions of known
concentration measurements were made previously by spectroscopy (Qubit fluorometer 3.0, Life Technologies).
Specificity is determined by the temperature of dissociation specific amplicon (79,6ºC) and subsequent
sequencing. The technique was developed from three samples obtained from the parasite tabs extracting a patient
with chronic blepharitis, which was used as a positive control. A system of manual DNA extraction columns
(ISOLATE Genomic DNA Spin Column- Bioline) was used. PCR was performed in 7500 Fast Thermal Cycler
(Applied Biosystems), with 35 cycles of temperature (95º-56º-72º) and a final dissociation curve. As fluorophore
in measuring amplification SYBR Green was used. The assay was performed in triplicate.
Results
The sensitivity limit of detection measured in copy number was between 0 and 10 copies. Specificity was
consistent with the dissociation temperature of 79,6ºC. The amplicon sequence determined by capillary
sequencing was 100% concordant with the GenBank database (KF745889.1).
Conclusions
With the data obtained sensitivity and specificity of the PCR developed, the parasite can be detected by this
technique. Being able to start the study of BCC correlation with parasite infestation.
258
259
)
$
$$
3$
&
0).<3 !$
Diabesity management through inhibition of nutrient digestion and absorption
0%' %'C!
(62
Daairy Microbiology Division, NDRI KARNAL, HARYANA, India
Manpreet Kaur, Monica Puniya, Priti Mudgil, Anita Kumari Garsa, and Anil Kumar Puniya

**"ºº"º{~{{;<º¡#"{"!=
!º{

**º;*!º{

*º#*"!"º{~{{;<º¡#"{"!
=!º{
@*=<Ô="==,$"@
*=@@\@@""Ô{
| @ "= \ } @ @ = = #!|> ,$=
= *= #!| = \ < { "¤ @< @\ @ @ = @
"<<*\@{{{@<*
""*<=@¤@<
@¤{
@<}\"@*=#\
=*@"*=<=@""@{
@"\@=@@\<
@"{
@ @ "= @ #!|> = Ô Ô
@@"Ô\=\*@*=*={
| * " @ Ô @Ô \ { "
}@=*={
Being a couch potato leads to the spread of silent assassins in the form of lifestyle diseases throughout the world
with diabetes and obesity as major visage. Diabesity describes diabetes in the context of obesity, sometimes
referred to as obesity-dependent diabetes. Recently, it has been recognized as a major public health problem and
also integral components of metabolic syndrome. The role of -glucosidase inhibitory lactobacilli in relation to
diabetes and pancreatic lipase inhibitory lactobacilli in relation to obesity is yet to be explored. The present study
was aimed to focus that how the probiotic lactobacilli can be used to treat the diabesity through the enzyme
inhibitory activity. For that, lactobacilli sp. to inhibit pancreatic lipase and -glucosidase, were isolated from the
different sources. Samples were enriched in MRS broth for 24 h at 37 oC. Isolation was carried out using pour
plating of enriched sample in LAMVAB and BCP-MRS agar. Gram positive and catalase negative rods were
selected for genomic DNA extraction and cultures were confirmed as lactobacilli through genus specific PCR.
Preliminary identification was done for non-lipase producers and non--glucosidase producers, selected isolates
were subjected to the inhibitory activity for both the enzymes. Out of 52 isolates, 20 cultures were found to be
negative for lipase production and 11 cultures were found to be negative for -glucosidase. For enzyme
inhibitory activity, 11 cultures were showing pancreatic lipase inhibitory activity and 9 cultures were showing glucosidase inhibitory activity. Among them 5 cultures were showing good probiotic attributes in vitro (acid
tolerance, bile tolerance, cell auto-aggregation ability, cell surface hydrophobicity, bile salt hydrolase (BSH)
activity, antimicrobial activity, antibiotic susceptibility,) were done followed by antioxidative potential (ABTS,
DPPH and FRAP) for both the activities and were confirmed by species specific PCR. Therefore, it is suggested
that pancreatic lipase inhibitory and -glucosidase inhibitory probiotics can be used as the new players for
controlling diabesity, although more interventions need to be done in-vitro and in-vivo for clinical use.
"#=#!|>#=,$!*{
260
261
Dynamics of Campylobacter jejuni shedding in a broiler flock experimentally
infected with two different strains
)&$$
$&$
.
Medelin Ocejo, Beatriz Oporto and Ana Hurtado
C%'
C
(' 6(' 1<2
Department of Animal Health, NEIKER – Instituto Vasco de Investigación y Desarrollo Agrario, Berreaga 1, 48160 Derio,
Spain

°@|@@|!};<=|@|
#=#=="==}@
@|!};<=@|

!°@|@@|!};<=|@|

" @ * \@@ " <" <{ >"
"*@§="@"{|""
@ \@ ¤ "@ " <= { @ < < " @ " @{
@@"=\<@<"="<"{
@\¤"*"*"*|@@{=¢
\*"*"@"*¤@{!@
\*=#^
@{"\"\\*@@@
\"@{!\"*±«\¤=
<* " \@{ @ " \ ^" @ " < * @"@{
"@\@\@¢{©\*="{©
# {© <={ @ \ "= \ "! !
!
{¢©{
|@"*@<@<@*"@
="*@"{
"#!*"@=">"""
Campylobacter is the main cause of gastroenteritis in industrialized countries and poultry its principal reservoir
and source for human infection. When Campylobacter enters a flock infection spreads rapidly colonizing most of
the animals in the flock shortly afterwards. Animals remain infected throughout their productive life shedding the
bacterium in their faeces. With the aim to monitor spreading of different Campylobacter jejuni strains in a flock,
600 one-day-old male Ross 308 broilers were allocated in floor pens bedded with ca. 5 cm of wood shavings and
reared following standard commercial practices. At 15-day-old, 120 chickens were inoculated by oral gavage
with a dose of 105 cfu of a mixture of 2 C. jejuni strains, the collection strain CNET099 (sequence type 267,
clonal complex 283) and a field strain isolated from chicken C303 (sequence type 572, clonal complex 206).
Faecal pool samples and cloacal swab samples from chickens, as well as samples from the drinking water and the
air, were obtained weekly until the end of their productive life (42 days of age). Animal and environmental
samples were analysed for the presence of C. jejuni by culture on the Campylobacter selective chromogenic
medium CASA (BioMérieux) and real-time PCR. Environmental samples remained culture negative throughout
the experiment but 6 days after inoculation the infection was widespread in the flock. Based on the difference
between both inoculated strains in terms of quinolone resistance (CNET099, Sensitive; C303, Resistant) their
spread was monitored by real-time PCR SNP mutation detection in the gyrA gene (C257T) [1]. Six days postinoculation, the field strain was already slightly more prevalent and during the following 2 weeks it was detected
in over 80% of the samples. At the end of the experiment the proportion was 70% vs. 30% for the field strain.
Mixed infections were detected at some point in 8.5% of the cloacal swabs individually tested. In the majority of
the inoculated animals that were repeatedly sampled, the field strain was the only detected; but in one third of the
animals a transition between one strain to the other was observed. Although birds were not under any selective
pressure, further MLST genotyping analyses are to be carried out to rule out the small possibility that the
quinolone resistance determinant used here to differentiate both strains was transferred between the strains
during colonization. If confirmed, these results showed that the field strain C303 was more widespreadly
disseminated in the flock and more heavily shedded by chicken. Pending analysis of caecal content samples will
allow us to compare colonization levels of both strains and associate them with the dissemination patterns
observed.
Keywords: Campylobacter jejuni; broilers, experimental infection; shedding
References
[1] Oporto, B., Juste, R.A. and Hurtado, A. (2009) Phenotypic and genotypic antimicrobial resistance profiles of
Campylobacter jejuni isolated from cattle, sheep and free-range poultry faeces. International Journal of Microbiology
2009, 456573.
262
263
$
$
&&
"
&$
Effect of interferon expression by supplementation with high-concentration
ascorbic acid in rainbow trout onchorhynchus mykis
/
&' <
'*B
'7
& ,'*7
Takumi Fujikura1, Kasumi Kanai, Aki Namba2, 3, Yasuhiro Shibasaki2, Noriko Wada4, Hiroyuki Anzai4,
Nobuhiro Mano1 and Teruyuki Nakanishi2
!@~|°|"|<=!{}¤{
1
|"ª @ *\ " "= @ * { <=
"@"={@@@"*"@"¤@
" @ *={ @=@} @ "*" " *=
"* #!^ =* " *= = {
""*=""@<@\@#!^="*=@
= @ " @ \@#!^ *= **{ | @ " <"@
@@*@#!^**\@@"
=@" !@**{
! #@ª ~\ \@ ** ¨" \ " @@
^@@*"\@\@#!^\¤¤@
\¤"@@{!\"@}\¤
{*#!^^\"@@**"@
{ ^ " *"" ^ \ @@= \ <" "{ ^^! |! \ * = \ " @"
{
"ª#!^*\@"\@@"
{\<""""=@
=@"\{#!^\*=^<"= !"\
< " ¢{© =} © ¢© ^{
\@@"^¨¢{^^!*
\=@*@*@@"^
<=@{
"ª@@"#!^"
@\@@{"@\@@@
="#!^*@**{
Department of Marine Science and Resources, Collage of Bioresource Sciences, Nihon University, Kanagawa, 252-0880,
Japan
Department of Veterinary Medicine, Collage of Bioresource of Sciences, Nihon University, Kanagawa, 252-0880, Japan
3
Research Fellow of Japan Society for the Promotion of Science, Chiyoda ward, Tokyo, Japan
4
Department of Bioscience in Daily Life, Collage of Bioresource Science, Nihon University, Kanagawa, 252-0880, Japan
2
Ascorbic acid (AsA) is an essential vitamin for optimal growth and believed in being beneficial for immune
response in fish. Previous studies showed that use of dietary supplementation with high-concentration AsA as a
dietary immunostimulant activated immune cells responsible to produce interferon gamma (IFN) in rainbow
trout. Interferons (IFNs) are powerfully multifunctional Cytokines that are induced in response to viral infection
and enhance antiviral activity and macrophage activity in fish and mammals [1]. We hypothesized that resistance
to viral infection given by AsA supplementation was affected by IFN antiviral property. In this study, expression
pattern of rainbow trout IFN and that relative gene was analyzed for elucidating mechanisms of especially rise of
antiviral defense in rainbow trout with High-concentration AsA supplementation. Quantitative reverse
transcriptase PCR (qRT-PCR) assays were performed to profile rainbow trout IFN subgroups transcripts, in naïve
fish and fed commercial diets supplemented with 5000 mg of AsA per Kg diet for 7days. Expression levels of
IFN1 and IFN2 were relatively higher at 7day of feeding AsA-supplemented diet than at 7day of feeding
normal diet. Slight increase of IP-10 expression, related genes to IFN, and TNF- were also detected. Our
result and previous study suggest that high-concentration AsA supplementation in fish may induce activation of
IFN and downstream IFN-related genes and as part of modulation of innate immunity against viral infection.
In this conference, we report the expression pattern of IFN and IFN-related genes with high-concentration AsA
supplementation in rainbow trout.
Keywords: interferon, ascorbic acid, qRT-PCR
References
[1] Zou J, Gorgoglione B, Taylor NGH, et al (2014) Salmonids have an extraordinary complex type I IFN system:
characterization of the IFN locus in rainbow trout oncorhynchus mykiss reveals two novel IFN subgroups. The Journal
of Immunology 193:2273–2286.
"#
"*{**=@"{
264
265
$
$
&
<4
-$
"
,8
,
%',H0=$
7)%'!
*%')
6%', H
0'('4
3('
<
&(',*4('&(',=(6Y%
,<B
%'.
('
B%'4B%6.
%

