libro de resúmenes

Comentarios

Transcripción

libro de resúmenes
ϭ
VIII Reunión Chilena de Investigación Antártica
VIII Chilean Meeting on Antarctic Research
LIBRO DE RESÚMENES
En orden alfabético
Ϯ
IV Simposio Latinoamericano de Investigación Antártica
VIII Reunión Chilena de Investigación Antártica
Comisión organizadora
Coordinador Instituto Antártico Chileno
Dr. Marcelo Leppe Cartes
Ing. Carla Gimpel
José Ojeda Santana
Comisión editorial
Dr. León Bravo
Dr. Marcelo Leppe Cartes
Diseño
Pablo Ruiz
Diagramación
Depto. de Comunicaciones
Diseño y editado en el Instituto Antártico Chileno
Plaza Benjamín Muñoz Gamero Nº 1055
Punta Arenas-Chile
INACH-2011
ϯ
Antártica: Un horizonte no tan lejano
Hace dos mil años Lucio Anneo Séneca (4 a. C. - 65 d. C.) en su obra Cuestiones Naturales
sentenció: “Llegará un tiempo en el que una investigación minuciosa y prolongada sacará a
la luz cosas que hoy están en la oscuridad. La vida de una sola persona, aunque estuviera
toda ella dedicada al cielo, sería insuficiente para investigar un tema tan vasto. Por lo tanto,
el conocimiento sólo se podrá desarrollar a lo largo de sucesivas edades. Llegará una época
en la que nuestra descendencia se asombrará de que ignoráramos cosas que para ellos son
tan evidentes. Muchos son los descubrimientos reservados para las épocas venideras,
cuando ya se haya borrado el recuerdo de nosotros. Nuestro universo sería una cosa muy
limitada si no ofreciera a cada edad algo que investigar. La naturaleza no revela sus
misterios de una vez y para siempre…”.
Resulta inquietante vivenciar, dos milenios después, la misma inconmensurable sensación
de misterio, curiosidad y fascinación frente a un continente como la Antártica. Todas y cada
una de las sentencias que Séneca hace respecto de la investigación de la naturaleza aplican,
casi sin corrección, al llamado Sexto Continente.
La exploración antártica ha pasado por diversas etapas, que han construido en el imaginario
colectivo la idea de un continente blanco inmaculado, estéril y riguroso, severo y hostil,
idea que hace mirar con una mezcla de admiración e incomprensión a los científicos que se
aventuran a plantar sus hipótesis (en vez de banderas de conquista) en esa mezcla de roca y
hielo. Sin embargo, esta febril actividad científica, concentrada en un 90% en la temporada
estival, está cambiando dramáticamente esa monolítica idea de Antártica. Los provocadores
resultados de las investigaciones llevadas a cabo durante los últimos 50 años han permitido
reconstruir una historia, develar una exuberante diversidad biológica y poner en valor las
exquisitas adaptaciones que la evolución ha producido en respuesta a un ambiente muy
poco propicio para la vida… al menos como la entendíamos.
La flora antártica en actualidad se encuentra dominada por criptógamas (algas, líquenes y
musgos), la mayoría de las cuales sólo crecen en zonas descubiertas de hielo al norte de los
65º S. Sólo crecen en forma nativa dos especies de plantas vasculares, la gramínea
Deschampsia antarctica y la cariofilácea Colobanthus quitensis. Sin embargo, la pobrísima
diversidad biológica observada en las plantas antárticas contrasta con la riqueza del registro
fósil. Bosques muy diversos, dominados por coníferas (mañíos, cipreses, araucarias y
cycadales) y plantas con flores (Angiospermas) habitaron la Antártica de la Era de los
ϰ
dinosaurios y solo la abandonaron para siempre hace unos 5 millones de años. En efecto,
recientemente se han realizado espectaculares hallazgos a 500 km del Polo Sur, en la
Formación Meyer Desert, una interesante biota de Nothofagus (con 9 especies arbóreas en
Chile), Ranunculus (con más de 25 especies en Chile) y Cyperaceae (con 120 especies en
Chile), interpretada como flora periglaciar de tundra, con insectos, moluscos e incluso un
vertebrado. Este hallazgo, de flora con elementos comunes a la flora de Chile y muy afín a
los ambientes de valles glaciares de Tierra del Fuego, nos obliga a replantearnos las ideas
acerca de cuándo y cómo desaparecieron los ambientes boscosos de Antártica. Hasta ahora
se pensaba que había sido alrededor de los 30 a 20 millones de años, lapso de tiempo que
siguió a la desconexión de Sudamérica y Antártica y que se caracterizó por crecientes
descensos de temperatura ambiental. Pero la flora miocénica de Meyer desert y los Dry
Valleys nos obligan a comprender que las ideas que tenemos acerca de los extremos a los
que sobrevive la vida están siempre cambiando.
Sea cual fuere la forma en que llegaron a la Antártica, estos organismos exhiben en la
actualidad una serie de adaptaciones para resistir la congelación y la intensa radiación UV
que se ha incrementado en las últimas décadas por el “Agujero de Ozono” antártico. El
medio antártico es paradójicamente seco, pues el agua dulce se encuentra en un estado
físico poco amable para la vida: hielo. Para las células vegetales, cuyos protoplastos están
principalmente constituidos por agua, la nucleación de cristales de hielo en su interior
produce la muerte celular, tal como ocurre con los cultivos ante las temidas heladas. Pues
bien, Deschampsia ha desarrollado mecanismos fisiológicos para evitar la formación de
cristales en sus células, a través de la expresión de proteínas anticongelantes y
crioprotectoras. A pesar de que hasta ahora no se les ha podido reproducir en laboratorio de
forma sexual, estas plantas se encuentran expandiendo su distribución ante el nuevo
escenario de cambio global, demostrando su enorme potencial colonizador. Son estas
adaptaciones también un singular reservorio de “respuestas” para problemas que aquejan a
la humanidad, que son decodificadas por la biología molecular y presentadas a la sociedad
a la forma de anticongelantes, detoxificantes y descontaminantes que funcionan a bajas
temperaturas, drogas anticancerígenas, protectores UV, antibióticos, etc.
El amor a una idea de inmutabilidad climática o a la estabilidad ha sido otro de los
preconceptos derribados a la luz de las evidencias entregadas por los testigos de hielo y
sedimentos obtenidos de la Antártica. Está profundamente enraizado en nuestra cultura, la
idea de una Antártica blanca, monolítica y fría, inmensa e inmutable, eterna y sepulcral...
Pero de nuevo las evidencias científicas vienen a golpearnos el rostro, obligándonos a
cuestionarnos y a cambiar viejos paradigmas.
ϱ
Para las entidades que financian investigación científica y tecnológica, la comprensión de la
estrecha relación entre Sudamérica y Antártica resulta un ejemplo clásico de lo que ha
denominado “el rol social de la ciencia”, pues el entendimiento de los procesos que
gobiernan el clima antártico, la dinámica de sus hielos y las corrientes marinas, ya no tan
solo como un indicador de cambio, se entienden como un modulador del clima mundial, y
en particular, del Cono Sur sudamericano. Fenómenos como la pluviosidad, temperatura
media, stocks de recursos marinos, salinidad se verán alterados en mayor o menor medida,
dependiendo de cómo cambie de la Antártica, y solo la ciencia ayudará a los tomadores de
decisiones a vislumbrar los efectos. Para que la ciencia latinoamericana tenga esa
trascendencia, solo existe el camino de la concursabilidad, la revisión por pares, la
validación en revistas de corriente principal, la cooperación internacional y el fomento a la
inserción de jóvenes investigadores, a través de programas de pre y postgrado que faciliten
el camino hacia la investigación científica de calidad.
Hoy, más que nunca, estamos más cerca que lejos de cumplir el viejo axioma de Séneca y
en nuestras manos se encuentra la oportunidad de tornar como nuestro nuevo norte al
Continente Blanco.
ϲ
ÍNDICE
Aguayo-Lobo, A., Acevedo, J., Brito, J.L., Acuña, P., Bassoi, M., Secchi, E.
& Dalla-Rosa, L. ……………………………………………………………….………… 15
PRESENCIA DE LA FOCA LEOPARDO, HYDRURGA LEPTONYX (DE
BLAINVILLE, 1820), EN LA COSTA DE CHILE: EJEMPLO DE UNA
CONEXIÓN, EN EL AMBIENTE MARINO, DE LA ANTÁRTICA Y AMÉRICA
DEL SUR
Alvarado, G., Díaz-Ochoa, J., Huerta, K. & Rodrigo, C. …………………………….….. 19
DISTRIBUCIÓN ESPACIAL Y TEMPORAL DE ZOOPLANCTON MEDIANTE
ANÁLISIS DE CPR (CONTINUOUS PLANKTON RECORDER) EN EL PASO
DRAKE: RESULTADOS PRELIMINARES
Amenábar, M. J., Flores, P. A., Pugin, B., Boehmwald, F. D. & Blamey, J. M …...….… 22
ANÁLISIS CULTIVO-INDEPENDIENTE Y CULTIVO-DEPENDIENTE DE
MUESTRAS SUBMARINAS PROVENIENTES DE SITIOS HIDROTERMALES
DE ISLA DECEPCIÓN, ANTÁRTICA
Arriagada A. M. & Baessolo L. A. …………………………………………..…..……….. 24
RECONSTRUCCIÓN DE AREAS ANCESTRALES EN ESPECIES ACTUALES DE
LA FAMILIA SPHENISCIDAE
Bascuñán-Godoy, L., Bravo L. A. & Corcuera L. J. ………………….…...…….……….. 28
RESISTENCIA Y CAPACIDAD DE RECUPERACIÓN A LA FOTOINHIBICIÓN
INDUCIDA POR FRÍO EN LOS ECOTIPOS ANDINO Y ANTÁRTICO DE
COLOBANTHUS QUITENSIS (KUNTH) BARTL. (CARIOPHYLLACEAE)
Bastias, J., Hervé, F., Aguirre, L., Demant, A., Fonseca, E.,
Torres, T. & Michea, W………………………………………………...…………...….… 33
MINERALOGIA DE ALTERACION DE MUY BAJO GRADO EN LA SUCESION
VOLCANICA DEL CRETACICO SUPERIOR EN PUNTA HANNAH, ISLAS
SHETLANDS del SUR, ANTARTICA
Berríos, G., Bizama, C., Cabrera, G., Gidekel, M. & Gutiérrez, A. ……….….…………. 39
INTERACCIÓN MOLECULAR PLANTA- MICROORGANISMOS
ANTÁRTICOS: Arabidopsis thaliana - Pseudomonas sp.
Bobadilla, H. F., Calderón, M., Hervé, F. & Fanning, C. M. ………………………..…… 42
NUEVOS ANTECEDENTES GEOQUÍMICOS PARA INTERPRETACIONES
PETROGENÉTICAS DEL BATOLITO DE LA PENINSULA ANTÁRTICA,
EXTREMO NORTE DE LA PENÍNSULA ANTÁRTICA
Bravo, L. A., Bascuñán-Godoy, Pérez-Torres E., & Corcuera L. J. …….…………….…. 46
ECOFISIOLOGÍA DE LAS PLANTAS VASCULARES ANTÁRTICAS: DOS
ESTRATEGIAS PARA ENFRENTAR LA BAJA TEMPERATURA Y LA
FOTOINHIBICIÓN
ϳ
Calfio, C. P., Mercado, L., Bethke, J. & González, M. ……………………..…..…….….. 51
EXPRESIÓN E IDENTIFICACIÓN DE UNA PROTEÍNA DE ESTRES TÉRMICO
DE 70 kDa EN CÉLULAS INMUNES DE STERECHINUS NEUMAYERI
Cañete J. I., Gallardo C. & Romero M. ............................................................................... 55
RANELIDOS SUBANTÁRTICOS (GASTROPODA) COMO INDICADORES DE
STABILIDAD DE BARRERAS OCEANOGRÁFICAS Y NO-CONECTIVIDAD
ARVAL ENTRE LA ANTÁRTICA Y LA REGIÓN DE MAGALLANES, CHILE
Carrasco-Urra F., Ricote N. & Molina-Montenegro M. A. ……………………….……… 59
EFECTO DEL APORTE EXÓGENO DE NITRÓGENO SOBRE EL DESEMPEÑO
DE COLOBANTHUS QUITENSIS EN LA ANTÁRTICA MARÍTIMA
Carrasco, M., Rozas, J., Villarreal, P., Barahona, S., Cifuentes, V.
& Baeza, M. ……………………………………………………………………………… 64
IDENTIFICACIÓN MOLECULAR Y ANALISIS DE ACTIVIDAD ANTIBIOTICA
DE LEVADURAS AISLADAS DESDE LA ISLA REY JORGE
Casanova-Katny, M. A. & Cavieres L. ……………………………………….………….. 68
INTERACCIONES POSITIVAS ENTRE UNA CARPETA DE MUSGOS Y EL
PASTO ANTARTICO DESCHAMSPIA ANTARCTICA EN ISLA ROBERT
Casanova-Katny A., Heredia R. & Torres-Mellado G. ……………………………..……. 71
DESCHAMPSIA ANTARCTICA UNDER GLOBAL WARMING: HOW LONG WE
NEED TO OBSERVE PLANT RESPONSES?
Castro C., Acevedo J., Aguayo-Lobo A., Allen J., Dalla Rosa L., Forestell P., Kaufman G.,
Olavarria C., Scheidat M., Secchi E. R. & Santos M. ……..…………………………….. 75
MOVIMIENTOS MIGRATORIOS DE LAS BALLENAS JOROBADAS Megaptera
novaeangliae ENTRE EL ECUADOR, ESTRECHO DE MAGALLANES–CHILE Y
LA ANTÁRTICA (1992-2008)
Cid-Ramírez, K., Fernández, E., Bello, H.2, Domínguez, M.
& González-Rocha, G. ………………………………………………………………...…. 79
BACTERIAS CON ACTIVIDAD PROTEOLÍTICA Y LIPOLÍTICA AISLADAS
DESDE EL TERRITORIO ANTÁRTICO CHILENO
Cid-Ramírez, K., Bello, H., Domínguez, M. & González-Rocha, G. ………………….… 83
CRECIMIENTO EN DIFERENTES CONDICIONES DE CULTIVO DE
BACTERIAS AISLADAS EN EL TERRITORIO CHILENO ANTÁRTICO
Cisterna K., Leppe M., Mihoc M., Varela N., Stinnesbeck W., Juhijara A.T.,
Mansilla H. & Bierma H. ……………………………………………...………………… 87
EVOLUCIÓN Y RELACIONES PALEOFITOGEOGRÁFICAS A TRAVÉS DE
ANÁLISIS PALEO-PALINOLÓGICOS DE LOCALIDADES DEL CRETÁCICO
SUPERIOR DEL SUR DE PATAGONIA Y LA PENÍNSULA ANTÁRTICA
ϴ
Contreras, R. A., Pizarro, M. & Zúñiga, G.E. …………………….………..…………….. 91
ACUMULACIÓN DE FITOQUELATINAS Y RESPUESTAS ANTIOXIDANTES DE
COLOBANTHUS QUITENSIS (KUNTH) BARTL. (CARYOPHYLLACEAE)
EXPUESTO A EXCESO DE COBRE Y ALUMINIO IN VITRO
Correa-Llantén, D. N., Amenábar, M. J., Muñoz, P. A., Monsalves, M. T.,
& Blamey, J. M. ……………………………………………………………………….…. 94
Alicyclobacillus sp. cepa CC2, BACTERIA TERMOFILICA UV-TOLERANTE
AISLADA DE ISLA DECEPCION, ANTARTICA
Cuba-Díaz, M., Cid, K., Navarrete, A., Retamal, C. & Bravo, L.A. ………………..…… 96
LA EXPRESIÓN DE SACAROSA FOSFATO SINTASA (SPS) REGULADA POR
FRÍO Y EL FOTOPERIODO FAVORECE LA ACUMULACIÓN DE SACAROSA
EN COLOBANTHUS QUITENSIS DURANTE EL VERANO ANTÁRTICO
Del Campo, K., Bello, H., Domínguez, M. & González-Rocha, G. ……………………. 101
ACTIVIDAD ANTIBACTERIANA DE METALES
PESADOS SOBRE
BACTERIAS ANTÁRTICAS
Díaz, A., González-Wevar, C.A., Gérard, K., Cañete, J.I., Poulin, E. ……..…………… 104
ESTIMACION
DE
TIEMPOS
DE
DIVERGENCIA
Y
PATRONES
CONTRASTANTES DE DIVERSIDAD GENETICA ENTRE INVERTEBRADOS
BENTONICOS MARINOS SOMEROS DE ANTARTICA Y MAGALLANES
Dold, B., Gonzalez-Toril, E., Aguilera, A., Cisternas, M.E., Lopez Pamo, E.
& Amils, R. …………………………………………………………………………...… 109
AGUAS ACIDAS DE ROCA COMO NUEVA FUENTE DE FE EN LA
ANTÁRTICA – IMPLICACIONES PARA EL CALENTAMIENTO GLOBAL
Enrique G. C., Enrique F. Olivares …………………………………………...………… 110
ANTARCTIC COSMIC RAY OBSERVATORY
INSIDE THE CHILEAN
NETWORK OF COSMIC RAY DETECTOR
Fanning, M. …………………………………………………………………...………… 115
THE TRANSANTARCTIC MOUNTAINS; A CORNERSTONE IN RODINIA AND
GONDWANA
Fuenzalida, G., Gonzales, C., Poulin, E. & Cardenas, L. ………………………..…….... 116
AISLAMIENTO INTENSIVO DE MICROSATELITES A TRAVES DE
PIROSECUENCIACION PARA ESTUDIOS DE ADAPTACION LOCAL EN LA
LAPAEdZd/E>>;Wd/E/'ZͿKE/EE;^dZ>͕ϭϵϬϴͿ
Flores, T. S. M., Torres, M. G., Molina-Montenegro, M. A. & Torres-Díaz, C. ……...... 120
DIVERSIDAD GENÉTICA EN POBLACIONES DE COLOBANTHUS QUITENSIS
PRESENTES EN ANTÁRTICA MARÍTIMA Y EL CONTINENTE
ϵ
Gárate F, Sánchez C, Quiroz F, Martínez F, Damiani A & Cordero R. R. ………….….. 123
MEDICIONES ABSOLUTAS DE IRRADIANCIA ESPECTRAL UV EN LA
PENÍNSULA ANTÁRTICA
Gérard, K., Maturana, C., Martínez, A., Díaz, A. & Poulin, E. ………………………… 124
DIVERSIDAD GENETICA Y ESTRUCTURACIÓN A PEQUEÑA ESCALA DE
ABATUS AGASSIZII (MORTENSEN, 1910), UN ERIZO ANTÁRTICO
INCUBANTE EN LA BAHIA FILDES (ISLA REY JORGE, SHETLAND DEL SUR)
Gimpel, C., Lavín, P., Gonzalez, A. & Gonzalez, M. ………………………………...… 126
FLAVOBACTERIUM SP.: EVALUACIÓN DE LA HIDRÓLISIS DE
POLISACÁRIDOS EN UNA CEPA AISLADA DESDE ANTÁRTICA
Gómez-Fuentes C., Calisto-Ulloa N. & Astorga-España M. …………………………… 130
DISTRIBUCIÓN DE COLIFORMES FECALES EN LAS PROXIMIDADES DE
LAS DESCARGAS DE AGUAS RESIDUALES Y SU RELACIÓN CON LOS
SISTEMAS DE TRATAMIENTO EN BASES ANTÁRTICAS
González, I., Hebel, I. & Jaña, R. ……………………………………………………….. 134
EVOLUCION DE LAS AREAS LIBRES DE HIELO Y MODELAMIENTO DE LA
DISTRIBUCIÓN DE NICHOS DE Sanionia uncinata EN LAS ISLAS SHETLAND
DEL SUR, ANTARTICA
González-Silvestre L.A., Torres-Díaz, C., Carrasco-Urra, F., Gianoli E.
& Molina- Montenegro M.A. ………………………………………………………...… 136
PLASTICIDAD FENOTÍPICA EN DOS POBLACIONES ANTÁRTICAS DE
COLOBANTHUS QUITENSIS (CARYOPHYLLACEAE) BAJO UN ESCENARIO
SIMULADO DE CAMBIO GLOBAL
González-Wevar, C. A. & Poulin, E. …………………………………...………………. 137
EVIDENCIA DE RE-COLONIZACIÓN POST-GLACIAL DE PENÍNSULA
ANTÁRTICA POR Nacella (Patinigera) concinna (STREBEL, 1908)
Figueroa, T. & González, M. …………………………………………...………………. 142
EXPRESIÓN DE METALOTIONEÍNA EN EL ERIZO ANTÁRTICO
(STERECHINUS NEUMAYERI) EN RESPUESTA A PARÁMETROS DE ESTRÉS
Galleguillos, C., Alarcón, V., Hebel, I. & Dacasa, M.C. ……….………………...…….. 145
MUSGOS AL LÍMITE: DESCUBRIENDO LA HISTORIA DE VIDA DE
SANIONIA UNCINATA EN ANTÁRTICA
Jaña, R., Durbahn, M. & Nuñez, P. ………………………………..…………….……… 148
LA RUTA DE LA EDAD DEL HIELO EN MAGALLANES
ϭϬ
Jujihara, A., Leppe, M., Mihoc, M., Mansilla, H., Cisterna, N., Varela, N.
& Bierma ……………………………………………………………………………...… 150
PALEOBIOGEOGRAFÍA DE PATAGONIA AUSTRAL Y ANTÁRTICA:
ESTUDIO DEL CRETÁCICO SUPERIOR
Köhler H.W., Pizarro M., Contreras R. A., Barrientos H. & Zúñiga G. E. ………….….. 154
RESPUESTAS ANTIOXIDANTES DE DESCHAMPSIA ANTARCTICA DESV.
CULTIVADA IN VITRO SOMETIDA A EXCESO DE NaCl
Leppe, M., Mihoc, M., Varela, N., Stinnesbeck, W., Mansilla, H., Bierma, H., Cisterna, K.,
Frei, E., Nishida, H., Riveros, P., Mansilla, K. & Jujihara A. ……………..……...…… 158
EVOLUCIÓN DE LA FLORA AUSTRAL-ANTÁRTICA DESDE EL CRETÁCICO
Maire M. & Blamey J. M. …………………………………………………….……...…. 162
COMPARACIÓN DE LOS PROCESOS DE
REDUCCION DIRIGIDA DE
METALES POR UN PSICRÓFILO ANTÁRTICO Y UN TERMÓFILO
Mansilla, H., Rubilar, D., Stinnesbeck, W., Leppe. M. …………………...……………. 164
PLUMA FOSIL DE LA ANTARTICA
Maturana, C. S. & Poulin, E. ……………………………………………………………..165
ESTACIONALIDAD REPRODUCTIVA DEL ERIZO INCUBANTE ANTÁRTICO:
Abatus agassizii
Monrás J.P., Bravo D., Díaz. V., Vásquez C.C. & Pérez-Donoso J. M. …………….….. 169
MICROORGANISMOS ANTÁRTICOS COMO MODELO
PARA LA
PRODUCCIÓN
DE
NANOPARTÍCULAS
SEMICONDUCTORAS
FLUORESCENTES (QUANTUM DOTS)
Monsalves, M.T., Ollivet-Besson, G., Pereira, J, Peralta, R & Blamey, J. M. ………..... 173
EFECTO DE LA RADIACIÓN ULTRAVIOLETA EN LA ACTIVIDAD
ANTIOXIDANTE DE LA ENZIMA SUPERÓXIDO DISMUTASA PROVENIENTE
DE UN MICROORGANISMO ANTÁRTICO
Mora, G. & Palma S. ……………………………………………..…....…………...…… 175
COMPOSICIÓN
FAUNÍSTICA
Y
DISTRIBUCIÓN
TEMPORAL
DE
ZOOPLANCTON EN BAHÍA FILDES, ANTÁRTICA (VERANO 2011)
Negrete P., Perona F., Sabat P., Sallaberry M. & Quillfeldt P. ………….………...……. 180
VARIACIÓN TEMPORAL Y ESTACIONAL EN LA COMPOSICIÓN ISOTÓPICA
DE AVES MARINAS ANTÁRTICAS DE MIGRACIÓN DE CORTA (FAMILIA:
SPHENISCIDAE) Y LARGA DISTANCIA (HYDROBATIIDAE) EN ISLA ARDLEY,
SHETLAND DEL SUR. ANTÁRTICA: INFERENCIAS DEL CAMBIO
CLIMÁTICO SOBRE LOS HÁBITOS ALIMENTARIOS
ϭϭ
Osorio J., Bernardo Y., Cabrera G., Gutiérrez A. & Gidekel M. …………….……...….. 184
COMPARACIÓN DEL CONTENIDO DE POLIFENOLES TOTALES,
ACTIVIDAD ANTIOXIDANTE Y AZUCARES DEL EXTRACTO ACUOSO DE
DESCHAMPSIA ANTARCTICA OBTENIDA IN SITU E IN VITRO
Pardo, A., Zamora, P., Prieto, H., Fierro, A., Pizarro, M. & Zúñiga, G. E. ...................... 186
EFECTO DE LA BAJA TEMPERATURA Y LUMINOSIDAD EN LA
ACUMULACIÓN DE FRUCTANOS Y EN LA EXPRESIÓN DE LOS GENES
INVOLUCRADOS EN SU BIOSÍNTESIS EN DESCHAMPSIA ANTARCTICA
DESV. IN VITRO
Peña F., Vianna J. & Poulin E. …………………………………………..……………… 191
EFECTOS DEL CAMBIO CLIMÁTICO SOBRE EL TAMAÑO POBLACIONAL
DE Pygoscelis adeliae Y Pygoscelis papua: UNA APROXIMACIÓN MOLECULAR
Pérez, J., Gimpel, C., Lavín, P. & Gonzalez, M. …………………..…………………… 194
FLAVOBACTERIAS CULTIVABLES ASOCIADAS A SUPERFICIES DE
MACROALGAS PRESENTES EN ANTÁRTICA
Y SU POTENCIAL
BIOTECNOLÓGICO
Préndez, M., Wachter, J., Correa, R., Donoso, N., Martínez, J., Flocchini, R., Wakabayachi,
P. & Morales, J.R. …………………………………………………………………….. 199
CONCENTRACIÓN DE LAS ESPECIES QUÍMICAS MÁS ABUNDANTES EN
LOS AEROSOLES TROPOSFÉRICOS FINOS COLECTADOS EN EL EXTREMO
NORTE DE LA PENÍNSULA ANTÁRTICA
Quiroga E., Gerdes D., Montiel A. & Knust R. ……………………………...………….. 204
ESPECTROS DE BIOMASA DEL MACROBENTOS ANTARCTICO: UNA
APROXIMACION ALOMETRICA PARA ESTUDIAR LAS PERTURBACIONES
POR ICEBERGS
Ricote N., Muñoz-Ramírez C., Gómez-González S., Torres-Díaz C., Salgado-Luarte C.,
Valladares F. & Gianoli E. & Molina-Montenegro M. A. ……..…………….………….. 209
INTERACCIONES POSITIVAS ENTRE EL LIQUEN USNEA ANTARCTICA
(USNEACEAE) Y LA FLORA ANTARTICA EN LA ISLA REY JORGE,
SHETLAND DEL SUR
Rivera, A., Zamora, R. & Uribe, J. ………………………………..……………………. 211
RECENT GLACIOLOGICAL SURVEYS IN THE INTERIOR OF WEST
ANTARCTICA
Rodrigo, C., Blamey, J., Huhn, O. & Provost, C. ………………………………...…….. 215
¿FLUJO HIDROTERMAL EN EL MONTE SUBMARINO ORCA?
ϭϮ
Rojas, J., Asencio, G., Lavín, P., González-Rocha, G. & González, M. ………...……… 219
AISLAMIENTO Y CARACTERIZACIÓN DE CEPAS ANTÁRTICAS
PRODUCTORAS DE COMPUESTOS ANTIMICROBIANOS DEL TIPO
BACTERIOCINA
Sagredo, C. E., Gutiérrez, A., Gidekel, M., Cabrera, G. ……………...………………… 224
CARACTERIZACIÓN DE UNA CEPA FÚNGICA AISLADA DESDE LA
RISÓZFERA DE Deschampsia antarctica Desv.
Sandoval, A., Fernández, E., Gidekel, M. & Gutiérrez, A. ……………………...……… 226
IDENTIFICACIÓN DE GENES EXPRESADOS DIFERENCIALMENTE EN
Deschampsia antarctica DESV., FRENTE A ESTRÉS OXIDATIVO POR
RADIACIÓN UV.
Souza, J.S., Costa, E. S., Pessoa, A. R. L., Cunha, L., Alves, M. A. S., Torres, J. P. M. &
Malm, O. ……………………………………………………………….……………… 230
MERCURY CONCENTRATION IN FEATHERS OF THE CAPE PETREL
(Daption capense)
Suwalsky, M., Osorio, P., Avello, M., Villena, F. & Strzalka, K. ………….……...…… 233
EFECTOS DE LOS EXTRACTOS ACUOSOS DEL LIQUEN U. aurantiaco Y
MUSGO W. sarmentosa SOBRE MODELOS MOLECULARES DE MEMBRANAS
CELULARES
Schories, D., Sack, A., Garrido, I., Heran, T., Holtheuer, J. & Kappes, J. ....................... 239
CONCINNA, DEL ERIZO
STERECHINUS NEUMAYERI Y OTROS
ORGANISMOS IN SITU
Torres-Mellado, G. A., Jaña, R. & Casanova-Katny, M. A. …………..………..………. 243
EXPANSIÓN DEL PASTO ANTÁRTICO, EN EL ARCHIPIÉLAGO DE LAS
SHETLAND DEL SUR Y LA PENÍNSULA ANTÁRTICA, REVISITADA
Urtubia, R., Rojas, J., Asencio, G., Lavín, P. & González, M. …………………………. 247
CARACTERIZACIÓN DE BACTERIAS AISLADAS DESDE EL LÍQUIDO
CELÓMICO DEL ERIZO ANTÁRTICO Sterechinus neumayeri
Vidal, S. E., Ovalle, E. M. & Foppiano, A. J. …………………………………………... 251
COMPARACION DE ABSORCION RADIOELECTRICA RIOMETRICA EN LA
ANTARTICA Y FLUJOS DE ELECTRONES ENERGETICOS DE LA MISION
THEMIS
Villanueva, F., Ávila, M., Mansilla, A., Abades, S. & Cáceres, J. ……………...……… 255
DE TEJIDO DE AHNFELTIA PICATA (HUDSON) FRIES, 1836 (AHNFELTIALES,
RHODOPHYTA): UNA ESPECIE DE DISTRIBUCION BIPOLAR
ϭϯ
Wendt, A., Rivera, A., Bown, F., Zamora, R., Casassa, G., Bravo, C., Dietrich, R.
& Fritsche, M. ................................................................................................................... 260
CAMBIOS DE ELEVACIÓN Y DE VELOCIDAD EN EL GLACIAR FLEMING,
PENÍNSULA ANTÁRTICA
Yury–Yáñez, R. E., Sallaberry, M., Rubilar–Rogers, D., Otero, R. A., Gutstein, C. S.,
Mourgues, F. A., Robert, E. & Torres, T. ……………..………………………………... 265
BONE MICROSTRUCTURE AND GROWTH DYNAMICS OF EOCENE GIANT
PENGUINS–AVES, SPHENISCIFORMES- FROM SEYMOUR ISLAND,
ANTARCTICA: PRELIMINARY RESULTS
ϭϰ
PRESENCIA DE LA FOCA LEOPARDO, HYDRURGA
LEPTONYX (DE BLAINVILLE, 1820), EN LA COSTA DE CHILE:
EJEMPLO DE UNA CONEXIÓN, EN EL AMBIENTE MARINO,
DE LA ANTÁRTICA Y AMÉRICA DEL SUR
(Presence of the leopard seal, hydrurga leptonyx (de blainville, 1820), on
the coast of chile: an example of the antarctica - south america
connection in the marine environment)
Aguayo-Lobo, A.1, Acevedo, J.2, Brito, J.L.3, Acuña, P.2, Bassoi, M.4, Secchi, E.4 & Dalla-Rosa, L.4
1
Instituto Antártico Chileno (INACH). Plaza B. Muñoz Gamero 1055,
Punta Arenas, Chile
Fundación Centro de Estudios del Cuaternario (CEQUA). Calle 21 de Mayo 1690,
Punta Arenas, Chile
3
Museo Municipal de Ciencias Naturales y Arqueología de San Antonio (MUCINASA). Salvador Sanfuentes 2365 Barrancas,
San Antonio, Chile
4
Universidad Federal de Río Grande (Furg). C.P. 470,
Río Grande R.S. Brasil, CEP 96201-900.
2
La foca leopardo, Hydrurga leptonyx, presenta una distribución circumpolar y vive sobre
los hielos flotantes (pack-ice) y aguas marinas al sur del Frente Polar debido a su
asociación con el hielo ha sido catalogada como pagófila y propiamente antártica. Es de
hábitos solitarios a diferencia de las otras focas antárticas. Además es la más grande de las
focas pagófilas, alcanzando los 3,3 m de longitud, comparada con la foca de Ross,
Ommatophoca rossi, que sólo mide 2,3 m, o la foca cangrejera, Lobodon carciniphagus,
que mide 2,6 m. La foca pagófila que le sigue en tamaño es la foca de Weddell,
Leptonychotes weddelli, con 2,9 m de longitud total.
La población principal de esta especie vive sobre el hielo marino circumpolar antártico que
se forma cada invierno, desde los 58°S en el Pacífico hasta los 78°S, aproximadamente.