#*=@=#@=¢ @>#!!;¢
};<=|"<|*""¤=
|*"@;<="=<<¢|*"
"¤=

# @ = @ = = \\{@<=¤""={"
*@"*""{\<
@ *" * " @ @ @@ ¤ @ * " ¤ \ @ " { | @ @
"@*¤@@@
<¤{@\@@"@<="*=@
="={
!*\<@@="<=*@@"
{>==>\="*@"*=\@@<*=\
\*{¥¦{>=@@*<
*@<<*{
| @ "= \ > = < * " \ < \@ =
{ > " \ \ § Ê¿ \@ >
§ "{ !* " \ " *@\ \@ <
<"¢={\\"*="*¤"
¢© © * { #" " \ @\ * {
= \ "<= " *= ~! ^{ ~! \
~! =@ \ { ^ \ @ \@ =
*{*#
> \ @ "= <" "= @\ < " " °{
"" " @< @\ @@ @ <= * ""=
"<={|@@
!|>~ö@\<"{=<="
@#"\@*
= !|>~ö=<<\@{@"@@
*" * <= <" ª ! 9 !
!!!#!
#!":{|\<"
@@""*"<=<""\@@
#{@"@\@@=@@*@@{
# \ < £ £ { | #
< £ <= @"@ @ \ "" " {
"\">\{*¢~!
\ " = < < @"@" @ "={
"@\@\@@
\{|@@*{|"@
=*""\{
! < <" @ < @ "\|>~¢ª<=@@=@\"\@
"@@"@"#
!!¢!¢!{@<\
@@@@*\@@"""@@^<{
¢©
=\<"@"*"@"
" @ " = ! *= { @ " " *"
"@"**@@¤{@@"=*
"<<"@{
©
"#!""*"
<&
%>
)
!
%!%:4;
!
%!2
!
%!:4;
!
%!D
!
(!%:4;
!
(!2
!
(!:4;
!
(!D
<
$

-
:$;
E
!
:Q;

¢©

¢

¢
:Q;

¢
¢

@
:;