Durante el verano este hielo sólo se extiende desde los 68°S, variando su extensión cada
año. Su presencia en un lugar durante varios días siempre está asociada al hielo. Sin
embargo, existen avistamientos de ejemplares jóvenes, principalmente dispersos en las islas
subantárticas, como Georgia del Sur, Heard (Laws 1957, Walter et al. 1998), Macquarie
(Gwynn 1953), Falkland (Hamilton 1939), Orcadas del Sur (Ericsson et al. 1970), Shetland
del Sur (Aguayo & Torres 1967), Kerguelen (Paulin 1962), Marion (Bester et al. 2006) y
Ámsterdam (Dearborn 1952). Por su cercanía a la Antártica, en América del Sur también se
han registrado individuos. En el Atlántico existen registros en Brasil (Pinedo 1990),
Uruguay (Vaz Ferreira 1984), Argentina (Bastida y Rodríguez 2003). En la costa del
Pacífico hasta el año 2000 conocíamos 19 registros, desde los 30°10´S hasta los 56°S
(Torres et al. 2000), incluyendo al Archipiélago de Juan Fernández (Torres y Aguayo
1971). A partir de ese año los registros en Chile han aumentado notoriamente al navegar los
canales y fiordos australes del país. Por tanto, el objetivo de la presente contribución fue
informar sobre los nuevos registros y discutir su ocurrencia durante todo el año en los
fiordos fueguinos, cono un ejemplo de conexión en el ambiente marino entre la Antártica y
América del Sur.
ϭϱ
MATERIALES Y MÉTODOS
La mayoría de los datos nuevos provienen de la Fundación Centro de Estudios del
Cuaternario Fuego Patagonia y Antártica (CEQUA) formado en Punta Arenas en el año
2003 y del Instituto Antártico Chileno (INACH) trasladado a la misma ciudad en el año
2000. Para la zona central-norte, la ran mayoría de los datos provienen del Museo de
Historia Natural y Arqueología de San Antonio (Mucinasa) a partir del año 1991.
El litoral chileno para ordenar los registros se dividió en tres regiones geográficas: i) Zona
Centro Norte, entre los 18°20´S y los 39°59´S, caracterizada por una costa limpia y casi
lineal y suave, influenciada por la corriente fría de Humboldt; ii) Las islas Oceánicas como
las Desventuradas, Archipiélago de Juan Fernández y la isla de Pascua, influenciadas por
aguas cálidas; iii) La Zona Austral entre los 40°S y los 56°S, caracterizada por un litoral
complejo, constituido por cientos de islas, islotes, canales, fiordos, bahías y senos,
influenciados por glaciares y la corriente fría del Cabo de Hornos, desde el Pacífico y, por
la corriente de las Malvinas por el Atlántico.
RESULTADOS
Entre los años 1927 y 2010 se han registrado 115 ejemplares de foca leopardo, en 67
avistamientos. De ellos, 96 ejemplares se registraron después del año 2000. Los registros
más norteños corresponden a la isla de Pascua (29°09´S) y Playa La Bandera (29°13´S) en
el continente. Los más australes corresponden al sur-oeste del Canal Beagle (55°06´S). El
registro más antiguo corresponde al Sr. Gunther Pluschow, quién filmó una foca leopardo
en seno Almirantazgo en el año 1927, filmación que conocimos en el año 2010.
El registro más reciente, corresponde a un ejemplar joven fotografiado y filmado por el Sr.
Jaime Gallardo Araya, el 28 de agosto de 2011, en el muelle de Asmar, Punta Arenas. Los
registros de la Zona Centro Norte se distribuyeron entre Punta Choros (29°13´S) y Río San
Juan (39°55´S) sumando 25 animales solitarios. Se sexaron 11 ejemplares correspondiendo
a 6 hembras y 5 machos. La mayoría de los animales se concentraron entre los 33° y 34°S
(52 %) y el 19,2% se concentraron entre los 36° y 37°S. En las estaciones de invierno y
primavera se concentraron 23 de los 25 registros de esta zona. Cinco ejemplares se
presentaron en condiciones físicas deplorables, con varias heridas, dos de los cuales
fallecieron posteriormente.
En la Zona de las Islas Oceánicas, existen sólo 2 registros. El primero fue informado por
Torres y Aguayo en el año 1971, al fotografiar la piel de un ejemplar joven trabajada por un
pescador en Juan Fernández, quién informó que el “Tigrillo” era muy peligroso en aguas
del mar abierto. El segundo ejemplar fue observado en isla de Pascua, playa Vaihu, el 4 de
agosto de 2002. Dicho ejemplar joven tenía una herida en la lengua, siendo atendida por el
Sr. Alejandro Bugueño, y una vez curado fue devuelta al mar.
Los registros de la Zona Austral corresponden a 87 individuos, en buenas condiciones
físicas; de los cuales se pudieron sexar 25 ejemplares (20 a ojo desnudo o con ayuda de
bimoculares y 5 genéticamente). Estos registros se distribuyeron entre la Laguna de San
Rafael (46°40´S) hasta el Canal Beagle (55°06´S), con la mayoría de ellos al sur de los
53°46´S. Los avistamientos se concentraron en 4 sectores: i) Seno Almirantazgo y
particularmente en el fiordo Parry con 23 avistamientos y 56 animales, y 2 animales en
bahía Ainsworth; ii) Seno Agostini, con 4 avistamientos y 9 animales; iii) Canal Beagle,
con 5 avistamientos y 8 animales; y iv) Senos Ballena y Helado, con 4 avistamientos y 7
ϭϲ
animales. Todos los avistamientos se registraron sobre el hielo, con excepción de uno en la
isla Navarino y otro en los Astilleros de Asmar, recientemente.
DISCUSIÓN Y CONCLUSIÓN
Conocemos que los movimientos de la foca leopardo son difíciles de estudiar debido a sus
hábitos solitarios, a diferencia de las otras focas pagófilas que son más o menos gregarias.
Sin embargo, los avistamientos de esta especie en las islas subantárticas, durante el
invierno, se ha interpretado como desplazamientos hacia el norte, en la medida que el
Océano Austral se congela alrededor del Continente Antártico (Gwynn 1953).
Su presencia en la costa de Chile, documentada desde 1927, pero en forma especial en la
zona austral del país desde el año 1971 (Markham 1971), en hábitat similar al antártico, así
como la presencia de machos y hembras adultas y en buenas condiciones físicas, durante
las estaciones de primavera y verano, especialmente en el fiordo Parry del seno
Almirantazgo, y en el seno Agostini, sugiere que la foca leopardo permanece en la Zona
Austral de Chile, durante todo el año. Además, debido a sus hábitos eurifagos, y a su
voracidad, su presencia durante todo el año sugiere que en la zona existe alimento
suficiente para mantener a este predador que consume pingüinos, crías de focas, crías de
lobos marinos, peces, calamares y krill (Oristland 1977, Borsa 1990, Rogers y Bryden
1995, Vera et al. 2004), presas todas abundantes en los fiordos chilenos. También, debido a
su reputación dentro de los pescadores artesanales, esta especie de foca es considerada de
gran peligro, por lo que han sido atacadas ilegalmente, en donde la encuentren.
Lamentablemente, no tenemos datos sobre estas capturas intencionales, porque no existe
fiscalización en el extenso y complicado litoral austral por parte de Sernapesca. En
consecuencia, su frecuencia en los registros pudiera estar sub-representada, en esta zona.
Los avistamientos de animales adultos de ambos sexos, en primavera y verano, en los
fiordos fueguinos, coincide con los meses de reproducción de la foca leopardo en la
Antártica (Gilbert y Ericsson1977, Kooyman 1981, Rogers et al. 2005). Las crías de esta
especie al nacimiento miden 1,2 m y a los 6-7 meses de edad miden alrededor de 1,9 – 2,0
m (Hamilton 1939, Matthews 1929). Por tanto algunos ejemplares juveniles observados por
nosotros en el fiordo Parry, pudieron haber nacido en dicho lugar.
Aunque los registros presentados en este trabajo sugieren una presencia de la foca leopardo,
durante todo el año en los fiordos fueguinos de Chile, se requieren estudios de telemetría
para conocer sus movimientos, tanto de ejemplares adultos como de juveniles, así como la
obtención de mayor número de biopsias para conocer mejor las relaciones de la población
de las Shetland del Sur, Antártica, con las focas leopardo de los fiordos fueguinos de
América del Sur.
AGRADECIMIENTOS
Se agradece a las instituciones CEQUA, INACH, MUCINASA y FURG.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
Aguayo-Lobo, A. y Torres, D. 1967. Observaciones sobre mamíferos marinos durante la Vigésima
Comisión Antártica Chilena. Primer censo de Pinnipedia en las islas Shetland del Sur. Revista de
Biología Marina, 13(1): 1-57.
Bastida, R. y Rodríguez, D. 2003. Mamíferos Marinos de Patagonia y Antártida. 1ra. Ed. Buenos
Aires. Vázquez Maziini Editores. 208p.
Bester, M.N., Hofmeys, G.J.G., Kirkman, S.P.,Chauke, L.F., de Bruyn, P.J.N., Ferreira, S.M.,
Makhado, A.B., Maswime, T.A.M., Mcintyre, T., Mutandri, T.W., Munyal, F.M., Pistorius,
P.A.,Radzilami, P.M., Ramunazi, A.J., Tshithabane, N.H. y Wilkinson, I.S. 2006. The leopard seal at
ϭϳ
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Marion Island, vagrant or seasonal transient ?. South African Journal Antarctic Research, 36(2): 195198.
Borsa, P. 1990. Seasonal occurrence of the leopard seal, Hydrurga leoptonyx, in the Kerguelen
Islands. Canadian Journal of Zoology, 68(2): 405-408.
Dearborn, J.H. 1952. An unusual occurrence of the leopard seal at Mac Murdo Sound, Antarctica.
Journal of Mammalogy, 43: 273-275.
Erickson, A.W., Hofman, W.L.T. y Ochlenschlager, R.J. 1970. Seal survey in the South Shetland
and South Orkney Islands. Antarctic Journal of the United State, 5(4): 130-131.
Gilbert, J.R. y Erickson, A.W. 1977. Distribution and abundance of seal in the pack-ice of the Pacific
Sector of Southern Ocean. Pp.703-748. In: G.A. Llanos (ed.). Adaptations within Antarctic
Ecosystem. Smithsonian Institution, Washington D.C. 1252p.
Gwynn, A.M. 1953. The status of the leopard seal at Heard Island and Macquarie Island.1948-1950.
ANARE Research Expedition Interin Report No. 3. Antarctic Division. Department of External
Affaire. Melbourne, Australia. 38p.
Hamilton, J.L. 1939. The leopard seal, Hydrurga leptonyx (de Blainville). Discovery Reports, 18:
239-264.
Kooyman, G.L. 1981. Leopard seal, Hydrurga leptonyx, de Blainville 1820. Pp. 261-274. In: S.H.
Ridway & R.J. Harrison (eds.). Handbook of Marine Mammals. Vol.2. Seals. Academic Press,
London and New York. 359p.
Laws, R.M. 1957. On the growth rates of the leopard seal, Hydrurga leptonyx (de Blainville 1820).
Säugetierkundliche Mitteilungen, 5(2): 49-55.
Markham, B.J. 1971. Observation on the elephant seal and the leopard seal seals on Brecknock
Peninsula (Alberto M. de Agostini National Park). Tierra del Fuego. Anales Instituto de la Patagonia
(Chile), 2: 160-163.
Matthews, L.H. 1929. The Natural History of the Elephant Seal with notes on other seals found at
South Georgia. Discovery Reports, 1: 233-255.
Øritsland, T. 1977. Food consumption of seals in the Antarctic pack ice. Pp. 749-767. In: G.A. Llano
(ed.). Adaptations within Antarctic ecosystems: Proceedings of the 3rd SCAR symposium on
Antarctic biology. Smithsonian Institute, Washington, DC. 1252p.
Paulin, P. 1952. Sur la presence aux Iles Kerguelen, Hydrurga leptonyx (Bl). et d¨Arctocephalus
gazella (Pet). Et notes biologiques sur deux phocides. Mammalia, 16: 223-227.
Pinedo, M. C. 1990. Ocorrência de Pinípedes na Costa Brasileira. Garcia de Orta, Sér. Zool., 15(2):
37-48.
Rogers, T. y Bryden, M.M. 1995. Predation of Adelie penguins (Pygoscelis adeliae) by leopard seals
(Hydrurga leptonyx) in Prydz Bay, Antarctica. Canadian Journal of Zoology, 73(5): 1001-1004.
Rogers, T.L., Hogg, C.J. y Irvine, A. 2005. Spatial movement of adult leopard seal (Hydrurga
leptonyx) in Prydz Bay, Easter Antarctica. Polar Biology, 28: 456-463.
Torres, D. y Aguayo-Lobo, A. 1971. Algunas observaciones sobre la fauna del archipiélago de Juan
Fernández. Boletín de la Universidad de Chile, 2(212): 26-37.
Torres, D., Aguayo-Lobo, A. y Acevedo, J. 2000. Mamíferos Marinos de Chile. II. Carnivora. Serie
Cientifica INACH, 50: 25-103.
Vaz-Ferreira, R. 1984. La foca leopardo Hydrurga leptonyx (de Blainville, 1820) (Pinnipedia,
Phocidae) en el Uruguay. Boletín de la Sociedad Zoológica del Uruguay (2da Época), 2: 18-21.
Vera, C., Vargas, R. y Torres, D. 2004. El impacto de la foca leopardo en la población de cachorros
de lobo fino antártico en cabo Shirreff, Antártica, temporada 2003-2004. Boletín del Instituto
Antártico Chileno, 23(1): 19-22.
Walker, T.R., Boyd, I.L., McCafferty, D.J., Huin, N., Taylor, R.I. y Reid, K. 1998. Seasonal
occurrence and diet of leopard seals (Hydrurga leptonyx) at Bird Island, South Georgia. Antarctic
Science, 10(1): 75-81.
ϭϴ
DISTRIBUCIÓN ESPACIAL Y TEMPORAL DE
ZOOPLANCTON MEDIANTE ANÁLISIS DE CPR
(CONTINUOUS PLANKTON RECORDER) EN EL PASO DRAKE:
RESULTADOS PRELIMINARES)
Alvarado, G. 1, Díaz-Ochoa, J. 1, Huerta, K. 1 & Rodrigo, C. 2
1
Departamento de Ciencias y Recursos Naturales, Universidad de Magallanes
2
Instituto Antártico Chileno (INACH)
El paso Drake está situado entre la Península Antártica y el extremo sur de Sudamérica, el
sector más angosto del Océano Austral, con ~800 km y está conformado por una gran
variedad de masas de agua (Zambrano et al., 1990). Una de sus características particulares
es que posee una estructura termohalina muy variable, la Corriente Circumpolar Antártica
es muy intensa, aumentando su complejidad y viéndose alterada la normal transición de
masas de agua (Allauca & Valencia, 1989).
El Océano Austral es conocido por su zonación latitudinal, allí los subsistemas coinciden
con la distribución de las masas de agua y las banquisas de hielo y la fauna planctónica está
dominada por copépodos y eufáusidos relativamente pequeños (Schnack-Schiel & Mujica,
1994). Esta compleja y diversa composición del zooplancton otorga múltiples elementos
para el estudio de los cambios en las masas de agua, permitiendo la utilización de algunas
poblaciones como indicadores biológicos de las variables hidrográficas (Castañeda, 1999).
En este trabajo queremos demostrar la asociación de la distribución espacio-temporal de
algunas especies de zooplancton en relación a la localización de los frentes oceanográficos
del Paso Drake.
MATERIALES Y MÉTODOS
Los métodos de captura de plancton para diferentes tipos de estudios abarcan una gran
variedad de herramientas. El CPR (Continuous Plankton Recorder) es un instrumento de
muestreo de plancton de alta velocidad diseñado para ser remolcado largas distancias, el
que, mediante filtración de agua, captura las muestras planctónicas en mallas de 270 micras
(Vezulli & Reid, 2003). Cada una de las muestras analizadas desde 1946 ha sido registrada
en una gran base de datos, logrando identificar los organismos a distintos niveles
taxonómicos (Vezulli & Reid, 2003).
En este estudio se utilizan los resultados de análisis de muestras obtenidas con CPR a bordo
de las embarcaciones Kaiyo Maru (KM; febrero de 2000) y Yuzhmorgeologiya (YU; eneromarzo de 2008) (Fig. 1). Los métodos de análisis de los organismos pueden ser consultados
en Hosie et al. (2003).
RESULTADOS Y DISCUSIÓN
La figura 2 muestra los resultados obtenidos del muestreo a bordo del R/V Kaiyo Maru en
el verano del 2000, en el que se puede distinguir la temperatura (W_Temp_Hi), la salinidad
(TSG_Sal) y la abundancia total de organismos (Total Abundance). Además se presentan
las posiciones de los principales frentes oceanográficos (SACCF, PF y SAF) según Orsi et
al., (1995). La temperatura posee una tendencia a aumentar a medida que se aleja del
continente Antártico, donde el cambio más brusco se produce al sur del Frente Polar (PF).
El la posición del Frente Subantártico (SAF) se produce una pequeña caída de la
ϭϵ
temperatura y salinidad, así también para el Frente del Límite Sur de la Corriente
Circumpolar Antártica (SACCF).