"ª>==**"
*
¥¦~{°Ê=*@"<¿|ª
266
267
Efficacy of new antiviral treatments for hepatitis C virus
Esmeralda Rodríguez-Molins, José Antonio Gómez-Fernández, Alberto Tenorio-Abreu, Luis Arroyo
Pedrero, Bárbara Gómez Alonso, Juan Ignacio Ynfante Milá.
Introduction
The Hepatitis C virus (HCV) causes chronic hepatitis by 85% of those infected. Traditional therapy was up to
pegylated interferon and ribavirin time. They have now been introduced into the market new direct acting
antivirals as sofosbuvir dasabuvir which are inhibitors and polymerase RNase preventing viral replication. These
antiviral be administered in combination of new protease inhibitors as Simeprevir, daclastavir, ledipasvir or
ritonavir. Cure rates are situated close to 100% using such combinations.
Objective
Evaluate the effectiveness of sofosbuvir in combination with Simeprevir, Daclatasvir or ledipasvir in the
treatment of chronic hepatitis C dispensed in outpatient hospital pharmacies Juan Ramon Jimenez Hospital in
Huelva.
It was studied the evolution of 22 patients treated with the following combinations: 14 patients with sofosbuvir +
Simeprevir, 6 Daclatasvir sofosbuvir + and 2 + ledipasvir sofosbuvir. Treatment duration was 3 months. All
patients were asked to monitor the viral load before treatment, 15 days after the beginning of treatment, at 30
days and 3 months. It was considered as cured patients with viral load 0 IU/ml at 3 months.
Results
18/22 (82%) were men. The average age was 55.18 years (SD = 9.9 years) and a range of 44-77 years. Viral load
prior to treatment varied between 7797 and 6,680,311 IU/ml, with an average of 1,040,004 IU/ml (SD =
1,600,725 IU / ml). After 15 days 13/22 (59%) had zero viral loads, presenting the remaining patients included
viral load between 36 and 851 IU/ml. At 30 21/22 (95.5%) had zero viral load, with one patient with 178 IU / ml.
At 3 months, all patients had viral load zero.
Conclusions
Ratio is higher in man affected with a ratio of 4/1. The treatment with the new drug in combination with
sofosbuvir new protease inhibitors presented a cure rate of 100% in the series studied. Therefore, although they
are costly therapies, healing, and improve the quality of life can be a long-term savings for the health system,
avoiding transplant, hospitalizations, diagnostic tests and drug-related adverse effects.
Enterocin M-producing strain Enterococcus faecium AL41 with probiotic
properties and its application in horses
A. Lauková1, E. Styková2, I. Kubašová1, M. Pogány Simonová1, I. Plachá1, S. Gancaríková2, V.
Strompfová1 and I. Valocký2
1
2
Institute of Animal Physiology Slovak Academy of Sciences, Šoltésovej 4-6, 040 01 Košice, Slovakia
University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice, Slovakia
The aim of every breeder is to maintain the animals in a good health condition. In spite of taking care very
strongly, the pathogens can cause some disorders. The frequent disorders due to pathogenic bacteria in horses
involve ehrliosis, salmonelosis, clostridiosis, some disorders caused by streptococci especially of group B [1].
Because our Laboratory of Animal Microbiology has dealt with beneficial microbiota of probiotic character and
by them produced antimicrobial substances-bacteriocins for years, we decided to check effect of our Enterocin
M-producing strain Enterococcus faecium AL41 in horses. Our decision was based on our previous results
concerning its application with beneficial effect in food-producing animals e.g. in rabbits or poultry [2, 3, 4] and
because there are only very limited information related to probiotic application in horses. Eleven animals (8
mares and 3 horses-geldings) were involved in the experiment. They were of different breeds such as the Norik
breed Murá Plain, English hot-blooded, Slovak hot-blooded and the Hucul breed. They were fed twice a day
with hay and oats alternatively grazed. Experiment was performed for twoo weeks (in autumn of 2014). Faecal
and blood samples were taken at the start of the experiment and then after 2 weeks of E. faecium strain AL41
application. Blood samples were collected from vena jugularis. Pure cells of E. faecium strain were prepared as
described previously [2] in the concentration 109 cfu/ml. The dose of strain (1g per 1 animal per day) was applied
into the diet, in the small part-bolus to check that animal received it. Animals had the attitude to water ad libitum.
Microbial analyses were performed according to ISO methods using the appropriate cultivation media.
Moreover, the strain AL41 was marked by rifampicin to differ it from the other microbiota and checked on MEnterococcus agar with rifampicin and then to confirm by PCR and MALDI-TOF identification system.
Moreover, phagocytic activity (PA) was tested [2] and biochemical parameters. E. faecium AL41 showed a
sufficient colonization in the digestive tract of horses; at day 14 its average count reached 2.35 (0.70) cfu/g
which is amount detected also in the other animals e.g. after three weeks application [2, 3]. The counts of the
total enterococci reached in average 3.52 (0.73) cfu/g and the total lactic acid bacteria counts were 5.62 (0.38)
cfu/g. The counts of undesirable bacteria were not high and they were not influenced by AL41 strain application,
except Aeromonas sp.; there significant decrease was found (p<0.001). After two weeks application of AL41
strain, tendency in increasing values of PA was found, when an average value of PA at day 0-1 was 73.13 (8.55)
and at day 14 it was 75.11 (8.66) %. Biochemical parameters were not influenced by the strain application or
they were optimized into physiological range. In spite of the preliminary reuslts, they have importance from the
basic point of view (stability and colonization of strain AL41, PA) as well as the priority is that there are no
applications of original probiotic and bacteriocin–producing strains in horses to maintain their good health
conditions. The study was financially supported by the project Vega 2/0004/14.
Keywords: Enterococcus faecium; probiotic; application; effect; horse
References
[1] Lavoie, J.P., Drolet, R., Parsons, D., Leguillete, R., Sauvageau, R., Shapiro, J. Et al. Equine proliferative enteropathy :a
cause of weight loss, colic, diarrhoea and hypoproteinaemia in foals on three breeding farms in canada. Equine Vet. J.
2000, 32, 418-425.
[2] Lauková, A., Chrastinová, ., PogánySimonová, M., Strompfová, V., Plachá, I., obanová, K., Formelová, Z.,
Chrenková, M., Ondruška, . Enterococcus faecium AL41:Its Enterocin M and their beneficial use in rabbits husbandry.
Probiotics and Antimicrob Prot. 2012, 4, 243-249.
[3] Lauková, A., Kandriáková, A., Šerbová, J. Use of bacteriocin-producing, probiotic strain Enterococcus faecium AL41
to control intestinal microbiota in farm ostriches. Lett. Appl. Microbiol. 50, 2014, 531-535.
268
269
"
,$6!
$$
"
Enterocins and their beneficial effect in rabbits husbandry
A. Lauková1, . Chrastinová2, M. Pogány Simonová1, I. Plachá1, V. Strompfová1, R. Szabóová3, A.
Kandriáková1, J. Šerbová1, Z. Formelová2, M. Chrenková2, . Ondruška2 , K. obanová1 and R. Žitan2
&
<
&
'7+,=
3
8
'0
'68&,=
'
*H
1
Institute of Animal Physiology Slovak Academy of Sciences, Šoltésovej 4-6, 040 01 Košice, Slovakia
National Agricultural and Food Centre, Hlohovecká 2, 951 41 Nitra-Lužianky, Slovakia
3
University of Veterinary Medicine and Pharmacy, Komenského 73, 048 03 Košice, Slovakia
2
The study concerning the enterocins, antimicrobial proteinaceous substances produced mostly by enterococci has
been enourmously developed in ninethieth years [1]. However, most experiments were focused on the
characterization and properties of those antimicrobial substances. But our interest is in their application
effect.Therefore, the present work studies beneficial effect of four bacteriocins-enterocins used in rabbits
husbandry. Rabbits represent not only food-producing animals but their also serve as a good experimental model
for the research studies. The following bacteriocins-enterocins were tested (characterized at our laboratory as
well as their producer strains): Enterocin 4231 produced by ruminal strain Enterococcus faecium CCM4231, Ent
M produced by E. faecium AL41 (CCM8558) of environmental origin, Ent 2019 produced by rabbit-derived E.
faecium 2019 (CCM7420) strain and Ent 55 produced by poultry strain E. faecium EF55. All partially purified
substances were prepared as previously described by Lauková et al. [2]. The experimental schedule was as
follows: sampling at the start of the experiment (day 0-1), after 3 weeks of Ents application, day 21) and at day
42 (3 weeks after cessation of application). Rabbits (120) were divided into 5 groups, 4 experimental and one
control. Manipulating and handling were accepted by the responsible institutions. Rabbits fed mixture for broiler
rabbits and had entrance to water ad libitum. Ents were applied into water (50μl per animal per day). In vivo
antimicrobial effect was checked (log10 colony forming units per g), phagocytic activity (PA in %), biochemical
parameters, gluthation-peroxidase enzyme including, morphometry, anti-Eimeria effect and partially also effect
on physico-chemical quality of broilers meat using standard and certified methods (ISO). Anti-coliforms effect
was noted as well as the decrease of staphylococci, pseudomonads and clostridiae was determined (with
significant or mathematic difference). Repeatedly, stimulation of PA (unspecific immunity parameter) was noted
with the significant increase of PA values comparing the experimental (ES) groups and control group- C),
p<0.001) with prolonged effect at the end of the experiment. Among Ents, the highest PA value was noted in
EntM group (68.80 ±0.06%). After this Ent M application, also the highest villi height:crypth depth ratio was
measured; it means that reparation ability of enterocytes was beneficially influenced-increased. Although the
mode of action is not known, anti-Eimeria effect was noted by the reduction of Eimeria oocysts immediatelly
after Ent application. Application of Ents did not evoke oxidative stress (no influence of GPx values) and also
they have not influence on the other biochemical parameters such as the total proteins, cholesterol,
alaninaminotranspherase-ALT, glucose, etc. Physico-chemical parameters of meat were in normal value range;
meat was juicy, tastive with accepted consistency. Our results using Ents in rabbits husbandry are really original
as well as parameters checked especially morphometry or anti-Eimeria effect; these results also bring new view
for enterocins utilization; our results are important from both, basic research and application research. Breeders
always look forward not expensive and simple innovations. The study was financially supported by the project
Vega 2/0004/14.
|"
@= *= " \
*\ \¤ { < \* "
@*@"*""{
>*§<
<"\=<<@
\{
#@
<="*\@<*= "
{"{ \ *@ \@ *{ @ < = @
* @{ | \ @ < " = @ \@"
@{@@\\@@@<
\* ¤;!{@"*\"*@"
* @{ @ \@ \ < @
""¾ "{ @ < <= \ *= " " ¤\
@ # { @ = \ *= = @ \@@=!^|"{
"
@ \ \@ "" * " <{ ! <
\*\{=¢{¢©\{=@\<
¢ {©{ ! < \ *= @ = !^|
"{
"
@ \ < < @ < " ¤ @ \@ { " " *
@" {
Keywords: enterocins; rabbits; beneficial effect
References
[1] Franz, CH.M.A.P., van Belkum, M., Holzapfel, W., Abriuel, H., Gálvéz, A. Diversity of enterococcal bacteriocins and
their grouping in a new classification scheme. FEMS Microbiol. Rev. 2007, 31, 293-310.
[2] Lauková, A., Chrastinová, ., PogánySimonová, M., Strompfová, V., Plachá, I., obanová, K., Formelová, Z.,
Chrenková, M., Ondruška, . Enterococcus faecium AL41:Its Enterocin M and their beneficial use in rabbits husbandry.
Probiotics and Antimicrob. Prot. 2012, 4, 243-249.
270
271
.4.%%R'%'&
$'
'1
%
(
"$
&
"
&
$
"%')
@
0
%'('!7F
%'!
,0
%'(
2

!!& '/@
7 !@ =@=@°@|"@=
°|§°
=^;<=@=;§°

{|"= "=#"=#;;<=#
~}¢¢;|

#*="=#;;<=#~}¢¢;
|

{|!};<=!¤*@!¤|

\}=<="@"@*@}={ |
@@@@"@"\}={\*
\ @= }= = @= © *= *= \
==* }= { < < ! ^@ |¢ ¢ @ < = *= " " ~!
@"{ " * \ =} *= \ == < < @ @ ""@@=<={!=
<@*^|¢"@\@=<=\@
= = <={ @" "* \@ *= ¤ }= *" " }=
<"{
|@"=@=@"||"§"<@"@"
""=@¤°<
\<{!\<<"{#@"<@
@ ° < * \@ @ §"< " || @ "|| "{ # @
<"<@@*"{!\"}\=
{\\¤@"}"\{!
@"|| "§"<@*=@°<"*
@*"@="<""
| | @"<<@\@@*@"{
!@"||"*\@@°<@@""
"="{
"#="""@@@"@"=
*
¥¦@{{{\}@@@"@"}==*
"!=@=¢«{
¥¦^@{{{""@=@==@=@
@=!!^»^¢¢{
"#§"<||
*
¥¦ } ~ °} # #} @*" # # @§ { <" @ §"<
<= { * \@ @¤ 3 #
<{#*|ª{
¥¦ }~ ^ @*" # #} °} # @@* { ~ " ==
" §"< < @ @ " < {
|"*={¢¢ª{
272
273
,&
$
&&
-$
"
&$
&
Fish and waterbirds as possible reservoirs and vectors of Vibrio cholerae
Laviad S1., Lev-Ari T1., Katzir G1., Izhaki I1. and Halpern M1,2
*B
%'/
&%'*7
%'@)
B('$('2
1
Department of Evolutionary and Environmental Biology, Faculty of Science and Science Education, University of Haifa,
Mount Carmel, Haifa, Israel,
2
Department of Biology Education, Faculty of Science and Science Education, University of Haifa, Oranim, Tivon, Israel

!@~|°|"|<=!{}¤
!;<=#*#
##*=;<=#*#

V. cholerae, the causative agent of cholera is a natural inhabitant of aquatic ecosystems where it can exist in a
free-living planktonic form or associated with copepods and chironomids. Cholera can spread rapidly, in
epidemics and pandemics, however, the mechanism that enables the bacteria to cross water bodies is still
puzzling. We hypothesized that both copepods and chironomids are dispersed by migratory waterbirds which
consume them, thus distributing the bacteria between water bodies. In addition, in the food chain, fish may link
chironomids and copepods to waterbirds. We were able to isolate V. cholerae from the intestine of several fish
and waterbird species. To further prove our hypothesis, we used cormorants (Phalacrocorax carbo) that lived in
captivity. These cormorants did not contain V. cholerae in their droppings. The conmorants were divided into
two groups and each group was fed with two different fish species; (1) Tilapia fish (Oreochromis aureus x
niloticus) that were V. cholerae positive and (2) Golden fish (Carassius auratus auratus) that did not contain the
bacteria. V. cholerae was isolated only from bird droppings that were fed with Tilapia fish. These demonstrate
that waterbirds get infected with V. cholerae when feeding on fish that are contaminated with the bacteria.
Moreover, we were able to isolate V. cholerae from the gut of four waterfowl species (black-crowned night
heron, great cormorant, little egret and black-headed gull), that were shot down by fishermen. We conclude that
waterbirds can act as long distance vectors of the bacteria and that the transfer of the bacteria to the waterbirds
may occur via fish consumption. Waterbird movements across intercontinental borders provide a possible
mechanism for the global distribution of V. cholerae.
.# "* #!^ @ "< "*" ^ @ "" @ "{
!@"@^@*@=¤\"""@
** "* { " " " @\ @ #!^ \@=**"{@¤=@*
*"@<\"\\@@@@
"#!^**{
# * " "" "" \ " ~\
\@**"\{|**¨\
@ " @ \@ #!^ \¤ " @ " " @= \ "@} \¤ { | @ ** ¨
\@"\@#!^\@@@"\
\@@@*\¤¢\¤{**"\
@\@#!^\\¤{"""""\
~!"*§|""@@=<*@¢
~! * ={@ \ " ! * =}
"$||#{@""\<*{@
*\*"\"!^#!~>!{>@
^§""!=>^!\=@\
@"{
*
#"@@*@@@"#!^**\@"
¨ { ¨ { \@ @@ * {
^#!~>! = "\@ ; < " @ " < ** ¨ {{ = "" "" "\@ ¨ { \@¨{;@\*\@*
**{ ! @=" < \ *" ^* " \@@@*\*"""""\@
"\*<{>^!==@"***\@
" ³¨ $¨{¢ @@ * ³ ¨{ $¨{ \ @ "" ""
*\@"³¨{$¨{¢@@*³¨{$¨{
\@"\@#!^{!@\@
#!^ @* * #* \ @
" "" "" \@ " { @ " \ <=\@@@"@"""""
@@@*{@*@\<=\@#!^"
" { * = #¢ \ <=
\@@"\@@@*<=\@
@"""""\@"{
4#@#!^@"@@"
""""***{"@@""@@#!^
@@@*="@{
"#
"*{**=@"
*
274
275
@
..-
$
$
Honeydew honey compared with manuka honey in the treatment of infected nonhealing wounds
C.
B'C.6'B!!
A. Mayer1, M. Horniackova2, M. Bucekova 3, V. Majtan2, J. Olejnik1 and J. Majtan2,3
*=#"#*=|"@=^@==#"!=
^"@@#\"
1
Department of Surgery, University Hospital and Faculty of Medicine, Slovak Medical University, Bratislava, Slovakia
Department of Microbiology, Faculty of Medicine, Slovak Medical University, Bratislava, Slovakia
Institute of Zoology, Slovak Academy of Sciences, Bratislava, Slovakia
2
3
< @= @*= *} *=
< @ " *= @= ||{ ! @ *}\"*="@"=<"\"\@=
\@@@"@@="<\@@={"<@@
= =|| < \ \@@ @ \@@ = = <" *{ >" " @
<*= * *} = @={ ! @ @ " \@ @= || <{ @ * @ "= * "} <= " @ @ @
@ < = \ " \@ "{ @ \¤ \
"*=@""@{
"#@=||**}
Natural products for their positive therapeutic effects are increasingly being introduced into a clinical practice.
Natural honey is one of these products that is used to treat burns and infected wounds. However, not all honeys
exhibit equal antimicrobial potency and only a few meet the criteria for clinical usage.
The aim of the present work was to carry out clinical trials with Slovak fir honeydew honey and manuka honey
to treat the long-term non-healing infected wounds (diabetic ulcers, pressure sores, etc.) as well as post-operative
infected wounds. In total of 52 patients (32 patients in honeydew honey group vs. 20 patients in manuka honey
group) we evaluated the changes of (i) the bacterial burden of the wound, (ii) the proteolytic activity of wound
exudate, and (iii) the general condition of the wound after 4 weeks treatment with a sterile honey. Furthermore,
subjective feelings of patients, an important parameter in clinical testing, was also monitored during the
treatment with honey. The average time to heal/improve the condition of the wound (wound infections
elimination) by both honeys was estimated at 18th day. In the case of manuka honey, it has been a statistically
significant reduction of the bacterial burden after 14 days of treatment in contrast to the honeydew honey, where
the observed decrease was not statistically significant. Molecular characterization of wound repair process with
respect to the inflammatory phase revealed that honeydew honey reduces the proteolytic activity of wound
exudates, at least in part, through inhibition of matrix metalloproteinase 9. One of the most mentioned sideeffects of honey treatment was transient pain. Patients evaluated the treatment with honey as satisfied with a
positive outcome. Analysis of cost-effectiveness for the treatment of non-healing wounds revealed that treatment
of wounds with manuka honey is more cost-effective than the standard treatment.
In conclusion, Slovak honeydew honey showed comparable effects to manuka honey in the term of wound
healing and it is a cheaper alternative to manuka honey.
Keywords: honey; wound healing; infected wounds
Acknowledgements: This work was supported by the Slovak Research and Development Agency under contract No.
APVV-0115-11.
276
277
@&$
$%'
$
-
@..
.
$
>
>
6.
&%
$
C.
B' !'E.!'C.6'/!'E!!
!
@%'."B%' !1%',¬
|B!(
&"B%
*=#"#*=|"@=^@==#"!=
^"@@#\"