Las variaciones antes mencionadas tienen una directa relación con la abundancia total de
organismos zooplanctónicos en estos transectos, notándose un aumento antes de llegar al
Frente Polar por el sur y después del mismo, sin embargo sobre éste baja bruscamente, lo
cual se puede explicar por la naturaleza convergente de este frente. Además la influencia
divergente del Frente Subántartico produce un gran aumento de la abundancia debido a la
mayor disponibilidad de nutrientes. Cabe destacar que cercano a las 300 millas náuticas se
observa una perturbación que produce una baja tanto de salinidad como de temperatura y
un aumento en la abundancia, esto podría deberse a un error instrumental o a algún otro
fenómeno natural.
Existen dos mecanismos posibles para explicar las altas densidades de fitoplancton
encontradas en los frentes oceanicos: Adveccion como resultado de un flujo convergente
que se haya observado en esos frentes, o crecimiento in situ de las poblaciones de
fitoplancton estimulado por transporte de nutrientes dentro de la zona estratificada
adyacente al frente en cuestion. (Mann & Lazier, 2006)
Una vez que se obtengan los resultados de los demás transectos se podrá evaluar una mejor
tendencia de la influencia de los frentes oceanográficos del Paso Drake sobre el
zooplancton considerado.
Figura 1. Área de estudio en el paso Drake. Ubicación de tracks donde se obtuvieron las muestras por
medio del CPR y esquema de las zonas frontales presentes en el Océano Austral (Tomczak y Godfrey, 2002).
STF: Frente Subtropical, SAF: Frente Subantártico, PF: Frente Polar, AD: Divergencia Antártica, CWB:
Límite de aguas continentales.
ϮϬ
Figura 2. Muestra los resultados obtenidos para la transecta obtenida el verano del 2000 por el crucero
Kaiyo Maru.
AGRADECIMIENTOS
Al Dr. Graham Hosie del AAD por facilitar los datos biológicos utilizados.
RERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
Allauca, S. & M. Valencia. 1989. Características físico-químicas de las aguas del Paso Drake durante
el verano 1988. Acta Antártica Ecuatoriana. PROANTEC. 1 (1): 19-23.
Castañeda, P. 2000. Los Eufáusidos en el mar ecuatoriano como indicadores de masas de agua,
durante el
crucero oceanográfico Co-II-99. Septiembre-Octubre de 1999. Acta Oceanográfica
del
Pacífico, INOCAR, 10(1): 161-167.
Hosie, G.W., Fukuchi, M. & S. Kawagushi. 2003. Development of the Southern Ocean Continuous
Plankton Recorder survey. Progress in Oceanography, 58: 263-283.
K.H. Mann & J.R.N. Lazier, 2006. Dynamics of marine ecosystems, tercera edicion, , Blackwell
Publishing, 496 pags.
Orsi, A.,Whitworth, T. & W. Nowlin. 1995. On the meridional extent and fronts of the Antarctic
Circumpolar Current. Deep-Sea Research., 42: 641-673.
Schnack-Schiel, S. & A. Mujica. 1994 . The zooplankton of the Antartic Peninsula región. Pp. 79-92.
En: Southern Ocean Ecology. Sayed Zakaria. El-Sayed, (ed) Cambridge University Press,
Cambridge, Inglaterra.
Vezzulli, L. & P.C. Reid. 2003. The CPR survey (1948–1997): a gridded database browser of
plankton
abundance in the North Sea Progress in Oceanography., 58: 327–336.
Ϯϭ
ϮϮ
ANÁLISIS CULTIVO-INDEPENDIENTE Y CULTIVODEPENDIENTE DE MUESTRAS SUBMARINAS
PROVENIENTES DE SITIOS HIDROTERMALES DE ISLA
DECEPCIÓN, ANTÁRTICA
(Culture-independent and culture-dependent analysis of submarine
samples from hydrothermal sites of Deception Island, Antarctica)
Amenábar, M. J.1, Flores, P. A.1, 2, Pugin, B.1, 2, Boehmwald, F. D.1 & Blamey, J. M.1
1
Fundación Científica y Cultural Biociéncia, José Domingo Cañas 2280,
Santiago, Chile
2
Doctorado en Biotecnología, Universidad de Santiago de Chile, Avenida Libertador Bernardo O’Higgins 3363,
Santiago, Chile. E-mail: [email protected]
A pesar de los distintos sitios geotermales descritos en Antártica, aún no se ha descrito la
presencia de archaeas hipertermofílicas en este continente. Uno de estos sitios geotermales
es Isla Decepción, la cual es un volcán activo localizada en la sección sur-oeste del estrecho
de Bransfield, entre la península Antártica y las islas Shetland del sur (Muñoz-Martín et al.
2005). El objetivo de este trabajo fue investigar la presencia de archaeas hipertermofílicas
en Isla Decepción. Para esto se realizó un gel de electroforesis con gradiente denaturante
(DGGE) para analizar el gen ARNr 16S obtenido de dos muestras ambientales prevenientes
de hidrotermalismos submarinos de bahía fumarola. Todas las bandas del DGGE fueron
secuenciadas y analizadas con la herramienta BlastN. Se detectó la presencia de archaeas
hipertermofílicas pertenecientes al género Thermococcus y diferentes archaeas no
cultivadas relacionadas a clones ambientales provenientes de ventos hidrotermales. A pesar
de la prevalencia de este tipo de microorganismos de origen de altas temperaturas, también
se encontró otras secuencias similares al género metanogénico anaeróbico
Methanococcoides. Bajo un contexto ambiental, las poblaciones de microorganismos
metabolizadores de azufre del género Thermococcus pueden ser beneficiadas por una
asociación sintrófica con productores primarios, tales como los metanógenos (BonchOsmolovskaya y Stetter, 1991), lo cual podría permitir la presencia de estos
microorganismos en sitios hidrotermales de Isla Decepción. De acuerdo a los análisis de
secuencia, algunas de las archaeas no cultivadas descritas en este trabajo podrían llevar
acabo la oxidación anaeróbica del metano (AOM). A pesar de que este es un proceso
importante el cual reduce la emanación del gas invernadero metano desde los ambientes
marinos a la atmosfera (Caldwell et al. 2008), sus vías metabólicas aún se desconocen. Por
esta razón, la comprensión de nuevas comunidades que realicen la AOM y las condiciones
ambientales bajos las cuales consumen este gas, podrían mejorar nuestro conocimiento del
ciclo del metano.
Análisis filogenéticos utilizando el método de Neighbor-Joining permitió inferir la historia
evolutiva de nuestras secuencias, formando cinco clados principales.
Además de los análisis cultivo-independientes, cortes ultra finos de un enriquecimiento
anaeróbico a 80ºC fueron realizados y analizados por microscopía electrónica de
transmisión, revelando un grupo diverso de morfologías microbianas. Estos resultados junto
con los datos moleculares obtenidos por DGGE, indican que diferentes tipos de
microorganismos hipertermofílicos están presentes en sitios hidrotermales de Isla
Decepción. Adicionalmente aislamos una archaea hipertermofílica anaeróbica perteneciente
al genero Thermococcus, similar a T. celericrescens. A pesar de la amplia distribución de
Ϯϯ
este género en sitios hidrotermales, a la fecha aún no se ha descrito su presencia en
Antártica.
AGRADECIMIENTOS
Este trabajo fue realizado bajo el marco del proyecto Antártica: Fuente biológica de
recursos para la biotecnología nacional 2008-2012, Innova-Corfo #07CN13PXT264.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
Bonch-Osmolovskaya, E. A. & Stetter, K. O. 1991. Interspecies hydrogen transfer in cocultures of
thermophilic Archaea, Systematic and Applied Microbiology, 14: 205– 208.
Caldwell, S. L., Laidler, J. R., Brewer, E. A, Eberly, J. O., Sandborgh, S. C. & Colwell, F. S. 2008.
Anaerobic Oxidation of Methane: Mechanisms, Bioenergetics, and the Ecology of Associated
Microorganisms. Environmental Science & Technology, 42: 6791-6799.
Muñoz-Martín, A., Catalán, M., Martín-Dávila, J. & Carbó, A. 2005. Upper crustal structure of
Deception Island area (Bransfield Strait, Antarctica) from gravity and magnetic modeling. Antarctic
Science, 17: 213-224.
Ϯϰ
RECONSTRUCCIÓN DE AREAS ANCESTRALES EN ESPECIES
ACTUALES DE LA FAMILIA SPHENISCIDAE
(Reconstruction ancestral areas in extant species of family Sphenicidae)
Arriagada A. M.1 & Baessolo L. A.2
1
Departamento de Zoología, Universidad de Concepción
2
Programa IBAM, Universidad de Los Lagos
En la actualidad la familia Spheniscidae está representada por 17 especies agrupadas en los
géneros Eudyptes (seis especies), Spheniscus (cuatro), Pygoscelis (tres), Aptenodytes (dos),
Eudyptula y Megadyptes (una especie cada uno). Estos vertebrados exhiben algunas
particularidades fisiológicas que han permitido una exitosa adaptación al medio marino,
además de una historia evolutiva con alto grado de monogamia, filopatría y colonialismo
reproductivo (Emslie et al., 2007). La mayor parte de estas especies están restringidas
reproductivamente al hemisferio sur, a excepción del pingüino de las Galápagos Spheniscus
mendiculus, especie endémica de las Islas Galápagos y alrededores, cuya distribución
tropical está asociada a la corriente fría de Cromwell (Acosta Hospitaleche 2004). Las
restantes especies presentan colonias reproductivas distribuidas en diversos territorios
continentales e insulares del Hemisferio Sur (Sibley y Monroe 1990).
La familia Spheniscidae constituye un grupo natural (Huxley 1867; Mayr 2009) y los
géneros actuales considerados por varios autores como monofiléticos (Giannini y Bertelli
2004; Baker et al., 2006; Slack et al., 2006). A pesar que las reconstrucciones filogenéticas
apoyan la monofilia de la familia (Meister 1962; Schreiweis 1982; O'Hara 1989; McKitrick
1991), algunas interrogantes sobre las relaciones entre los géneros actuales aún permanecen
poco claras (Warkheit 2001; Giannini y Bertelli 2004; Baker et al., 2006), lo que genera
discusión sobre la reconstrucción de áreas ancestrales y centros de origen de este grupo de
vertebrados. Sin embargo, los esfeníscidos exhiben una marcada fidelidad por el sitio de
reproducción, evidenciado por un alto porcentaje de retorno de parejas reproductivas e
individuos pre-reproductivos a las colonias de origen, lo que sumado al adecuado
conocimiento de los rangos reproductivos de sus 17 especies, facilita la postulación de
hipótesis biogeográficas.
El objetivo de este trabajo es reconstruir las áreas ancestrales de las especies actuales de
pingüinos, a partir de sus relaciones evolutivas. Para esto, se reconstruyo la filogenia de las
especies actuales de la familia Spheniscidae, utilizando una matriz combinada de los genes
mitocondriales 12S y citocromo b, analizada utilizando inferencia bayesiana (IB) en el
programa Bayes Phylogenies (Pagel y Meade 2004). Sobre la base de las hipótesis
filogéneticas obtenidas, se estimaron las probabilidades a posteriori de las áreas ancestrales,
considerando la distribución actual de las 17 especies de pinguínos (ver detalle de
distribución geográfica en Figura 2). Esto permitió discutir algunas de las hipótesis que han
sido propuestas para explicar la diversidad actual de Spheniscidae en el Hemisferio Sur.
Con la matriz combinada de genes y el análisis de IB se obtuvieron 535 árboles, lo que
permitió estimar un árbol de la regla de la mayoría del 50% que recupero la monofilia de
Spheniscidae con altos valores de apoyo en la mayoría de los nodos. Además, se recupero
al género Aptenodytes como grupo hermano del resto de los pingüinos (Figura 1). Este
resultado es consistente con las topologías obtenidas con caracteres moleculares en los
trabajos de Bertelli y Giannini (2005), Ksepka et al. (2006) y Baker et al. (2006). La demás
Ϯϱ
relaciones filogenéticas entre especies y entre géneros se ajustaron a lo descrito en la
literatura sistemática del grupo.
Figura 1. Topología del árbol de la regla de mayoría de la familia Spheniscidae, obtenido a partir de 535
árboles. En líneas rojas se muestran las especies del grupo externo.
Figure 1. Topology of the tree of majority rule Spheniscidae family, derived from 535 trees. Red line shows
the outgroup species.
En cuanto a la reconstrucción de áreas ancestrales mediante la distribución geográfica
actual de Spheniscidae, se pueden inferir algunos resultados importantes. Primero, el rango
reproductivo del ancestro de la familia es ambiguo, ya que aparecen dos regiones probables
para la distribución del ancestro: Península Antártica (PA) y Australia-Nueva Zelanda (AZ)
(Figura 2, nodo 1). Un probable evento de vicarianza puede observarse en el nodo 2, donde
una parte del rango reproductivo de Aptenodytes (Península Antártica) desaparece en el
nodo siguiente y es recobrada sin ambigüedad la región Australia y Nueva Zelanda como el
área ancestral del resto de esfeníscidos (Figura 2, nodo 2). Para el género Spheniscus
también se observa un origen basal asociado a la región de Australia, sin embargo, el nodo
genérico muestra un origen probablemente más reciente en Sudamérica (Figura 2, nodo 3).
Los géneros Megadyptes y Eudyptes presentan en la actualidad una distribución
reproductiva que involucra territorios de diferentes edades geológicas, como las islas del
Arco de Escocia, islas Kerguelen, Marion, Edwards; Sudamérica, Península Antártica,
Australia y Nueva Zelanda (Figura 2, nodo 4).
La reconstrucción de áreas ancestrales de los géneros Eudyptes y Pygoscelis sugiere varios
eventos de especiación posteriores a procesos de dispersión. Puede observarse que ninguna
Ϯϲ
de las regiones insulares incluidas en este trabajo, consideradas como geológicamente
recientes (e.g., Islas Bouvet, conjunto de islas Kerguelen, Marion, Edwards, islas del Arco
de Escocia), son recuperadas como áreas ancestrales en nodos más internos de la familia, lo
que sustenta el análisis de reconstrucción general. Es también significativo que los fósiles
de esfeníscidos son relativamente abundantes en Nueva Zelanda, la Península Antártica
(Isla Seymour) y la Patagonia (Simpson 1972; Clarke et al., 2003). De esta forma, la
reconstrucción planteada en este trabajo sugiere antepasados subantárticos para los
pingüinos presentes en Nueva Zelanda y la Península Antártica y una especiación reciente
en los pingüinos sudamericanos.
Futuras investigaciones pueden mejorar significativamente las hipótesis filogenéticas y
evolutivas de los esfeníscidos combinando diversas bases de datos (e.g., información
morfológica y molecular) de las especies actuales e información osteológica del registro
fósil (ver Clarke et al., 2003). De esta forma, se propone que al incorporar caracteres
anatómicos de especies extintas se facilita la reconstrucción filogenética en un esquema
sistemático integrando las especies actuales y comparar este resultado con aquéllos
efectuados por otros investigadores, lo que facilitaría la comprensión en la evolución e
historia biogeográfica de los esfeníscidos.
Figura 2. Reconstrucción de áreas ancestrales de la familia Spheniscidae obtenido a partir de hipótesis
filogenéticas y la distribución geográfica de las especies actuales.
Figure 2. Reconstruction of ancestral areas Spheniscidae family derived from phylogenetic hypotheses and
geographic distribution of extant species.
(A: territorio antártico, AE: islas del Arco de Escocia; AZ: Australia-Nueva Zelanda, IB:
Islas Bouvet, IG: Islas Galápagos, KH: islas del océano austral (Kerguelen, Marion,
Edwards, etc.), PA: islas de la Península Antártica; SAM: Sudamérica, SAF: Sudáfrica).
Ϯϳ
AGRADECIMIENTOS
Arriagada A.M. agradece el apoyo CONICYT, el Departamento de Zoología y la Dirección
de Postgrado de la Universidad de Concepción.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Acosta Hospitaleche C. 2004. Los pingüinos (Aves, Sphenisciformes) fósiles de Argentina.
Sistemática, biogeografía y evolución. Ph.D. Tesis. Facultad de Ciencias Naturales y Museo,
Universidad Nacional de La Plata. Ciudad de la Plata, Argentina.
Baker A, S Pereira, O Haddrath y K Edge. 2006. Multiple gene evidence for expansion of extant
penguins out of Antarctica due to global cooling. Proceedings of the Royal Society B 273: 11-17.
Bertelli S y N Giannini. 2005. A phylogeny of extant penguins (Aves: Sphenisciformes) combining
morphology and mitochondrial sequences. Cladistics 21: 209-239.
Clarke J, E Olivero y P Puerta. 2003. Description of the earliest fossil penguin from South America
and first paleogene vertebrate locality of Tierra del Fuego, Argentina. American Museum Novitates
3423: 1-18.
Emslie S, L Coats y K Licht. 2007. A 45.000 year record of Adélie penguins and climate change in
the Ross Sea, Antarctica. Geology 35: 61-64.
Giannini N y S Bertelli. 2004. Phylogeny of extant penguins based on integumentary and breedings
characters. Auk 121: 422-434.