*=#"=|"=@=; #; #;<= Ú¤
*¤ Ú¤^
=!*=#;<= Ú¤*¤ Ú¤^

" \= " @ \@ < @
= { >@ { " @= " = "<"={@@*
*""*{>@@=||=||@=
\<""*{|*@=*{=||
"@"*=*<@\*=
= { " * @= " @
<{ = \ @< @\ @ =|| *= < @@<"@"<"<*"{
\<¤\@\=||<{"<""\@
@"*@=<=={;
^@"*\@\@@"
<@(({@@=||"
\@ @ @" { @" * @ "*
@ (( < @ " " "@ ¤{ @
" < ** @ @ < " == *< "¤={|<*""*
@ = " @ * @ " =<"*=*{¤\"
="@**<
{@\¤\"*=@""@
{
"#@=||"@=@"*
"""@""@""=*=
< * " ~! { | @ * @}
*"<=@}"@"
*"@@=""@{
! @< * "} = @" }= @
"{
"==\"*"@"-
@ = - } "" "= -
<"@{
**@=@;!;-\"
@ "{ * ; \ = @* "*<<;{
\ @ * ;! ; "
=="}{|;\@
""@="@@"\""={"@"
*<-{
"#-<
278
279
In silico characterization of proteins implicated in the Dot/Icm secretion apparatus
and related virulence effectors in the fish pathogen Piscirickettsia salmonis
In vitro activity of ceftaroline against clinical isolates of Haemophilus spp. and
Moraxella catarrhalis
F. A. Gómez1, O. Arredondo-Zelada1, P. Flores-Herrera1, F. Henríquez1 and S. H. Marshall1,2.
Alberto Tenorio-Abreu, José Antonio Gómez-Fernández, Esmeralda Rodríguez-Molins, Luis Arroyo
Pedrero, Bárbara Gómez Alonso, Ana Ávila Alonso, Raúl Ortiz De Lejarazu Leonardo.
1
Laboratorio de Genética e Inmunología Molecular, Instituto de Biología, Pontificia Universidad Católica de Valparaíso,
Av. Universidad 330 Curauma, Valparaíso, Chile. PO Box: 2340025.
2
Fraunhofer Chile Research Foundation: Center For Systems Biotechnology, Av. M. Sánchez Fontecilla 310, Piso 14, Las
Condes, Santiago, Chile.
Piscirickettsia salmonis is a fish bacterial pathogen that seriously affects the salmon farming in Chile, producing
annual economic losses around US$ 200 millions. This agent is a Gram-negative bacterium, a facultative
intracellular organism, non motile and is able to infect and survive in fish macrophages. To date, relevant aspects
to P. salmonis biology and pathogenesis still unclear, but a recent report confirm the presence of four genes that
encodes structural proteins of the Dot/Icm Type IV-B Secretion System in its genome [1]. In this work, using the
recent publish genome sequences of several strains, was possible confirm and characterize all genes involved in
the Dot/Icm secretion apparatus in P. salmonis. Our work was focused in make an in silico reconstruction of the
Dot/Icm exportation machinery and describe and characterize putative Dot/Icm substrates (Virulence effectors).
To do that, the genome data of P. salmonis LF-89 (ATCC VR-1361) was submitted for annotation at the RAST
server in order to identify the genes involved in the central core of the Dot/Icm exportation complex
(Intermembrane channel and exportation pore). Additionally, the CLC Main Workbench software was used to
determine the dot/icm gene organization. Surprisingly, our results show the presences of two copies of all dot/icm
genes in P. salmonis genome, located in different genomic regions. Additionally, the two copies of each Dot/Icm
ORF are not identical between them, obtaining a difference in both nucleotide and amino acid sequences. In
Legionella pneumophila and Coxiella burnetii strains only has been described one copy of each dot/icm gene,
therefore the presence of a duplicate in P. salmonis is an intriguing mystery that have to be solved.
In order make an in silico reconstruction of the central core channel of the P. salmonis Dot/Icm system, was
made an homology modeling of the five proteins that conform them (DotG, DotH, DotC, DotF and DotC) trough
various bioinformatics servers. In all cases, all ORFs coding both copies of Dot/Icm proteins were modeled and
processed separately as two different Dot/Icm systems. In the future is needed an analysis to determine if both
systems synergist or have different functions in P. salmonis pathogenesis.
Finally, in this work also were characterized putative Dot/Icm substrates (virulence effectors), using different L.
pneumophila and C. burnetii proteins as reference. Were found 5 possible virulence effectors in P. salmonis,
which contain the conserved domains described for Dot/Icm substrates in the references organisms (Serinethreonine Kinase C, SEL-1, U-Box and ankyrine repeats). Additionally, the new P. salmonis proteins contain the
typical Dot/Icm secretion signal in the C-terminal (Block-E, negative charge, hydrophobic residues in -3 or -4
position) [2–4]. The genes that encode the 5 P. salmonis effector proteins were cloned in the pYES3-CT vector
and then transformed in Saccharomyces cerevisiae cells, in order to evaluate if the expression of these proteins
affect the viability and/or lifecycle of eukaryotic cells.
Keywords: Dot/Icm secretion system; P. salmonis; virulence effector, Dot/Icm core channel.
Introduction
Ceftaroline is a new cephalosporin with a broad spectrum activity against gram-positive and gram-negative
bacteria. Ceftaroline has been licensed in Europe for use in complicated skin- and soft tissue- infections as well
as community acquired pneumonia.
Objective
To evaluate the in vitro activity of ceftaroline against Haemophilus spp. and Moraxella catarrhalis clinical
isolates collected from respiratory infections.
A total collection of Haemophilus influenzae (n=66), Moraxella catarrhalis (n=14), and H. parainfluenzae
(n=10) was obtained from patients with respiratory infections. Only one isolate per patient was included. The
ceftaroline antimicrobial activity was assessed by determining the minimum inhibitory and bactericidal
concentration (MIC and MBC, respectively). Broth microdilution was used as the reference method using
ceftaroline powder provided by AstraZeneca. Enterococcus faecalis ATCC 29212 was included as quality
control strain. The cut-off points were those provided by the CLSI (<0.5 μg / ml = susceptible; 0.5 μg / ml =
resistant).
Results
All isolates were susceptible and showed MICs values of at least two and four two-fold dilutions lower than the
cut-off for Moraxella and Haemophilus spp., respectively. The quality control strain showed a MIC value of 0.5
μg/ml (within the expected range). Ceftaroline MIC and MBC values were equal in 54 out of 90 isolates (60%),
whereas the remaining 36 isolates showed MBCs just one two-fold dilution higher than the respective MICs. The
following table shows the ceftaroline MIC and MBC values:
Isolates (n)
MIC90
MIC50
MIC Range
MBC90
MBC50
MBC Range
H. influenzae
0,03
0,008
0,004-0,016
0,03
0,016
0,008-0,125
H. parainfluenzae
0,016
0,008
0,008-0,016
0,03
0,016
0,008-0,03
M. catarrhalis
0,125
0,06
0,06-0,125
0,125
0,125
0,06-0,125
Conclusions
Ceftaroline showed excellent in vitro activity against the microorganisms tested, displaying an inhibitory potency
of several dilutions below the susceptibility cut-off. The MIC/MBC values indicated bactericidal activity.
Therefore, ceftaroline can be considered as an alternative treatment for infections caused by these
microorganisms.
References
[1] Gómez F ., Tobar J ., Henríquez V, Sola M, Altamirano C, Marshall SH. Evidence of the presence of a functional
Dot/Icm type IV-B secretion system in the fish bacterial pathogen Piscirickettsia salmonis. PLoS One. 2013;8: e54934.
doi:10.1371/journal.pone.0054934
[2] Huang L, Boyd D, Amyot WM, Hempstead AD, Luo Z-QQ, O’Connor TJ, et al. The E Block motif is associated with
Legionella pneumophila translocated substrates. Cell Microbiol. 2011;13: 227–245. doi:10.1111/j.14625822.2010.01531.x
[3] Nagai H, Cambronne ED, Kagan JC, Amor JC, Kahn RA, Roy CR. A C-terminal translocation signal required for Dot Icm-dependent delivery of the Legionella RalF protein to host cells. Proc Natl Acad Sci U S A. 2004;102: 826–831.
doi:10.1073/pnas.0406239101
[4] Burstein D, Zusman T, Degtyar E, Viner R, Segal G, Pupko T. Genome-scale identification of Legionella pneumophila
effectors using a machine learning approach. PLoS Pathog. 2009;5: e1000508. doi:10.1371/journal.ppat.1000508
280
281
In vitro and in vivo protection against Lactococcus garviae infection by the enterocin
AS-48 producer strain Enterococcus faecalis UGRA10
.
&
Baños A2, Lorenzo-Vidaña N2, Núñez C2, Godoy RC2, García-Bonilla ML2, Perez-Martín S2, Ariza J1,
Trouerbach A2, Baños A2, Maqueda M1, Martínez-Bueno M1 and Valdivia E13

4,
&
%'3
('0!
(
^;<=@^!{ "
}
#==*=!{^! "
}

1
Departamento de Microbiología, Facultad de Ciencias, Universidad de Granada, Fuente Nueva s/n, 18071-Granada, Spain
Departamento de Microbiología y Biotecnología, DMC Research, Camino de Jayena s/n, 18620-Granada, Spain
Instituto de Biotecnología, Universidad de Granada, 18071-Granada, Spain
2
3
@@""@<§"
@"{;*""=!%{9
\"'!,{*"<{\@@@
=@""{|=
<" @ = "= @ §
\ " <\ @ @= ¸
{|\<"*==@"@}"@
={|@\"ª¢*=¢
*= 9 \"' *= % # *=
, { @ "= \ = " * @" "=
<"{ @ § \ <{ @ " ¤ \ª " <"
@ < " = @ <{ @ " " @ "*=!9,{\"}@
*=%{\@{#@\<
\@ " *" {© { @ @ = @
@"=""={
The Lactococcosis is a trout disease caused by L. garvieae. This pathology has great economic and health
relevance for the aquaculture sector in the Mediterranean countries, particularly in Spain, the leading producer of
trout in the European Union. The Lactococcosis in trout is associated with an increase in water temperature
caused by deficiencies in the quality of the water, and produces a general septicaemia with high mortality
rates (50-80% of production). The treatment of this disease requires the administration of expensive antibiotics,
which are also difficult to implement and, in many cases, ineffective due to the increasing occurrence of multiresistant strains of L. garvieae.At present, preventive measures against Lactococcosis in fish include the use of
vaccines, highly effective but also expensive, and requiring treatments that cause stress to fish. An alternative
would be the use of probiotic Lactic Acid Bacteria and their bacteriocins. AS-48 is a broad-spectrum cyclic
bacteriocin produced by Enterococcus species which is currently being tested against several bacterial pathogens.
Recently we have isolated an AS-48 producing strain, E. faecalis UGRA10 [1], on which an extensive study of
their functional, biosafety and probiotic characteristics is being conducted. The present study aims to evaluate the
in vitro antimicrobial effects of UGRA10 strain and enterocin AS-48 against pathogenic strains of L. garvieae
and the in vivo effectiveness of both, strain and bacteriocin, to protect zebrafish (Danio rerio) and rainbow trout
(Oncorhynchus mykiss) against this pathogen.
To evaluate the in vitro antimicrobial activity, well diffusion assays were used to provide semi-quantitative
measures of antibacterial activity, and Minimum Bactericidal Concentrations (MBC) were determined by micro
dilution assay. Furthermore, AS-48 lethal dose curves for each strain of L. garviae, at different enterocin
concentrations (100, 50 and 25 μg/ml), were performed. In addition cocultures of UGRA10 and the pathogenic
lactococci, containing different concentration ratios of both type of bacteria, were prepared in BHI broth at 25ºC,
determining the pathogen evolution in time. The results showed the high effectiveness of AS-48 in controlling L.
garviae, with a MBC average value of 45.3 μg/ml. Likewise, the presence of UGRA10 in cocultures significantly
managed the pathogen and differences up to 6 log units in lactococci counts of cocultures, were achieved
compared with control cultures of L. garviae.
"#@³
*
¥¦##¹}!!{"={|ª{
¥¦@#Ð{@=="{#*|ª
{
In vivo experiments were conducted with 60 zebrafish divided into three tanks (20 animals per tank) which were
experimentally infected with L. garviae (by incorporating the pathogen in water at a concentration of 107 cfu/ml).
Afterward, one group received AS-48 (2 μg/ml) in the water, another group received an inoculum of UGRA10
(to a final concentration in the water of 2.5 x 106 cfu/ml) and a third group had no treatment (control). Regularly,
the concentration of L. garviae and UGRA10 was quantified in the water and the cumulative mortality was
recorded for each group. Another study was carried out with rainbow trout (average weight of 20 g), obtained
from a commercial fish farm. In this case, the trouts were infected intraperitoneally with L. garviae (108 cfu). A
first group received L. garviae and AS-48 solution (100 μg) intraperitoneally, a second group was infected
periodically (every 3 days) and received a bath during 30 minutes with a solution of AS-48 (2 μg/ml) and a third
group didn’t receive any treatment (control) During the following 10 days mortality was recorded for each group.
In both models, the results showed a protective effect of AS-48 when intraperitoneally administered as well as by
dipping bath, with reductions in the mortality rates of 50-70%. The results indicate the protective effect of
UGRA10 and AS-48 and the potential of these new natural products to replace antibiotics for controlling
emerging diseases in aquaculture species.
Keywords: Lactococcus garviae; trout; Enterococcus faecalis; enterocin AS-48
References
[1] Cebrián, R., Baños, A., Valdivia, E., Pérez-Pulido, R. Martínez-Bueno, M., & Maqueda, M. (2012). Characterization of
functional, safety, and probiotic properties of Enterococcus faecalis UGRA10, a new AS-48-producer strain. Food
Microbiology, 30, 59–67.
Acknowledgement: Piscifactorías Andaluzas S.L., Spain.
282
283
Introducing Clinical Microbiology to secondary school science teachers in
Catalonia
.
A
&
"
'.!
'/
Javier Méndez1 and Josep Maria Fernández2
1
&&'*4%')B
/'7/%'>1'@.%'>B'.2B
'@.%'B'.('/"B"
' %G$'>%
2

Fermentation Unit, Faculty of Biology, University of Barcelona, Av. Diagonal, 643, 08028 Barcelona, Spain
Department of Biochemistry and Molecular Biology, Faculty of Biology, University of Barcelona, Av. Diagonal, 643,
08028 Barcelona, Spain
#*=|;<=>\~
!<=|;<=>\~{
~"!<|¤¤"">\|~

To bring biochemistry and microbiology close to secondary school level the Department of Biochemistry and
Molecular Biology and the Fermentation Unit at University of Barcelona have designed a course oriented to
biology secondary school teachers. The aim of the 2014 course “Microorganisms and Clinical Microbiology,
Microorganismes i Microbiologia Clínica” is to contribute to the improvement of the biochemical and
microbiological fields amongst the secondary school teachers and as a result promote the scientific vocation
among their students.
!"=@",#\@*>\\
" @ < @ " "{
$"=@@<\*"*==\
"{ >" @ @" <= " \ {© \ \@ , # @
< \ @@ {© \ *\ @ ={ @ <
{© \ " \ " {© " \ {¢©{#
{© @ \ \ ={ , # " {© " @
\{^<{©\\{@@"*@@
@"@|@"{|
= { @" * "= < = @ " @@"\@@¤"<=<"@=@{
This course, basically, comprised three practical sessions:
1. - General culture conditions and viability estimated by microscopy counting. Gram’s method of staining
bacteria, the gram-staining characteristics of bacteria are denoted as positive or negative, depending upon
whether the bacteria take up and retain the crystal violet stain or not.
2. - Antibiotics, this session contained a short history of antibiotic discovery and development, how antibiotics
work and how they are used in clinical and biotechnological fields. The practice work included two antibiogram
on Mueller-Hinton agar and the determination of the minimum inhibitory concentration (MIC) for Escherichia
coli and Bacillus mycoides.
"ª@!=^};;{
3. - Prodigiosin production by Serratia marcescens. This bacterium was chosen because it allowed us to introduce
some concepts like biological marker, opportunistic pathogen and quorum sensing. In addition, prodigiosin
exhibits some antibacterial, immune-suppressive and antiproliferative activities. It extraction was carried out
with acetone in two different temperatures, 30°C and 37°C. Finally, a qualitative assessment by
spectrophotometry was done.
Participants have been surveyed about the course interest and the secondary school teachers’ feedback has been
extremely encouraging.
Keywords: Secondary school teacher; Microbiology, Antibiotics, Biochemistry.
284
285
&
"6
Middle East Respiratory Syndrome Coronavirus infections in Iran from 2013-2015
!*%'E4,!
%'('! %'('0@
!('4 %
Jila Yavarian, Azadeh Shadab, Talat Mokhtari Azad