Huxley T. 1867. On the classification of birds; and on the taxonomic value of the modifications of
certain of the cranial bones observable in that class. Proceedings of the Zoological Society of London
1867: 415-472.
Ksepka D, S Bertelli y N Giannini. 2006. The phylogeny of the living and fossil Sphenisciformes
(penguins). Cladistics 22: 412-441.
Mayr G. 2009. Paleogene fossil birds. Springer-Verlag Berlin Heidelberg. Berlin, Germany.
McKitrick M. 1991. Phylogenetic analysis of avian hindlimb musculature. University of Michigan
Museum of Zoology Miscellaneous Publications 179: 1-89.
Meister W. 1962. Histological structure of the long bones of penguins. Anatomical Record 143: 377388.
O’Hara R. 1991. An estimate of the phylogeny of the living penguins (Aves: Spheniscidae).
American Zoology 29:11A.
Schreiweis D. 1982. A comparative study of the appendicular musculature of penguins (Aves:
Sphenisciformes). Smithsonian Contributions to Zoology 341: 1-46.
Sibley C y B Monroe. 1990. Distribution and taxonomy of birds of the world. Yale University Press.
London, UK.
Simpson G. 1972. Conspectus of Patagonian Fossil Penguins. American Museum Novitates 2488: 137
Slack K, C Jones, T Ando G Harrison, R Fordyce, A Ulfur y P David. 2006. Early penguin fossils,
plus mitochondrial genomes, calibrate avian evolution. Molecular Biology and Evolution 23: 11441155.
Ϯϴ
RESISTENCIA Y CAPACIDAD DE RECUPERACIÓN A LA
FOTOINHIBICIÓN INDUCIDA POR FRÍO EN LOS ECOTIPOS
ANDINO Y ANTÁRTICO DE COLOBANTHUS QUITENSIS
(KUNTH) BARTL. (CARIOPHYLLACEAE)
Resistance and recovery from cold induced photoinhibition in both
Andean and Antarctic ecotypes of Colobanthus quitensis (Kunth) Bartl.
(Cariophyllaceae)
Bascuñán-Godoy, L.1, Bravo L. A.2 & Corcuera L. J.3
1
Departamento de Fisiología Vegetal, Centro de Estudios Avanzado Zonas Áridas,
La Serena, Chile
Laboratorio de Fisiología y Biología Molecular Vegetal, Instituto de Agroindustria, Departamento de Ciencias Agropecuarias y
Recursos Naturales, Facultad de Ciencias Agropecuarias y Forestales, Universidad de La Frontera, Av. Francisco Salazar 01145,
Temuco, Chile
3
Departamento de Botánica, Facultad de Ciencias Naturales y Oceanográficas. Universidad de Concepción, Casilla 160-C,
Concepción, Chile
2
Colobanthus quitensis (Kunth) Bartl. (Caryophyllaceae). Es una de las dos especies de
plantas vasculares que han colonizado naturalmente la Antártica Marítima. Esta especie se
distribuye por Sudamérica a través de la Cordillera de los Andes. Los ecotipos antárticos y
andinos están expuestos a condiciones de alta intensidad lumínica y bajas temperaturas
durante su periodo de crecimiento (Lewis-Smith, 2003; Cavieres & Arroyo, 1999). Sin
embargo, la frecuencia e intensidad de los diferentes estreses ambientales varía entre estos
dos lugares. En la Antártica, C. quitensis está expuesto permanentemente bajas
temperaturas y la gran mayoría de los días de verano son nublados. En la cordillera de los
Andes C. quitensis crece bajo un rango amplio de temperaturas en su ciclo diurno y esta
frecuentemente expuesto a una alta radiación lumínica al medio día solar. Se ha reportado,
que estos ecotipos difieren en su temperatura letal del 50% (TL50) en respuesta a la
aclimatación al frío donde la TL50 del ecotipo antártico es 5°C menor que la del ecotipo
andino (Gianoli y col., 2004).
La exposición a la baja temperatura induce alteraciones en el metabolismo, especialmente
en la fotosíntesis, donde un exceso de luz absorbida puede generar fotoinhibición (Huner y
col., 1993). Por otro lado, las bajas temperaturas asociadas a condiciones de alta intensidad
lumínica son especialmente fotoinhibitorias, porque la alta radiación genera fotodaño y el
frío inhibe la síntesis “de novo” de proteínas importantes en la recuperación de la
fotosíntesis, como es la D1 del centro de reacción del fotositema II (PSII)(Murata y col.,
2007).
Sin embargo, las plantas han desarrollado mecanismos para disminuir la probabilidad de
fotoinhibición. Un mecanismo fotoprotector altamente estudiado es la disipación térmica
del exceso de energía absorbida. Sin embargo, bajo condiciones de frío al parecer el
incremento de la tolerancia a la fotoinhibición, está bastante relacionada con la capacidad
de mantener los procesos sumideros de electrones (Gray y col., 1996).
Considerando las diferentes condiciones de crecimiento y la diferencial resistencia a las
bajas temperaturas, creemos que es importante estudiar el rol de la aclimatación al frío en
la magnitud del fotodaño bajo condiciones fotoinhibitorias, y como se afecta la capacidad
de recuperación de los procesos fotoquímicos en los distintos ecotipos de C. quitensis. En
este trabajo se propone que la aclimatación al frío tiene un efecto positivo más importante
en el ecotipo antártico que en el andino, porque éste es capaz de mantener sus fotosistemas
Ϯϵ
activos a baja temperatura, lo que disminuye el fotodaño y/o promueve una rápida
recuperación.
MATERIALES Y MÉTODOS
Material vegetal. Las plantas de ambos ecotipos fueron crecidas bajo condiciones de
laboratorio a 15°C (plantas controles no-aclimatadas al frío) y expuestas a 4°C por 21 días
(plantas aclimatadas al frío).
Tratamiento fotoinhibitorio inducido por frío (FI) y cinética de la recuperación a baja
temperatura: Las plantas aclimatadas y no-aclimatadas al frío de ambos ecotipos fueron
expuestas a un tratamiento fotoinhibitorio de 5 hrs (4°C y 1200 µmol photons m-2 s-1) y a
un periodo de 9 horas de recuperación en oscuridad, donde al final de cada periodo se
evaluaron parámetros fotoquímicos, no fotoquímicos, el nivel de fotosíntesis y de las
proteínas Lhcb2 y D1. Para detectar diferencias en la velocidad de recuperación del PSII, el
reestablecimiento del Fv/Fm fue monitoreado en plantas no aclimatadas y aclimatadas al
frío de ambos ecotipos después de 1, 4, 9 y 18 horas a las condiciones de oscuridad a baja
temperatura.
RESULTADOS
La exposición al FI indujo una reducción similar del Fv/Fm similar entre los ecotipos, sin
diferencias respecto a la aclimatación al frío (Fig.1). Las plantas aclimatadas al frío del
ecotipo antártico experimentaron un incremento en la velocidad de reestablecimiento del
Fv/Fm, respecto a plantas no aclimatadas y plantas andinas durante la primera hora de
recuperación en oscuridad.
En general, las plantas aclimatadas experimentaron un mayor mantenimiento de los
procesos fotoquímicos que plantas no aclimatadas. El ecotipo antártico aclimatado al frío,
fue capaz de mantener los procesos fotoquímicos (qP) después del FI (datos no mostrados).
Sin embargo, la disipación térmica medida como NPQ tendió a disminuir después del FI en
plantas aclimatadas y no aclimatadas de ambos ecotipos.
No-aclimatadas
a
Andino
Antartico
0.8
bcd
ab
Fv/Fm
bcd
bcd
B a
ab
ab
abc
fgh
0.7
bcd
fghi
ab
0.8
bc
0.7
ab
cdef
bcd
efghi
defgh
0.6
defg
0.6
ih
defghi
-5
FI
0
i
1
Fv/Fm
A
Aclimatadas al frío
i
4
9
18
Recuperación
Tiempo (horas)
-5
FI
0
1
4
9
18
Recuperación
Tiempo (horas)
Figura 1. Efecto del tratamiento fotoinhibitorio (FI) y cinética de recuperación del Fv/Fm en plantas
aclimatadas y no aclimatadas al frío de ambos ecotipos de C. quitensis. Los círculos representan promedios ±
SE. Diferentes letras representan diferencias significativas entre condiciones de crecimiento, ecotipos y
tiempo de recuperación P< 0.05 usando ANOVA de tres vías. Effect of photoinhibitory treatment and
recovery kinetics on Fv/Fm in NA and CA plants of both ecotypes of C. quitensis. Circles show mean values
± SE. Different letters represent significant differences between growing conditions, ecotypes and recovery
time P< 0.05 using three-way ANOVA.
ϯϬ
Los más altos niveles de Lhcb2 (proteína del complejo antena del PSII) fueron observados
en plantas antárticas (Fig. 2A). Se observó una tendencia a disminuir Lhcb2 después de FI,
con la excepción de plantas antárticas aclimata al frío. Los niveles de D1 fueron similares
entre los ecotipos y temperaturas de crecimiento (Fig. 2B). Después del FI se observó a lo
menos un producto de degradación de 18 kDa (Fig. 2C). Sin embargo, sólo en plantas no
aclimatadas del ecotipo andino, el incremento de este producto de degradación fue
concomitante con una disminución del 30 % de D1.
La reducción de la fotosíntesis (Fig. 3) después del FI fue menor en plantas aclimatadas al
frío (28%) que en plantas no aclimatadas (34% y 51% para el andino y antártico
respectivamente). Después del periodo de recuperación, la fotosíntesis fue reestablecida en
plantas no aclimatadas y aclimatas de ambos ecotipos. Las plantas aclimatas al frío del
ecotipo antártico exhibieron mayores niveles de fotosíntesis que los valores iniciales de
plantas no-fotoinhibidas. La aclimatación al frío incremento del rendimiento quántico de la
fijación de CO2 un 47% y 90% en plantas andinas y antárticas. El FI redujo
significativamente el rendimiento quántico de la fijación del CO2 en plantas no aclimatadas
y aclimatas de ambos ecotipos, sin embargo, los valores se reestablecieron después de 9
horas de recuperación.
Figura 2. Efecto del tratamiento fotoinhibitorio (FI) y recuperación (R) sobre los niveles de Lhcb2 (A), D1
(B) y su producto de degradación de 18 kDa (C) . La figura muestra un western-blot representativo para cada
proteína con su respectivo peso molecular. Effect of PhT and recovery period on Lhcb2 (A), D1 (B) and its
degradation product of 18 kDa (C) levels in NA and CA plants of both ecotypes of C. quitensis. The figure
shows a representative western-blot for every protein with its respective molecular weight.
ϯϭ
Aclimatadas al frío
No aclimatadas
A
Andino
12
B
Andino
10
10
Inicial
FI
Recuperación
Tasa Fotosintética ( CO2 µmol m-2 s-1)
8
6
8
6
4
4
2
2
0
0
10
C 0
Antártico
200 400 600 800 1000 1200 1400D 0
Antártico
200 400
600 800 1000 1200
X Data
8
10
8
6
6
4
4
2
2
0
0
-2
Tasa fotosintética ( CO2 µmol m-2 s-1)
12
-2
0
200 400 600 800 1000 1200
0
200 400 600 800 1000 1200
Intensidad Lumínica (µmoles de fotones m -2 s -1 )
Figura 3. Efecto del tratamiento fotoinhibitorio (FI) y recuperación de la fotosíntesis neta. Plantas no
aclimatadas (A, C) y aclimatas al frío (B, D) de ambos ecotipos de C. quitensis fueron sometidos a FI y a un
periodo de recuperación. La fotosíntesis neta fue medida después de cada tratamiento y su respectivo control
no fotoinhibido (Inicial) a 4°C a 360 ppm de CO2 a diferentes intensidades lumínicas. Resultados representan
promedios ± SE, n=3. Effect of photoinhibitory treatment and recovery period of net photosynthesis. NA (A,
C) and CA (B, D) plants of both ecotypes of C. quitensis were subjected to photoinhibitory treatment and
recovery period. Net photosynthesis was measured after each treatment and the respective non-photoinhibited
controls at 4°C under 360 ppm CO2 at different light intensities. Results are mean values ± SE, n=3.
DISCUSIÓN Y CONCLUSIÓN
Al parecer la aclimatación al frío no cambia la susceptibilidad al daño inducido por la
fotoinhibición , sino más bien cambia la capacidad de recuperación de la actividad
fotosintética y fotoquímica. Esto fue más evidente en el ecotipo antártico, que presento un
mayor nivel de los procesos fotoquímicos después del FI, incrementó el rendimiento
quántico de la fijación del CO2 y exhibió una acelerada recuperación de la actividad
fotoquímica y fotosintética en el periodo de recuperación. En este trabajo, se sugiere, que
en el reestablecimiento de la fotosíntesis a baja temperatura, el incremento de sumideros de
electrones en respuesta a la aclimatación al frío fue muy importante. Esto debido a que
podrían estar limitando el traspaso de electrones hacia el oxígeno evitando la formación de
ERDOS (especies reactivas derivadas del oxígeno) que inducen fotodaño, especialmente a
la proteína D1, del centro de reacción del PSII.
Concluyendo la aclimatación al frío fue especialmente relevante en el ecotipo antártico el
cual incremento la capacidad de recuperación después del FI. Los cambios en el aparto
fotosintético del ecotipo antártico, a través de la aclimatación al frío podrían facilitar en
parte el éxito de la colonización de la Antártica Marítima. Por otro lado, fue consistente la
menor capacidad de recuperación fotoquímica y fotosintética experimentadas por el ecotipo
ϯϮ
andino, puesto que bajo el ambiente natural donde este ecotipo crece, las condiciones
fotoinhibitorias inducidas por frío son menos relevantes.
AGRADECIMIENTOS
Instituto Antártico Chileno, FONDECYT y CONICYT.
REFERENCIA BIBLIOGRÁFICA
•
•
•
•
•
•
Cavieres, LA.y Arroyo, MTK. 1999. Tasa de enfriamiento adiabático del aire en el valle del río
Molina, provincia de Santiago, Chile central (33°S). Rev Geogr Chile Terra Australis, 44:79–86
Gianoli, E., Inostroza, P., Zúñiga-Feest, A., Reyes-Díaz, M., Cavieres, LA., Bravo, LA.y Corcuera
LJ. 2004. Ecotypic differentiation in morphology and cold resistance in populations of Colobanthus
quitensis (Cariophyllaceae) from the Andes of Central Chile and Maritime Antarctica. Arctic
Antarctic and Alpine Research, 36:470-475
Gray, GR., Ivanov, AG., Krol, M. y Huner NPA. 1998. Adjustment of thylakoid plastoquinone
content and electron donor pool size in response to growth temperature and growth irradiance in
winter rye (Secale cereale L.). Photosynth Res, 56: 209–221.
Huner, NPA., Öquist, G., Hurry, V., Krol, M., Falk, S. y Griyth, M. 1993.Photosynthesis,
photoinhibition and low temperature acclimation in cold tolerant plants. Photosynth Res, 37:19–39
Lewis Smith, RI. 2003. The enigma of Colobanthus quitensis and Deschampsia antarctica in
Antarctica. In: Huiskes AHL, Gieskes WWC, Rozema J, Schorno RML, van der Vies SM, WolV
WJ (eds) Antarctic biology in a global context. Backhuys Publishers, Leiden, pp 234–239
Murata N., Takahashi S., Nishiyama Y. y Allakhverdiev SI. 2007. Photoinhibition of photosystem II
under environmental stress. Biochim Biophys Acta, 1767: 414–421.
ϯϯ
MINERALOGIA DE ALTERACION DE MUY BAJO GRADO EN
LA SUCESION VOLCANICA DEL CRETACICO SUPERIOR EN
PUNTA HANNAH, ISLAS SHETLANDS del SUR, ANTARTICA
(Very low grade alteration minerals in the Upper Cretaceous volcanic
succession at Hannah Point, South Shetland Islands, Antarctica )
Bastias, J. 1, Hervé, F. 1, 2, Aguirre, L. 1, Demant, A. 3, Fonseca, E. 4, Torres, T. 5& Michea, W. 1
1.-Departamento de Geología, Universidad de Chile. Plaza Ercilla, 803,
Santiago, Chile
2.-Escuela de Ciencias de la Tierra, Universidad Andrés Bello,
Santiago, Chile
3.-Laboratoire de Petrologie Magmatique, Université Aix Marseille III,
France,
4.-Departamento de Laboratorios, Servicio Nacional de Geología y Minería,
Chile,
5.-Facultad de Agronomía, Universidad de Chile.
Livingston Island is the second largest island of the South Shetland archipelago. Hannah
Point is located midway between Byers Peninsula and Hurd Peninsula, on the south-central
coast .Although the occurrence of alteration minerals has been reported during the early
scientific expeditions to the South Shetland islands, only few studies about them
corresponding to King George Island have been published (Kim et al., 2002; Willan et al.,
2002). The first publications about Livingston Island reported alteration in the basic
igneous rocks (Araya &Hervé, 1966; Smellie et al., 1984; Gonzalez-Ferran et al., 1972),
however, without providing a detailed sample description. This geological subject has not
been examined in detail by any previous publications.