|"@;<^";~|^!<{! "¹«^}

^!@;<=;~|!~|!{"^"¹«^}
Virology Department, School of Public Health, Tehran University of Medical Sciences, Porsina st, Tehran, Iran, Postal
code: 14155-6446
@"}*¢@@"
@= *= \ {{ @ <" " * "@ \
<<*@{@=*<@
{|\@=@"@*¤*@<*
@"*@@\<@@=¤\
\@@@¤*=@@
=*\@@*@¾¤{@@"=\<"@*
*@ @ *\ @ < @=
@* @ { @ "= @ \ \@ \* @ ¾
*¤{ \ @ #*= *= ;~|^ " "¹^ } *
\@*={=""*=*
\*=@@"{@"=@@¤
@* *= < * "{ >" < @@ <" <*= *\ { < < \ "
" 9! { @ * < <
*=@@\<{@\
*\@@=\@@@<\@\@
@@= { | } * " \ " @ *= \@ < @={ | @ @ @ ¤ " <<
<*@¤\*"@
*@<"@<\*"*@{
Human infection with a newly identified coronavirus named Middle East Respiratory Syndrome (MERS-CoV)
was reported in Saudi Arabia in 2012. Up to 20 June 2015, 1334 confirmed cases of MERS-CoV have been
reported to the WHO. We report the virological and epidemiological data of MERS-CoV infections in Iran from
2013-2015. From January 2013 until 15 Feb 2015, more than 2000 samples were tested by Real time RT-PCR
assay for detection of MERS-CoV. During this period six patients were positive for MERS-CoV in 2014 and
2015. The first patient was hospitalized on 11 May 2014 and died 18 days later. The second patient was her sister
which survived without complication. Two other patients with complete recovery were health care workers
which had contact with the first case. The fifth patient with history of chronic respiratory disease passed away on
5 July. The sixth patient was detected in 28 March 2015 and discharged from hospital on 27 April. There was no
history of travel or contact with animals and consumption of raw camel products in the 14 days prior to
becoming ill in these patients. All close contacts of the mentioned cases, including family members, other
patients in the hospital were negative for MERS-CoV infection in contact investigation. For better understanding
about the route of transmission, the ability of causing illness among close contacts, epidemiologic features,
prevalence in the community, pathogenesis and risk factors, active contact tracing, enhanced surveillance and
searches for the animal host and route of transmission is recommended.
Keywords: MERS-CoV; Iran
"#¤*<{
*
¥¦!|~^{!®|ç^"^{@ª*{{*{
¥¦;{{=ª@{!{<{{{¢¢{
¥¦$;|~~^{{!#{{#!°³{! {{{=#*={ ª
{{
286
287
Molecular characterization of Carnivore protoparvovirus-1 in wild carnivores in
Spain reveals wide host range and cross-species transmission
$
)$
$
$
/
Javier Millán1, Olga Calatayud2, 3, 4, Roser Velarde5, Emilio J. García6, Álvaro Oleaga7, 8, Luis Llaneza6, 9,
José Vicente López-Bao10,11, Vicente Palacios6, Ana de la Torre2, Alejandro Rodríguez12, Fernando
Esperón2
B
!
F
"
1
¤"ª9@=@"
*{
#*="=>*!\\;<=||~
Facultad de Ecología y Recursos Naturales, Universidad Andres Bello, Av. República 252, Santiago, Chile.
Animal Health Research Centre INIA-CISA, Ctra. Algete a El Casar, 28130, Madrid, Spain.
Institute of Zoology, Zoological Society of London, Regent’s Park, London, UK.
4
The Royal Veterinary College, Royal College Street, London, UK.
5
Servei d’Ecopatologia de Fauna Salvatge (SEFaS), Departament de Medicina i Cirurgia Animals, Universitat Autònoma de
Barcelona, 08193 Bellaterra, Spain.
6
A.RE.NA. Asesores en Recursos Naturales SL, Perpetuo Socorro 12-Entresuelo 2B, 27003, Lugo, Spain.
7
SERPA, Sociedad de Servicios del Principado de Asturias S.A., 33203 Gijón, Asturias, Spain.
8
Instituto de Investigación en Recursos Cinegéticos (IREC), CSIC-UCLM-JCCM, Ronda de Toledo s/n, 13071 Ciudad Real,
Spain.
9
Departamento de Bioloxía Celular e Ecoloxía, University of Santiago de Compostela. Campus Sur, 15782, Santiago de
Compostela, Spain.
10
Research Unit of Biodiversity (UO/CSIC/PA), Oviedo University, Mieres, Spain.
11
Grimsö Wildlife Research Station, Swedish University of Agricultural Sciences (SLU), Riddarhyttan, Sweden.
12
Department of Conservation Biology, Estación Biológica de Doñana, CSIC, Américo Vespucio s/n, 41092 Sevilla, Spain.
2
3
Spleen samples collected in 1994–2013 in Spain from 213 wild carnivores belonging to five different families
were analysed using real time PCR. Canine protoparvovirus-1 infection was confirmed in 18% of samples,
chiefly in wolves (Canis lupus). Nearly all of the VP2 gene in the 19 positive cases was sequenced and 15
different nucleotide sequence types, clustered into eight amino-acid sequence types (aaSTs), were detected. Most
were identical or closely related to sequences previously found in domestic and captive animals. Fifteen isolates
including five aaSTs corresponded to the canine parvovirus (CPV) 2c, which was identified in the majority of the
wolves and badgers (Meles meles) analyzed, as well as in a genet (Genetta genetta) and a wildcat (Felis
silvestris), the latter animal sampled before this strain had been detected in dogs in Spain. Identical CPV-2c
sequences were found in five individuals belonging to three different families sampled in 2001–2013 in two
distant regions. Sequences from three wolves corresponding to CPV-2b clustered near the CPV-2c group into a
phylogenetic group that includes sequences from a stone marten (Martes foina) from Portugal and North
American carnivores, which provides further evidence for the existence of an intermediate clade between CPV2b and CPV-2c. CPV-2b infection was confirmed in a fox (Vulpes vulpes) and probably in a stone marten; as
well, the feline panleukopenia virus was detected in a stone marten, a badger and probably in a genet. Our
findings expand the range of hosts for parvoviruses, reveal the predominance of CPV-2c among European
wildlife, and confirm that virus transmission occurs between wild and domestic carnivores.
>*§<ª@ @ "= \= 9 " "
@@ " || ~ @ ~!
<""*9{
#@ª|$\"#¤={|\
" @"{ !* <= \ " °*="¸ " @{
^ ~! \ *= ¤ = ¬ # <" \ *= ^{ ! {© 9 \ " \@@ {¢© \
"*#!{*<={@@\@@
" {© = {©{ @ \ <= @ #! \@ *=\@@\*{@"@=#!
@*"*¢*{@¢{¢©@@¬*
* \@ {¢© @*" * { \< # * \ =@{
"ª@#!9@"=@@@@
<=\@@@"{
Keywords: Carnivora, FPLV, Iberian Peninsula, Parvoviridae, phylogenetic network
288
289
Phosphorylation of Giardia lamblia End-binding 1 Protein by Aurora Kinase
Juri Kim and Soon-Jung Park
Department of Environmental Medical Biology and Institute of Tropical Medicine, Brain Korea 21 PLUS Project for
Medical Science, Yonsei University College of Medicine, Seoul, 120-752, South Korea
Postoperative infections associated with semiautomatic retractors O'Sullivan O'
Connors, Balfour and Soriano
Ángel R Soriano – Sánchez 1, Armando Ahued - Ortega2, Eleuterio Ortiz - Cruz3
1
Gineco obstétra, General Hospital Iztapalapa, Health Ministery, Government of Federal District, Mexico.
Secretary of Health Ministery, Government of Federal District, Mexico.
Director, General Hospital Iztapalapa, Health Ministery, Government of Federal District, Mexico.
2
Giardia lamblia is a parasitic pathogen causes diarrheal diseases, and is an interesting organism with a distinct
polarity. However, its cell division is poorly understood at cellular and molecular levels. Previously studies
indicate that G. lamblia end-binding 1 (GlEB1) and G. lamblia aurora kinase (GlAK) modulate microtubule
(MT) during cytokinesis. In this study, direct association between GlEB1 and GlAK were demonstrated via coimmunoprecipitation and GST pull-down experiments. Like GlEB1, GlAK was also found at the nuclear
envelopes and the median bodies of G. lamblia at an interphase. In vitro-kinase assays using immunoprecipitated
Giardia lysates with anti-GlAK antibodies or recombinant GlAK demonstrated that EB1 is a substrate of GlAK.
Site-directed mutagenesis demonstrated that Thr-205 of GlAK is the amino acid residue of autophosphorylation,
and GlAK phosphorylates a Ser-148 residue in linker region of GIEB1. Ectopic expression of a mutant GlEB1
(with conversion of Ser into Ala at the 148th residue of GlEB1) resulted in increased number of Giardia cells
with mitotic defects. These results demonstrate that phosphorylation of GlEB1 by GlAK plays a role in
cytokinesis through controlling MT distribution during Giardia cell cycle.
3
Background: The usefulness of semiautomatic retractors is limited and it´s related to postoperative infections.
Preventive measures and infection prophylactic antibiotics have reduced the incidence of bacterial, fungal and
viral postsurgical infections, but infections have not been eradicated.
Aim: To evaluate the usefulness of semiautomatic retractors in surgery and identify their relationship with
postoperative infections made via abdominal and pelvic.
Material and methods: Prospective, longitudinal, exploratory and form, structure and design of semiautomatic
retractors was revised.
Sample: One hundred patients with surgery; 18 vaginal, 82 abdominal.
Result: The joint, dislocation, placement and removal of the retractor Soriano was satisfactory in 98 surgeries
and vaginal surgery, one obstetrician was enough.
This retractor reduces the duration of the surgical event, blood loss, and amount of anesthetics. Among the joints
and control system of retractors O' Sullivan O´ Connors and Balfour can stay detritus with bacteria and fungi.
Measures to prevent postoperative infections were insufficient.
Conclusions: Soriano retractor is useful in 98% of patients and contributed to decrease the duration of surgery,
use amount of bleeding and anesthetic drugs. Among the joint spaces retractors O'Sullivan O' Connors and
Balfour sterilization is limited and the detritus hosted contains blood, bacteria and viruses that can cause
postoperative infections.
290
291
&
$
&
#
$
$$
6)/
#!4
<<
!*
@$'!
$@$6
B@3@$
6*
'
,
/E
@%4.6
*%' 41
78
%'7
6%'*/Y
%'0
"&
(77E
=%

#""¹"#=;<
#@~¶{^{°{{{#º"^¹*
{^{#@¶#º

!<{|"^º~{^{^{¢#º{{!ª
#º{{
!4<%'7
.&
6
("%
@ @= < @ "" * @ "<"{"@""*@@
{ | @ \¤ \ @ *@ * * "* *< @ \ "*§ "
@}*="""=#={|<""=\"@@
<\@"="*"¢
==*<<¤{@\<\"
\@ "*" = \@ "=" @
"¥¦{|@==@"*
<*\"@*@@<¤
\\={*@\\@°\¤¥¦{
\ @ # @ \@ # # @{ \
=} @ *¤"{ *= " \
@ *@{ ! = \ { #" @
=\<"*"¢{~*@
\ "*" { @ = *@
~!\@@}=-(((M(<{"
@ }= " @ ;^ #! @ ^=@ < ¥¦ \@ ={ < =
"\"@=={\¤="\"
*@{@{{={|@"
@*"§="# !¢\¥¦<§@="{>"
<@@="\*@{!*"
@\@@""@=*@{!@}
@=@="*@=\@@!^=
@=@=!~"
* \ { ( = @ " = "
@= " < * =@ \@ }= ,:( -((( ( 1({^^=\@@}=\<=@"={|"
@"==\@"@\"<*@
@ § *¤" < @ { @ @ *@
* " = " " "
=¥¦*@<{
#@""¤=@
< " "* @ ! @ \ @ <"*{
<<@**@"=
"{\<*"\@@=@§
"@*@@**"\
{@*"@**@
@ @ @ ** ={ @ * ¤ @ * \ " *= @¤ @ "= #" =
*= @ # @ \ " @ *¤ *= @
<" \@@ @ \ ¤ @ @ \ " @
@= *{ @ \ " {© * " ¢ @ @
\@@\@§@!@{@"*@
@ ¢{© < \ " ¢ @
<\{!@<@"=\"^{
"{@\*=@"\@@¤@={|
*"@"=@@¤
* @ {@ " *" @ =@= { |
=*<=¤="=*\@
"@*@"*<{

#*=@#°\~¤"@;<=
@=°" @
"="= @{

"#*@@==
*
¥¦!!º{{<=!";#~¢ª
{
¥¦°\¤{{!@{{ª{
¥¦^<{{#ª{
¥¦"{{#{{<{ª{
¥¦{{}@@{ª¢{
292
293
Prevalence of rotavirus and adenovirus associated with diarrhea among displaced
communities in Khartoum, Sudan
Public health implications and risk factors assessment of Mycobacterium bovis
infections among abattoir personnel in Bauchi State, Nigeria
Wafa I Elhag1,*, Humodi A Saeed2, El Fadhil E Omer1 and Abdelwahid S Ali3
1
1
Department of Microbiology, Faculty of Medical Laboratory Sciences, Al Neelain University, Khartoum, Sudan.
Department of Microbiology, College of Medical Laboratory Sciences, Sudan University of Science and Technology,
Khartoum, Sudan.
3
Faculty of Medicine, King Khalid University, Riyadh, Saudi Arabia.
2
Background: Diarrheal diseases represent a major worldwide public health problem particularly in developing
countries. Each year, at least four million children under five years of age die from diarrhea. Rotavirus, enteric
adenovirus and some bacterial species are the most common identified infectious agents responsible for diarrhea
in young children worldwide. This study was conducted to determine prevalence of rotavirus and adenovirus
associated with diarrhea among displaced communities in Khartoum state, Sudan.
Methods: A total of seven hundred and ten patients, children and adults, suffering from diarrhea were examined.
The clinical history, socio-demographic characteristics, physical examination findings and laboratory
investigations were recorded. Stool samples or rectal swabs were collected and tested for rotavirus and
adenovirus antigens using the immuno-chromatography test (ICT). Characterization of the identified Rotaviruses,
as a major cause of diarrhea, was then made using real time-reverse transcription PCR. To make the study legal,
an ethical clearance was obtained from Sudan Ministry of health- Research Ethical Committee. Written consent
was taken from adult subjects, and also from children mothers.
The participants were informed using simple language about the infection, aim of the research and the benefits of
the study.
Results: Out of the 710 patients, viral pathogens were detected in only 99 cases (13.9%). Of the 99 cases of viral
diarrhea, 83 (83.8%) were due to rotaviruses while 16 (16.2%) attributed to adenovirus. Of the 83 rotaviruses
identified, 42 were characterized by RT-PCR, of these 40 (95.2%) were proved as type A (VP6), and 2 (4.8%)
type C (VP7). Type C (VP7) rotavirus was detected in samples collected from children under 5years only.
5
A. S. Sa’idu, 1 E. C. Okolocha, 1 A. A. Dzikwi, 3A. A. Gamawa, 4 S. Ibrahim, 1 J. K. P. Kwaga, 2 A. Usman,
S. A. Maigari
1
Department of Veterinary Public Health and Preventive Medicine, Ahmadu Bello University, P.M.B. 1013, Zaria 2222,
Kaduna State, Nigeria.
TB-Laboratory,Department of Veterinary Medicine, Faculty of Veterinary Medicine, Ahmadu Bello University, P.M.B.
1013, Zaria 2222, Kaduna State, Nigeria.
3
Area Veterinary Clinic (Kofar Ran), Ministry of Animal Resources and Normadic Resettlement, Bauchi State, Nigeria.
4
Department of Veterinary Medicine, Faculty of Veterinary Medicine, Ahmadu Bello University, P.M.B. 1013, Zaria 2222,
Kaduna State, Nigeria.
5
University of Maiduguri Teaching Hospital, P.M.B., 1069, Maiduguri, Borno State, Nigeria.
2
Bovine tuberculosis (bTB) is a chronic infectious and contagious zoonotic disease of domestic animals, wild
animals and humans. It poses a public health threat and economic losses due to abattoir condemnation of infected
carcasse during meat inspection of slaughtered animals. Bovine tuberculosis is widespread in Africa including N
igeria affecting both cattle and humans, particularly, the Northern Nigeria. A prospective survey was conducted
from June to August 2013in the three zonal abattoirs of Bauchi State, Nigeria. A total of 150 structured
close ended questionnaires were administered to abattoir personnel to assess their level of awareness of
bTB. This study was aimed at determining the level of Public health awareness, attitude and practices of
abattoir workers of bTB in Bauchi State, Nigeria. There was a statistically signifycant association between
respodents’ awareness of bTB and their occupational status, age and duration of exposure to cattle carcasses
(p<0.05), the odds of being aware of bTB were: 9.4, 7.3, and 2.1 respectively. In conclusion, these demonstrate
the urgent need for public health authorities to intervene in bTB control. The risk of bTB transmission as
indicated by the personnel’s practices and awareness levels in Bauchi State could be prevented through the use of
protective clothing (PPEs).
Keywords: Abattoir staff; Bauchi; Infection; Mycobacterium bovis; Public Health; Zoonotic risk.
Conclusions: In conclusion, most cases of viral diarrhea are found to be caused by rotavirus especially among
children less than five years. Most of the identified rotavirus belonged to type A (VP6).
It was also evident that most patients are those who drank untreated water obtained from donkey carts source and
who had no access to latrines, and lived in poor environmental conditions would acquire diarrheal infection.
Keywords: Diarrhea, Rotavirus, Adenovirus, PCR, Displaced camps, Khartoum
294
295
*
&$
%
$
-%$
$
*
-&&B
4
-"
""
<¨«%'/4
B('A
('6"!
"B(')"/"B(
!8
%'*!8
%'77E
=(,,8
0%

*=#"=|"=@=;<= Ú¤#
;\= Ú¤*¤ Ú¤^

*=*|"=@=;<= Ú¤#
;<= Ú¤°¤ Ú¤^
*#*¹ "~|"^º~{=
^!={^{#º{
#""¹"#=;<
#@~¶{^{°{{{#º"^¹*
{^{#@¶#º{

@"}<"@"@\*<*\\"
@@ <= *={ < < < " <" @{
=<*<\@<@*="@""}
*@"!"~!{\<*="=
<*"<"{=@@
" <" " " < \@ < "{ "}*"="<"{
|"}<"==@=@<*@\""}!
<" @ "} ! <" @{ } <=
<<"@@"~^@#**"
@"*="=*\"*=@<"{|@*}@=¤=
"}<"*="@"@{
"<*\@@"{*=
=<"@;@}{@
<@"*@"
@""\@@{|""="@
\"""}<"#@"{
#\"\*=@"*=
@"*{@"=*\*=
{ ! < *= |~ò |^> = "
"{
. # = " @ * < { \< @@=\{.#@*¢©
=@@=\@©¥¦{"@
! ¥¦ @ * *< " *= @ ~" ¥¦{
!@ . # < @ * @ "
<"{\@{¥¦@=@*=
**\@{|\¤\@*@@
@ @ @= @{ | @ \¤ \
<"@@<@*"*@
# \{ = . # @ *@ \
\@¨¨¢{\"!~"
. # *@ \ <"= ¥¦{ !@ \
* { ¥¢¦{ != \ " @< @
\@@\@"**@£
££ ¢ £££ ²{ *= \ \@ { ¥¦{ *\ @ < @ < \ " \@ ¬
=*@{¤<*"**=\
\@>\{~=\*<@
*\{@*"@""="<"
¤ < * @{ @" \ @ @ " @ " * " ¤ "@ @ * *={ < @ \
*<"Ë{\@\££££££{
¤*©©|{{¤<£££££
>{©|{¢{{=\=*\
@@Ñ{©¢{Ñ{@@<*<""Ë{{>"
""@@<@**==*¤
<"@.#@@=@{
\@

Microbiology of food and animal feed

Transcripción

Documentos relacionados

Spain

Erratum to