The aim of the study is to contribute to the characterization of the mineral chemistry and
petrology of the very low grade alteration minerals at Hannah Point, and briefly discuss
some aspects of the geological setting where these features developed.
The first study at Hannah Point was reported by Hobbs (1968).He related the volcanic
outcrops with the marine and volcaniclastic succession from Byers Peninsula and defined
both as the Younger Volcanic Group of Miocene origin. Stratigraphical and paleontological
observations at Byers Peninsula by Araya &Herve (1966), Valenzuela and Herve (1970),
Gonzalez et al (1970) and Valenzuela (1971) established that the main part of the
succession there was undoubtedly of Mesozoic age, and that an unconformity separated the
fossiliferous sedimentary volcanic succession from an overlying mainly volcaniclastic unit
then of unknown age. Smellie et al. (1980) and Crame et al. (1993) redefined the
stratigraphic units at Byers peninsula and defined them as the Byers Group of late Jurassic
to Early Cretaceous age. Further field studies and geochronological data at Byers Peninsula
led to define an Upper Jurassic – Lowermost Cretaceous fossiliferous marine sequence
uncomformably overlain by Lower Cretaceous continental volcaniclastic strata, containing
abundant macroflora (Pankhurst et al., 1979; Smellieet al. 1980;Smellie et al., 1984;Cramet
al., 1993; Lopez-Martinez et al., 1996).
The magmatic arc activity at the South Shetland Islands and the Antarctic Peninsula is
recorded from the Middle Jurassic to the Miocene, during which two magmatic arcs
formed: the inner arc at the northern Antarctic Peninsula, from the Middle Jurassic to the
earliest Cretaceous, about 170-130 Ma (Rex, 1976), and the outer arc at the South Shetland
Islands, from the Early Cretaceous to the Miocene (Birkenmajer, 1994; Zheng et al. 2003).
ϯϰ
These magmatic arcs were formed as a response to the subduction of the south-east Pacific
oceanic lithosphere under the continental crust of the Antarctic Peninsula.
The volcanic activity at Byers Peninsula extends from the Lower to the Upper Cretaceous.
Byers Peninsula presents a large and thick basaltic to andesitic lobe intercalated in the
marine sequence which presents features of water-magma interaction ( Demant et al., 2004
). They are contemporaneous with shallow marine sedimentation from the Chester Cone
formation (Hathway and Lomas, 1998), and can be considered Early Cretaceous. Hathway
et al. (1999) dated plagioclases and biotites in ignimbrites at 120-119 Ma, corresponding to
the lowermost Aptian. The sills, dykes and plugs represent the eroded roots of the volcanic
edifices belonging to the Cretaceous arc (Smellie et al., 1984; Demant et al., 2004).The
Sealer Hill plug yielded K/Ar ages of 109 ± 4 and 108 ± 4 Ma and Cerro Negro, another
basaltic plug, was dated at 95 ± 5 and 89 ± 4 Ma (Pankhurst et al., 1979).The reported
upward increasing amounts of intercalated volcanic rocks in the Byers Group, have been
interpreted as an encroachment of the magmatic arc into the forearc basin (Hathway &
Lomas, 1998). Willan & Kelley (1999) reported four episodes of magmatic and
hydrothermal events at the South Shetland Islands: (1) ~108-74, (2) 52-45, (3) 44-36, and
(4) 31-29 Ma, with an important gap of activity between 70 and 50 Ma. Zheng et al. (2003)
recognized four episodes with radiometric data in the dykes from Hurd Peninsula,
Livingston Island: 1) A Late Cretaceous-Paleocene episode in the range of 80-60 Ma,
related with the main magmatism at the island; 2) An Eocene episode (56-52 Ma) that fills
the gap from 70 to 50 Ma, reducing the gap activity from 20 Ma, to only ~5 Ma.; 3) a Late
Eocene event (45-42 Ma) related to the Barnard Point tonalite; and 4) an Oligocene age
representing the last igneous activity at Hurd Peninsula, prior to the opening of the
Bransfield Strait. Tertiary to Quaternary volcanic activity has been reported in central
Livingston, northern Greenwich and King George islands (Smellie et al., 1984; Smellie et
al.; 1996; Smellie et al.,1998) but they have a different chemical signature than the
Mesozoic volcanic activity (Weaver et al., 1982; Keller et al. 1992). The recent volcanism
of Deception island also has different chemical characteristics (Smellie et al.,1984; Marti et
al., 1996). This volcanism is either related to the crustal extension of a back-arc process
(Baker, 1990) or the opening of a new oceanic basin (Gonzalez-Casado et al., 2000).
Hannah Point. Presents a thick volcanic succession, comprising about 500 m of layered
rocks assigned to the Upper Cretaceous (Pallas et al. 1999; Leppe et al, 2007). Smellie
(1984) interpreted the rocks of Hannah Point as part of the volcanic succession cropping
out on Byers Peninsula, and assigned a Lower Cretaceous age. K-Ar analyses of two
basaltic-andesite samples corresponding to the mid and the upper part of the succession
gave 87.9 ± 2.6 and 67.5 ± 2.5 Ma respectively, indicating an Upper Cretaceous age
(Smellie et al., 1996). The older age correspond to a Coniacian date, in accordance with the
migration of the volcanism suggested by Pankhurst & Smellie (1983).The geochemical data
reported by Smellie et al. (1996) ruled out any cogenetic relationship between the
volcaniclastic rocks of Hannah Point and the Byers Group.
The volcanic succession at Hannah Point has a continental character. Pallas et al. (1999)
observed in the Upper Cretaceous volcanic succession at Hannah Point many juvenile
components in the matrix-supported breccias indicating a pyroclastic mode of
fragmentation. The amygdules, devitrification and collapse of pumice indicate that they
were emplaced by pyroclastic flows associated to explosive volcanic activity. The absence
of subaquatic features on them suggest a subaerial environment of emplacement. Palma et
ϯϱ
al (2007) studied palinomorphs from the Punta Hannah succession. The palynological
record is dominated by Pteridophyta (Gleicheniidites senonicus, G. circinidites, Cyathidites
minor, Dictyophyllidites sp.) and tricolpate pollen grains of a Magnoliophyta: cf.
Tricolpites pachyexinus. There is a low frequency of Podocarpidites marwickii and
epiphyllous fungal spores. A Late Cretaceous (Santonian – Campanian )age is suggested,
younger than the Williams Point palynoflora age . After Leppe et al (2007) the fossiliferous
leaf content of Hannah Point exhibits the dominance of a podocarp-araucarian-fern forest
association, but with evidence of angiosperms restricted to the Late Cretaceous in the South
Shetland Islands .A xylological study of 15 samples of fossil wood (this study), three
coniferal morpho-genus were identified: Araucaropitys Jeffrey, Podocarpoxylon Gothan,
and Taxodioxylon Hartig. The specimens are related to the similar coniferal woods found in
the Cretaceous (Late Albian) of Alexander Island, Antarctica (Falcon-Lang and Cantrill ,
2000) and with the similar cretaceous coniferous fossil wood found at Williams Point,
Livingston Island (Torres & Lemoigne, 1989; Philippe et al., 1993; Poole & Cantril, 2001).
Sampling and analytical procedures. Field studies at Hannah Point took place in
February, 2007 and briefly re-visited during 2008, with the purpose of studying its
volcanism. Samples were collected from the main units of the Upper Cretaceous volcanic
succession. The x-ray analyses of alteration minerals in 5 samples were performed at the
Servicio Nacional de Geologia y Mineria (SERNAGEOMIN), Chile with a diffractometer,
with Cu radiation, 40 kV, 20 mA, , and divergence slit of 1°. Chemical compositions of
primary and secondary minerals were obtained using the Cameca SX100 at the Universite
de Montpellier, with a beam size of 5.0 m, 20 keV.
The microprobe analyses correspond to primary phenocrysts of pyroxenes and plagioclase
feldspars, and secondary minerals of mafic phyllosilicates, and zeolites.
The Upper Cretaceous volcanic succession at Hannah Point is mostly composed of
andesitic to basaltic pyroclastic rocks and lava flows. Pyroxenes and plagioclases are relic
primary phases in the studied volcanic rocks, which have a devitrified matrix and a large
percentage of secondary minerals within the matrix.
The pyroxenes correspond to augite, they usually show alteration into mafic phyllosilicates
in the edges and fractures. Plagioclase displays a varied chemical composition, however the
participation of orthoclase is negligible. The results represent an almost complete sequence
from anorthite, to albite, including mid-way samples of labradorite, andesite, and oligoclase
composition.
The alteration minerals in the Upper Cretaceous volcanic succession at Hannah Point are
easily observed at the outcrops, occur in veins (or veintlets), amydgules,
groundmass/matrix and phenocrysts. Phenocrysts have an intense alteration into albite,
zeolites and calcite. The replacement can be partial or complete, in the first case affecting
the edges and fractures. The composition of plagioclases in this type of magma is usually
anorthite, therefore the albite-anorthite trend is due to an albitization process.
The maphic phyllosilicates are present as patches in primary plagioclases and pyroxenes, as
partial or complete replacements of phenocrysts, as replacement of the groundmass/matrix,
and filling amygdules and veinlets. They show composition focused between trioctahedral
smectite (saponite), with no mixed layers, towards an end-member chlorite. Their
compositions correspond to diabanites (Hey, 1952). It is important to mention the presence
of celadonite in a few samples.
ϯϲ
Zeolites are found as partial or total replacements of primary plagioclase,
groundmass/matrix, and in amygdales and veins (or veinlets). Many shapes and habits
occur due to the many types of zeolites.
Two different geothermometers were used: 1) Cathelineau (1988) which was used for
mafic phyllosilicates within the geothermal system of Los Azufres, Mexico; and 2) Jowett
et al. (1991) which was developed for the same minerals, but with different assumptions.
Discussion. The alteration minerals are mafic phyllosilicates of dabianite composition,
laumontite, yugawaralite, dachiardite, celadonite and albite. Yuwagaralite, dachiardite,
laumontite and albite could be related to a Ca-alteration.
The formation temperatures reported for the zeolites involved in this event are around 150200 C (Deer et al., 2004). This matches with the geothermometry results of the mafic
phyllosilicates (160-190 C).
The geological setting that developed this mineralogy could be burial metamorphism or a
hydrothermal system. Reaction 1 suggests the ubiquous presence of water and silica within
the environment since the moment of formation of the alteration mineralogy. Deers et al.
(2004) show that these zeolites are related to active and recent geothermal systems.
Alteration mineralogy is present in fractures at different scales which indicates that the rock
was at a fragile state during the development of the secondary minerals. The spherical
shape of the amygdules show no ductile behavior of the rocks before and during the
alteration. The model described for this mineralogy at the Andes (Levi et al., 1988; Aguirre
et al., 1989) is similar, however new geochronological data at the alteration minerals is
needed to compare.
The studied volcanic succession show ample features of secondary mineralogy. They took
place at a fragile state, and are present in fractures, amygdules, groundmass/matrix and
phenocrysts.
The most plausible thermal source for this event is Tertiary to Quaternary volcanism,
although more studies are needed to constrain the age of this event.
ACKNOWLEDGMENTS
INACH G_14-09, SERNAGEOMIN, Universite de Montpellier, Anillo Antartico AT-105.
REFERENCES
•
•
•
•
AGUIRRE, L., LEVI, B., NYSTRFM, J.O., 1989. The link between metamorphism, volcanism and
geotectonic setting during the evolution of the Andes. In: Daly, J.S., Cliff, R.A., Yardley, B.W.D.,
Evolution of Metamorphic Belts. Special Publication - geological Society of London8 vol. 43, pp.
223–232.
ARAYA R. & HERVÉ F. (1966). – Estudio geomorfológico y geológico en las Islas Shetland del
Sur, Antártica. – Instituto Antártico Chileno, Publicación 8, 76 p.
BAKER P.E. (1990).– Deception Island.In : W.E. LEMASURIER & J.W. THOMSON, Eds.,
Volcanoes of the Antarctic plate and southern oceans. – Antarctic Research series 48, American
Geophysical Union, Washington D.C., 316-321.
BETTISON, L. A. L.A., SCHIFFMAN, P., 1988. Compositional and structural variation of the
phyllosilicates from the Point Sal ophiolite, California.American Mineralogist 73, 62– 76.
BIRKENMAJER, K. 1994. Evolution of the Pacific margin of the no0rthern Antarctic Peninsula: an
verview. GeolRundsch, 83. Pp.309-312.
CATHELINEAU, M. 1988. Cationsite occupancy in chlorites and illites as a function of
temperature. Clay Minerals, 23: 471-485.
ϯϳ
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
CRAME J.A., PIRRIE D., CRAMPTON J.S. & DUANE A.M. (1993). – Stratigraphy and regional
significance of the Upper Jurassic-Lower Cretaceous Byers group, Livingston lsland, Antarctica. – J.
Geol. Soc. London, 150, 1075-1087.
DEER, W., A.; HOWIE, R., A.; WISE, W., S.; ZUSSMAN, J. 2004.Volume 4B.Second edition.
Framework Silicates: Silica Minerals, Feldespathoids, and the Zeolites. pp: 619, 954, 756.
DEMANT, A.; TOURON, S.; LAPIERRE, H.; BOSCH, D. 2004. Cretaceous arc volcanism of Byer
Peninsula, Livingston Island, Antarctica: new opetrological, geochemical and isotope data. Bull. Soc.
Géol. Fr. N°2, pp. 131-145
FALCON-LANG, H.J,; CANTRILL.D.J. 2000. Cretaceous (Late Albian) coniferales of Alexander
island, Antarctica.1:Wood taxonomy: aquantitative approach. Review of Paleobotany and
Palynology 111(2000) 1-17
GONZÁLEZ-FERRÁN O., KATSUI Y. & TAVERA J. (1970). – Contribución al conocimiento
geológico de la Península Byers de la isla Livingston ; Islas Shetland del sur, Antártica. – Instituto
Antártico Chileno, serie científica, 1, 41-54.
HATHWAY B. & LOMAS S.A. (1998). – The Upper-Jurassic-Lower Cretaceous Byers Group,
South Shetland Islands, Antarctica: revised stratigraphy and regional correlations. – Cretaceous Res.,
19, 43-67.
HATHWAY B., DUANE A.M., CANTRILL D.J. & KELLEY S.P. (1999). – 40Ar/39Ar
geochronology and palynology of the Cerro Negro Formation, South Shetland Islands, Antarctica : a
new radiometric tie for Cretaceous terrestrial biostratigraphy in the southern hemisphere. –
Australian J. Earth Sci., 46, 593-606.
HEY, M.H., 1954. A new review of the chlorites.Mineralogical Magazine 30, 272– 292.
HOBBS G.J. (1968). – The geology of the South Shetland Island : IV. The geology of Livingston
Island. – British Antarctic Survey, Scientific Report 47, 34 p.
LEPPE, M; MICHEA, W.; Muñoz, C.; PALMA-HELDT, S.; FERNANDOY, F. 2007 Paleobotany
of Livingston Island: The first report of a Cretaceous fossil flora from Hannah Point, in Antarctica: A
Keystone in a Changing World – Online Proceedings of the 10th ISAES, edited by A. K. Cooper and
C. R. Raymond et al., USGS Open-File Report 2007-1047, Short Research Paper 081, 4 p.;
doi:10.3133/of2007-1047.srp081
LEVI, B., NYSTRFM, J.O., THIELE, R., A ° BERG, G. 1988. Geochemical trends in Mesozoic–
Tertiary volcanic rocks from the Andes in central Chile and tectonic implications. J. South Am.
Earth Sci. 1, 63– 74.
LÓPEZ-MARTÍNEZ J., THOMSON M.R.A., MARTÍNEZ DE PINSÓN E., et al. (1996). –
Geomorphological map of Byers Peninsula, Livingston Island. – BAS Geomap series, sheet 5-A, 1 :
25,000, with supplementary text, 65 p. – British Antarctic Survey, Cambridge.
KELLER R.A., FISK M.R., WHITE W.M. & BIRKENMAJER K. (1992). – Isotopic and trace
element constraints on mixing and meltingmodels of marginal basin volcanism, Bransfield Strait,
Antarctica. – Earth Planet. Sci. Lett., 111, 287-303.
KIM, H.; CHO, M.; LEE, J. 2002.Thermal metamorphism of volcanic rock son Barton Peninsula,
King George Island, Antarctica. Geosciences Journal, v.6, n.4, p.303-317
MARTÍ J., VILA J. & REY J. (1996). – Deception Island (Branfield Strait, Antarctica) : an example
of a volcanic caldera developed by extensional tectonics. In : W.J. MCGUIRE, A.P. JONES & J.
NEUBERG, EDS., Volcano instability on the Earth and other planets. – Geol. Soc. London Spec.
Publ., 110, 253-265.
PALMA_ HELDT, S., F. FERNANDOY, G. HENRIQUEZ, and M.LEPPE (2007), Palynoflora of
Livingston Island, South Shetland Islands: Contribution to the understanding of the evolution of the
southern Pacific Gondwana margin. Online Proceedings of the 10th ISAES X, edited by A. K.
Cooper and C. R. Raymond et al., USGS. Open-File Report 2007-1047, Extended Abstract 100, 3 p.
REX, D. C. 1976. Geochronology in relation to the stratigraphy of the Antarctic Peninsula. Bulletin
of the British Antarctic Survey 43, pp. 49-58.
SMELLIE J.L., PANKHURST R.J., THOMSON M.R. & DAVIES R.E. (1984). – The geology of
the South Shetland Island : IV. Stratigraphy, geochemistry and evolution. – British Antarctic Survey,
Report 87, 85 p.
ϯϴ
•
•
•
•
•
•
•
•
•
•
•
•
SMELLIE J.L., PALLÁS R., SÁBAT F. & ZHENG X. (1996). – Age and correlation of volcanism
in central Livingston Island, South Shetland Islands : K-Ar and geochemical constraints. – J. South
Amer. Earth Sci., 9, 265-272.
SMELLIE J.L., DAVIES R.E. & THOMSON M.R. (1980). – Geology of a Mesozoic intra-arc
sequence on Byers Peninsula, Livingston Island, South Shetland islands. – British Antarctic Survey
Bull., 50, 55-76.
PÀLLAS, R.; SORIANO, C.; ZHENG, X.; SÀBAT, F.; CASAS, J. M. 1999. Volcanic Stratigraphy
of Hannah Point, Livingston Island, South Shetland Islands, Antarctica.ActaGeológicaHispánica, v.
34, n°4, p. 323-328.
PANKHURST R.J., WEAVER S.D., BROOK M. & SAUNDERS A.D. (1979). – K-Ar chronology
of Byers Peninsula, Livingston Island, South Shetland Islands. – British Antarctic Survey Bull., 49,
277-282.
PANKHURST R.J. & SMELLIE J.L. (1983). – K-Ar geochronology of the South Shetland Islands,
Lesser Antartica : apparent lateral migration of Jurassic to Quaternary island arc volcanism. – Earth
Planet. Sci. Lett., 66, 214-222.
PHILLIPPE,M. BARALE,G., TORRES,T., COVACEVICH.V., 1993. Firts study of in situ fossil
woods from the Upper Cretaceous of Livingston Island south Shetland islands Antarctica:
palaeoecological investigation. C.R. Acd Sci. series II 317: 103-108.
TORRES, T., LEMOIGNE,Y., 1989. Hallazgos de maderas fósiles de Angiospermas y
Gimnospermas del Cretacico Superior en Punta Williams, isla Livingston, Islas Shetland del Sur,
Antártica. Serie Científica INACH, 39, 9-29.
VALENZUELA, E. (1971). Geología de las penínsulas Byers, Islas Livingstone, Antártica. Memoria
para optar al título de Geólogo, Depto. de Geología, U. de Chile.
VALENZUELA, E. & F. HERVÉ (1970). Geology of Byers Peninsula, Livingston Island, South
Shetland Islands. In Adie, R.J., ed., Antarctic Geology & Geophysics, I.U.G.S. Series B, No1: Oslo,
Universitetsforlaget, 83-89.
WILLAN, R.; ARMSTRONG, D. 2002. Successive geothermal, volcanic-hydrothermal and contactmetasomatic events in Cenozoic volcanic-arc basalts, South Shetland islands, Antarctica. Geol. Mag.
132(2). Pp.209-231
WILLAN, R.; KELLEY, S.P. 1999. Mafic dyke swarms in the South Shetland Islands volcanic arc:
Unravellingmultiepisodicmagmatism related to subduction and continental rifting. Journal
ofGeophysical research.V.104. n. B10.23.051-23.068.
ZHENG, X.; KAMENOV, B.; SANG, H.; MONCHEV, O. 2003. New radiometric dating of the
dykes from the hurd Peninsula, Livingston Island, South Shetland Islands. 15, 925-934.
ϯϵ
INTERACCIÓN MOLECULAR PLANTAMICROORGANISMOS ANTÁRTICOS: Arabidopsis thaliana Pseudomonas sp.
(Plant - Antarctic microorganisms molecular interaction:
Arabidopsis thaliana - Pseudomonas sp)
Berríos, G.1, 2*, Bizama, C.2, Cabrera, G.2, Gidekel, M.2 & Gutiérrez, A.1, 3
1
Laboratório de Biologia Molecular Aplicada. Facultad de Ciencias Agropecuarias y Forestales. Departamento de Producción
Agropecuaria. Universidad de La Frontera,
Temuco, Chile
2
[email protected] Escuela de Negocios, Universidad Adolfo Ibáñez,
Santiago, Chile
3
Faculta de Ingeniería y Ciencias, Universidad Adolfo Ibáñez,
Santiago, Chile
La diversidad microbiana en el continente antártico ha demostrado ser muy amplia. Al
parecer las bajas temperaturas que prevalecen a lo largo del año no son obstáculo para la
colonización de los microorganismos (Tindall, 2004). Muchos investigadores señalan que
las plantas vasculares que habitan en la Antártica presentan una microflora característica
que le ayudan a nutrirse y sobrevivir frente a condiciones ambientales extremas. En el
estudio realizado por Barrientos et al., (2008), se señala que en el suelo rizosférico de
Deschampsia antarctica es posible encontrar un amplio espectro de bacterias
psicrotolerantes que presentan una variada resistencia a diferentes antibióticos, toleran
metales pesados y producen una diversa modalidad de enzimas.
En particular, la cepa TI-8 de Pseudomonas sp, aislada desde el suelo rizosférico de D.
antarctica ha resultado ser una cepa de alto interés agronómico. Estudios realizados han
demostrado que la colonización radicular de esta cepa favorece la germinación y el
crecimiento de varias plantas de interés económico. Este efecto estaría medido por el
aumento del desarrollo radicular y aéreo de las plantas producto de la infección, lo que ha
despertado el interés del uso de esta bacteria como biofertilizante. Sin embargo, se
desconoce hasta el momento como es la interacción planta – microorganismo a nivel
molecular.
En los últimos años, se ha logrado un avance significativo en la comprensión de la
interacción planta-rizobacteria gracias a la identificación de genes expresados
diferencialmente en la planta o en la bacteria crecida en presencia de exudados radicales
provenientes de la planta, como modelo de colonización inicial. Siendo las plataformas
transcriptómicas mayormente utilizadas para las identificación de genes diferencialmente
expresados los microarreglos y la hibridación sustractiva por supresión (SSH). La ventaja
de la SSH en relación a los microarreglos, es que esta tecnología es útil cuando se trabaja
con especies nuevas de las cuales se desconoce su secuencia, a fin de encontrar genes
nuevos específicos de la interacción planta- bacteria. El principio de esta tecnología, es la
identificación de genes diferencialmente expresados entre dos poblaciones de interés
biológico mediante etapas simultáneas de normalización y sustracción. La etapa de
normalización consiste en igualar la abundancia de mRNA y la etapa de sustracción
excluye las secuencias que son comunes para ambas poblaciones.
Los estudios dedicados a la identificación de genes involucrados en la interacción plantarizobacterias antárticas son muy limitados, por lo tanto, el objetivo principal de este
ϰϬ
estudio es identificar y caracterizar genes expresados diferencialmente durante el proceso
de interacción inicial de una planta – microorganismo antártico.
MATERIAL Y MÉTODOS
Utilizando el método de hibridación sustractiva por supresión se obtuvo una biblioteca de
cDNA diferencial de la interacción inicial planta - bacteria (Pseudomonas sp., cepa TI-8).
Para esto, la cepa TI-8 de Pseudomonas sp fue cultivada en un medio mínimo M9, donde
la fuente de carbono fue reemplazada por exudados radicales obtenidos desde un cultivo in
vitro libre de patógenos de Arabidopsis thaliana. La SSH fue realizada utilizando el kit
comercial de Clontech PCR-Select cDNA Subtraction (Clontech, Terra Ave, CA, USA) con
la modificaciones descrita por De Long et al (2008). Como diseño experimental se
consideró una hibridación de tipo “forward” y “reverse”, para identificar tanto los genes
sobrexpresados y reprimidos en la interacción. Se utilizó RNA de bacterias incubadas con
los exudados como “tester” y como “driver” se utilizó la bacteria crecida en medio M9 con
glucosa como fuente de carbono. Las extracciones de RNA fueron realizadas utilizando el
protocolo de extracción de Trizol (Invitrogen, Carlsbad, CA, USA). Luego, los RNAs
fueron sometidos a digestión enzimática con DNAsa I (AmbionInc, Austin Tx, USA) y a
purificación con el kit total RNA I (Omega bio-tek, Norcross, GA, USA). La eficiencia de
la sustracción fue verificada monitoreando la disminución del gen constitutivo RpoS,
previamente caracterizado para la cepa en estudio.
RESULTADOS Y DISCUSIÓN
La eficiencia de la sustracción fue confirmada, tanto para la hibridación de tipo “forward” y
“reversa”. Se observó una disminución de un 99,8% de transcritos en ambas condiciones.
A partir de la biblioteca sustractiva, 500 clonas fueron obtenidas y 115 enviadas a
secuenciar. Puesto que se trata de una cepa de origen desconocido, se buscaron secuencias
homológas a Pseudomonas ya caracterizadas y disponibles en la base de datos del NCBI
(National Center for Biotechnology Information) mediante análisis con BLAST. Dentro de
los genes diferencialmente expresados en la condición “forward” con exudados radicales
como fuente de carbono, destacan genes implicados en procesos celulares conocidos por
estar involucrados en la colonización raíz-bacteria (28%) como metabolismo celular,
adaptación al estrés, adquisición de nutrientes, defensa, transducción de señales, transporte,
etc. Cabe destacar que, un porcentaje mayoritario de los genes 68%, corresponden a
proteínas hipotéticas conservadas que no poseen funciones biológicas asociadas, los cuales
corresponderían a genes nuevos propios de la interacción de esta bacteria y los exudados; y
tan solo un 4% correspondieron a fragmentos que no muestran coincidencias con las
secuencias conocidas encontradas en la base de datos GenBank. Dentro de los genes
diferenciales en la condición “reverse” destacan un 28% de genes conocidos involucrados
en procesos celulares, un 63% corresponden a proteínas hipotéticas conservadas y un 10%
de fragmentos sin similitud encontrada.
Actualmente, se está trabajando en la validación de algunos genes interesantes mediante
trascripción reversa y PCR cuantitativo (qRT- PCR).
El tema propuesto pretende realizar un aporte importante en el conocimiento de la cepa
antártica TI-.8 (extremófila) de Pseudomonas sp, y su interacción con las raíces vegetales.
Esto permitiría dilucidar el posible impacto directo en la fisiología de una planta modelo
como Arabidopsis thaliana, y generar una base metodológica para continuar profundizando
en plantas de interés económico, aportando una caracterización funcional y molecular, no
descrita en profundidad hasta ahora, para esta especie bacteriana.
ϰϭ
AGRADECIMIENTOS
INACH 0301; Vitrogen SA; Beca Doctorado CONICYT Graciela Berríos.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
Barrientos L., Gidekel M & Gutiérrez A. 2008. Characterization of rhizospheric bacteria isolated
from Deschampsia antarctica Desv. World J Microbiol Biotechnol. 24:2289–2296 p.
De Long, S., Kinney, K & Jo Kirisits, M. 2008. Prokaryotic Suppression Subtractive Hybridization
PCR cDNA Subtraction, a Targeted Method To Identify Differentially Expressed Genes. Appl
Environ Microbiol. 74 (1) 225–232 p.
Tindall, B. J. 2004. Prokaryotic diversity in the Antarctic: the tip of the iceberg. Microb Ecol 47:271283 p.
ϰϮ
NUEVOS ANTECEDENTES GEOQUÍMICOS PARA
INTERPRETACIONES PETROGENÉTICAS DEL BATOLITO DE
LA PENINSULA ANTÁRTICA, EXTREMO NORTE DE LA
PENÍNSULA ANTÁRTICA
(New geochemical background for petrogenetic interpretations on the
Antarctic Peninsula Batholith, northern tip of the Antarctic Peninsula)
Bobadilla, H. F.1, Calderón, M.2, Hervé, F.1, 3& Fanning, C. M.4
2
1
Departamento de Geología, Universidad de Chile, e-mail: [email protected]
Servicio Nacional de Geología y Minería (SERNAGEOMIN), e-mail: [email protected]
3
Departamento de Geología, Universidad Andrés Bello, e-mail: [email protected]
4
PRISE. Research School of Earth Sciences, The Australian National University
La Península Antártica (PA) es un bloque de corteza continental, el cual ha sido afectado
por distintos procesos tectónicos asociados a la subducción desde el oeste de la placa
Phoenix desde tiempos mesozoicos tempranos a cenozoico (Brix et. al, 2007; Leat et. al,
1995).
Los modelos actuales de evolución tectónica de la PA proponen un crecimiento cortical
debido a procesos de acreción y magmatismo, los que se han mantenido durante el
Mesozoico y Cenozoico, aunque con variaciones geográficas (Barker, 1982; Vaughan et al.,
2000).
MATERIALES Y MÉTODOS
Se dispone de una colección de 19 muestras, pertenecientes al Batolito de la Peninsula
Antártica (BPA), extraídas del extremo norte de la Península Antártica, en su costa oeste e
islas aledañas. 10 de estas muestras cuentan con edades U-Pb SHRIMP en circones y 16
edades de trazas de fisión en apatito (Calderón et. al, 2010). Se ha obtenido la composición
geoquímica de las muestras en torno a los elementos mayores, menores y tierras raras con
ICP-óptico (Universidad de Chile) y óxidos mayores en minerales mediante EPMA
(Universidad de Stuttgart). Varios geotermobarómetros han sido testeados (Otten, 1984;
Schmidt, 1992; Blundy& Holland, 1990; Ridolfi, 2010). Además se ha obtenido la
composición isotópica de las razones 87Sr/86Sr y 143Nd/144Nd . de 10 muestras.
RESULTADOS GEOQUÍMICOS Y DISCUSIONES PETROGENÉTICAS
Elementos mayores. En cuanto a la clasificación de los plutones, representados por las
muestras, éstos serían principalmente dioritas, aunque el rango se extiende desde gabros a
cuarzo-dioritas (TAS).
Respecto de la composición geoquímica, los plutones son magnesianos, cálcicos a calcoalcalinos, metaluminosos y sódicos, con una amplia gama de concentraciones de sílice.
Estas características sugieren que clasificarlos como granitos tipo I (Chappell et al., 1974),
aunque Frost et al. (2001) sugieren escapar a dicha clasificación. En dicho sentido,
podemos referirnos al BPA como un batolito cordillerano, asociado a un arco. Su carácter
cálcico permite proponer que al menos parte de los magmas que dieron origen a los
plutones estudiados se habrían originado en el manto. Respecto de las pocas muestras
peraluminosas, exclusivamente miocenas, a pesar de que un magma podría volverse
peraluminoso por cristalización fraccionada de olivino, piroxeno o hornblenda, este proceso
es poco eficiente (Frost et. al, 2001). Lo más probable es que el magma sea peraluminoso
ϰϯ
debido a la fuente. Magmas de esta naturaleza pueden formarse por fusión de rocas
pelíticas a semipelíticas o a partir de rocas máficas hidratadas (Ellis&Thompson, 1986).
Esta segunda opción parece ser la más probable, dado que la mayoría de los plutones
presentan características de granitos tipo I.
Elementos traza y tierras raras. Respecto del fraccionamiento de tierras raras, dada su
dimensión, podría deberse a la presencia de olivino, clinopiroxeno y ortopiroxeno en la
fuente (Rollinson, 1993): el fraccionamiento de las tierras raras livianas respecto de las
pesadas es de un orden de magnitud (normalizadas a condrito). Descartamos la presencia de
granate en la fuente, no sólo porque acentuaría el fraccionamiento de tierras raras por sobre
un orden de magnitud, reflejado en los valores La/Yb, sino también porque los valores de Y
son medianamente altos para magmas con granate en la fuente (Rollinson, 1993; Leat et. al,
1995). Por ello se propone una roca fuente tipo peridotita mantélica.
Se aprecia una evolución de las anomalías de Eu: éstas en el cretácico son negativas
principalmente y algunas positivas, mientras que hacia el mioceno se hacen nulas a
ligeramente positivas. Esto sugiere una profundización de las fuentes de magmas desde la
corteza media inferior parece contradecir a la ultima frase del parrafo anetrior en el
cretácico a manto superior en el mioceno.
Respecto del resto de elementos traza, los patrones observados para las distintas muestras
en los diagramas SPIDER, tanto normalizando a manto primitivo, condrito y MORB,
permiten descartar fuentes tipo MORB y OIB (Rollinson, 1993). El comportamiento
geoquímico se asemeja más a los patrones que muestra la corteza continental,
principalmente la inferior, dados los valores moderados de K2O Y Rb normalizados. Para
el caso de los plutones cretácicos estudiados, este diagnóstico es compatible con las
conclusiones de las anomalías de Eu. En el caso de las plutones cenozoico inferior se
plantea que alteraciones posteriores alterarían su perfil geoquímica, mientras que se plantea
que los plutones miocenos han sufrido contaminación cortical.
Se ha confiado más en las anomalía de Eu por su carácter menos móvil que el resto de
elementos traza en los diagramas Spider. Además, estas interpretaciones son respaldadas
por la composición isotópica.
Composición isotópica. Los plutones poseen valores ˇ Nd>0 y 87Sr/86Sr<0,7048. Por ello
se propone que todos tendrían su origen en reservorios mantélicos. En concordancia con lo
expuesto en el apartado anterior, se aprecia una evolución temporal de estos valores, siendo
los plutones cretácicos aquellos con mayores razones 87Sr/86Sr y menores ˇ Nd,
evidenciando así una mayor influencia cortical.
Los resultados se correlacionan bastante bien con la composición isotópica de plutones del
Batolito Sur Patagónico (BSP) de las mismas edades. La evolución temporal entre ambos
batolitos es afín. Un aspecto compartido también entre ambos batolitos es una amplia
dispersión en los valores de ˇ Nd. Se ha propuesto que esto sea una evidencia de
contaminación cortical (Voicu et al., 2000). Se puede apelar también al carácter
peraluminoso de los plutones miocenos con estos fines.
Geotermobarometría. Respecto de los resultados geotermobarométricos, los cálculos
indican que los plutones se habrían emplazado en la corteza superior, entre 4 y 7 km., en un
rango de temperaturas que va desde 650°C a 750°C (cristalización de anfíbola). Se han
estimado mayores tasas de exhumación promedio hacia el Mioceno, de hasta 600 m/Ma.
ϰϰ
Estos resultados coinciden con cálculos hechos para el BSP (Dzogolyk, 2007). Sin
embargo, recomendamos tomar estas interpretaciones con prudencia, pues aún se están
haciendo esfuerzos por afinar los cálculos geotermobarométricos con otros modelos y
ampliar el espacio muestral.
CONCLUSIONES
El BPA, en su extremo norte, corresponde a rocas de variada composición, aunque
esencialmente diorítica. El BPA se habría formado en un margen activo de subducción,
constituyendo así las raíces de un arco mesozoico-cenozoico. Los granitos son tipo I,
magnesianos, cálcicos, metaluminosos y sódicos. Se propone que los magmas que dieron
origen a los plutones en el norte del BPA, habrían tenido su origen en el manto,
probablemente a partir de rocas tipo peridotita. Sin embargo, en el cretácico superior habría
una importante componente cortical también. Los plutones miocenos patentan evidencias
de contaminación cortical. El emplazamiento posterior se efectuaría en la corteza superior.
Se proponen tasas de exhumación progresivamente mayores hacia el Mioceno de hasta 600
m/Ma.
AGRADECIMIENTOS
Proyecto Anillo Antartico (ARTG04, ACT105), Proyecto INACH M_06-10, Centro de
Pesquisas Geocronologicas (USP), Universidad de Stuttgart, Fernanda Soto, Beca Magíster
CONICYT.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
Barker, P. 1982. The Cenozoic subduction history of the Pacific margin of the AntarcticPeninsula:
ridge crest-trench interactions. Journal of the Geological Society of London, vol.139, pp. 787-801.
Blundy, J., Holland, T. 1990. Calcic amphibole equilibria and a new amphibole-plagioclase
geothermometer. Contributions to Mineral Petrology, vol. 104, pp. 208-224.
Brix, M., Faundez, V., Hervé, F., Solari, M., Fernandez, J., Carter, A., Stöckhert., B.
2007.Thermochronologic constraints on the tectonic evolution of the western Antarctic Peninsulain
late Mesozoic and Cenozoic times. In: Antarctica: A keystone in a changing world -Online
Proceedings of the 10th ISAES, edited by A. K. Cooper and C. R. Raymond et al.,USGS.
Calderón, M., Fanning, C.M., Hervé, F., Faúndez, V., Sanchez, A. 2010. Spatial Distribution of
Miocene Plutonic Rocks in the Northern Antarctic Peninsula Batholith. IV OSC SCAR Open
Science Conference. Buenos Aires, Argentina.
Chappell, B.W., White, A.J.R. (1974). Two contrasting granites types. Pacific Geology, vol. 8, 173174.
Dzogolyk, E.I. (2007) Termobarometría de aluminio en hornblenda en el Batolito Sur Patagonico.
Tesis de grado. Universidad de Chile.
Ellis, D.J. & Thompson, A.B. (1986). Subsolidus and partial melting reactions in the quartz-excess:
CaO+MgO+Al2O3+SiO2+H2O system under water-excess and water-deficient conditions to 10 kb:
some implications for the origin of peraluminous melts from mafic rocks. Journal of Petrology 27,
91-121.
Frost, B.R., Barnes, C.G., Collins, W.J., Arculus, R., Ellis, D.J. y Frost, C. 2001.
A
geochemical classification for granitic rocks. Journal of Petrology 42: 2033-2048.
Grunow, A.M. 1993. Creation and destruction of Weddell Sea floor in the Jurassic. Geology, vol. 21,
pp. 647-650.
Leat, P.T., Scarrow, J.H., Millar, I.L. 1995. On the Antarctic Peninsula Batholith.
GeologicalMagazine, 132, 4, 399-412.
Otten, M. 1984. The origin of brown hornblende in the Artfjället gabbro and dolerites. Contributions
to Mineral Petrology, vol. 86, pp.189-199.
ϰϱ
•
•
•
•
•
Ridolfi, F. Renzullli, A., Puerini, M. 2010. Stability and chemical equilibrium of amphibole in calcalkaline magmas: an overview, new thermobarometric formulations and application to subductionrelated volcanoes. Contributions to Mineral Petrology, vol. 160, pp. 45-66.
Rollinson, H.R. 1993. Using geochemical data. Longman Scientific &Technical, 352 pags.
Schmidt, M. 1992. Amphibole composition in tonalite as a function of pressure: an experimental
calibration of the Al-in-hornblende barometer. Contributions to Mineral Petrology, vol. 110, pp. 304310.
Vaughan, A.P.M., Storey, B.C. 2000. The eastern Palmer Land shear zone: a new terrane accretion
model for the Mesozoic development of the Antarctic Peninsula. Journal of the Geological Society,
London, vol. 157, pp. 1243-1256.
Voicu, G., Bardoux, M., Stevenson, R., & Jébrak, M. (2000). Nd and Sr isotope study of
hydrothermal scheelite and host rocks at Omai, Guiana Shield: implications for ore fluid source and
flow path during the formation of orogenic gold deposits. Mineralium Deposita, 35, 302-314.
ϰϲ
ECOFISIOLOGÍA DE LAS PLANTAS VASCULARES
ANTÁRTICAS: DOS ESTRATEGIAS PARA ENFRENTAR LA
BAJA TEMPERATURA Y LA FOTOINHIBICIÓN
(Ecophysiology of Antarctic vascular plants: two strategies to cope with
low temperature and photoinhibition)
Bravo, L. A.2, 3, Bascuñán-Godoy 1, Pérez-Torres E.1, & Corcuera L. J.1
2
1
Laboratorio de Fisiología Vegetal, Fac. Cs. Nat. y Oceanográficas, Universidad de Concepción
Laboratorio de Fisiología y Biol. Mol. Vegetal, Depto. Cs. Agronómicas y Recursos Nat., Fac. Cs. Agropecuarias y
Forestales
3
Center of Plant, Soil Interaction and Nat. Resources Biotech., Scientific and Technological Bioresource Nucleus,
Universidad de La Frontera, Temuco, Chile.
The Antarctic is the coldest region of the world. About 98% of its territory is covered by
ice. Thus, only a small portion of the Antarctic continent is available for plant colonization.
Most of the ice and snow-free land is found along the Antarctic Peninsula, in the Maritime
Antarctic. Although some of the lowest temperatures in the world are registered in this
continent, temperatures are much milder in the coastal areas of the Antarctic Peninsula and
associated islands. The mean summer temperature near the coast of the South Shetland
Islands is about 2.8ºC (Zúñiga et al., 1996). Although temperatures remain with little
variation during one day, weekly variations are higher. For example, low mean temperature
may range from -4ºC to 0ºC and high temperature from 0 to 6ºC (Edwards and Smith, 1988,
Zúñiga et al., 1996). The winter snow cover usually melts by the end of spring, when the
growing season for vascular plants begins. During summer, there is rain and occasional
snow. Irradiance and photoperiod are highly variable in the Antarctic. The highest radiation
and photoperiod occur in summer and the lowest in winter (Kappen, 1993). In summer
clear days, irradiance reaches up to 2000 µmol photons m-2 s-1 (Schroeter et al., 1995) and
day length at the northern end of the Antarctic Peninsula is about 20 hours in early summer.
These combined conditions of high irradiance and near zero temperatures are generally
unfavorable for plants because they may cause photoinhibition of photosynthesis (DemmigAdams and Adams, 1992). An additional stress for plants may be the excess proportion of
UV-B due to the stratospheric ozone hole over the Antarctic (Day et al., 1999; Xiong and
Day, 2001). The Antarctic vegetation is very poor in number of flowering plants. Only two
have been able to naturally colonize parts of the Maritime Antarctic. These are the hair
grass Deschampsia antarctica Desv. (Poaceae) and the pearlwort Colobanthus quitensis
(Kunth) Bartl. (Caryophyllaceae) (Smith, 2003). These two species are found in the South
Orkney Islands and in most of the Maritime Antarctic down to ca. 68°S, but do not extend
into the continental Antarctic (Greene and Holtom, 1971). Deschampsia antarctica has a
remarkably wide ecological amplitude and competitive tolerance. It has colonized habitats
ranging from mineral soils to organic soils, nutrient deficient to highly nutrient enriched,
and from dry to waterlogged areas. Colobanthus is less tolerant to extreme conditions,
preferring sparsely-vegetated, sheltered, moist well drained mineral soils. The Antarctic
hair grass is much more abundant and widely distributed than the pearlwort (Smith, 2003).
The populations of these vascular species, especially D. antarctica, are expanding in the
Maritime Antarctic (Cassaretto et al., 1994; Smith, 1994; Day et al., 1999). For this reason,
it has been suggested to use them as indicators of global warming (Smith, 1994; Rozema et
al., 2001). What is so special about these two species that has enabled them to be the only
successful flowering plants in the Antarctic? This question was fully analyzed in an
ϰϳ
inspired article by Smith (2003) and by Alberdi et al. (2002). To survive in the Antarctic,
plants must be able to cope with severe physiological stresses, especially during the
growing season (Antarctic summer), caused by low temperature and repeated freezing and
thawing, desiccation, low water availability, and high irradiance. The aim of this work is to
make an up to date analysis of the properties of these plants that allow them to survive in
the harsh Antarctic conditions.
Figure 1. The growth of single ice crystals was examined in 10-nL samples of apoplastic extracts obtained
from leaves of non-acclimated and cold-acclimated plants of D. antarctica (D.a.) and C. quitensis (C.q.).
Each sample was flash-frozen at −40°C to obtain small ice crystals, warmed until all but one ice crystal had
melted, and then cooled to observe the shape of the single ice crystal as it grew. Scale bar represents 10 µ m.
These unique vascular species posses contrasting mechanisms to cope with freezing. While
C. quitensis avoids freezing by moderate supercooling, D. antarctica is able to tolerate ice
formation in its tissues (Bravo et al., 2001). This has been studied by thermal analysis
combined with the LT50 injury index. C. quitensis experiences tissue injury at higher
temperatures than apoplastic freezing (LT50=-5.8ºC>NT=-9.4ºC) when ice nucleators where
included in the LT50 assays to avoid supercooling (Bravo et al., 2001). However, LT50
decreases when plants are allowed to supercool, especially in cold-acclimated plants which
reach a LT50 of -14°C (Gianoli et al., 2004). Deschampsia antarctica is more freezing
tolerant, exhibiting always lower LT50 than NT. Besides it has a bigger capacity to cold
acclimate than the pearlwort, exhibiting a LT50 of -12°C in non-acclimated and -27°C in
cold-acclimated state (Bravo et al., 2001; Alberdi et al., 2002). Therefore, antarctic
vascular plants are not the most freezing tolerant plant in the world. D. antarctica has a
similar LT50 to those exhibited by winter cereals, such as cold-acclimated winter rye. C.
quitensis is within the range of LT50 observed in other plants from cold environments in
high elevations or high latitude temperate zones.
Therefore, what really distinguishes Antarctic plants is that they must cope with low
temperatures year-round. This imposes two mayor constrains: first, they must grow and
reproduce under continuous low temperature conditions, which imply that their metabolism
ϰϴ
is adapted to work under these conditions. For instance, low temperature may seriously
impair respiration and photosynthesis or cause photoinhibition if it is combined with even
moderate irradiance in sensitive plants (Huner et al., 1998). Second, these plants have to be
prepared to undergo freezing events during the growing season. Several biochemical and
physiological mechanism of freezing tolerance are present in these plants during the
growing season. For example, apoplastic antifreeze activity (Fig. 1) associated to apoplastic
soluble proteins has been found in D. antarctica even in non-acclimated plants, being the
first plant described that possesses constitutive expression of these proteins.
Figure 2. Model comparing the main strategies to cope with low temperature-induced photo-inhibition in C.
quitensis and D. antarctica. The latter is able to divert most of absorbed energy into photochemical process,
having a robust carbon fixation apparartus and an efficient antioxidant system. While C. quitensis dissipate
the excess absorbed energy by non-photochemical process.
Griffith, 2005). It is likely that this peculiarity is due to the constant low temperature
selection pressure in which this plant has evolved. Nonetheless, these plants are able to
respond to low temperature exposure inducing an increase in antifreeze activity (Bravo
and Griffith, 2005) as well as other stress-induced proteins such as dehydrins (OlaveConcha et al., 2004), during cold acclimation. Dehydrins contains certains domains (k
segments) which plays an essential role in cryoprotection or in preventing freeze-induced
cell dehydration injury of cells and macromolecular structures (Lin and Thomashow, 1992;
Bravo et al., 2003).
ϰϵ
Figure 3. Comparison of total SOD activity in leaves of Antarctic plants and other species.
Dehydrin expression has been also shown in D. antarctica subjected to drought, osmotic,
and salt stress, and by ABA treatment (Olave-Concha et al., 2004). A series of other
biochemical responses, including soluble sugars and proline accumulation (Bravo et al.,
2001), gene expression (Gidekel et al., 2003), an increase of antioxidants and antioxidant
enzymes (Perez-Torres et al., 2004ab) have been found in these Antarctic species. The
magnitude of these responses is more intense in D. antarctica than in C. quitensis. For
instance, SOD activity is much higher in D. antarctica than in other studied species (Fig. 2)
which probably explains their differences in freezing tolerance or may be related with their
different mechanisms to cope with freezing temperatures (avoidance vs tolerance).
Additionally, both species are able to cope with the photoinhibitory conditions that
frequently occur during summer. However, the strategies they use are completely different.
While C. quitensis efficiently dissipate the excess of absorbed light, D antarctica
preferentially used it in photochemistry (Fig 2), promoting carbon assimilation and nonassimilative alternative electron sinks, such as oxygen (Perez-Torres 2007). Consistently,
D. antarctica has higher activity of the detoxifying oxygen species (Fig 3).
All the above physiological and biochemical adaptations have allowed these plants to
successfully colonized this harsh environment. The enigma now is how they may cope with
the increase in temperature that is affecting the Antarctic Peninsula or how they will
compete with exotic flora that may succeed in Maritime Antarctic as a consequence of local
warming.
ACKNOWLEDGMENTS
INACH G-02-08 and Fondecyt 1060910.
REFERENCES
ϱϬ
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Alberdi, M. et al. 2002 Physiologia Plantarum 115, 479-486.
Bravo, LA., et al. 2001 Physiologia Plantarum 111, 55-65.
Bravo, L.A. et al. 2003 Physiologia Plantarum 118, 262–269.
Bravo, LA. and Griffith, M. 2005 Journal of Experimental Botany. 56, 1189-1196.
Casaretto, JA., et al. Serie Cientifica INACH 44, 61-66.
Day, TA. et al. 1999 Oecologia 119, 24-35.
Demmig-Adams, B, Adams III, WW. 1992 Annual Review of Plant Physiology and Plant
Molecular Biology 43, 599-626.
Edwards, JA., Smith, RIL. 1988 British Antarctic Survey Bulletin 81, 43-63.
Gianoli, E., et al. 2004 Artic, Antarctic and Alpine Reseach 36, 470-475.
Gidekel, M., et al. 2003 Extremophiles 7, 459–469.
Huner, NPA., Oquist, G. and Sarhan, F. 1998 Trends Plant Science 3, 224-230.
Kappen, L. 1993 Arctic 46, 297-302.
Lin, C. and Thomashow, M.F. 1992. Biochemical and Biophysical Research Communications 183,
1103–1108
Olave-Concha, N., et al. 2004 Antarctic Science 16, 175-184.
Pérez-Torrez, E., et al. 2004a Polar Biology 27, 183-189.
Pérez-Torres, E., et al. 2004b Functional Plant Biology 31, 731-741.
Pérez-Torres, E., et al. 2007 Physiologia Plantarum 130, 185-194.
Rozema, J. et al. 2001 Plant Ecology 154, 11-26.
Smith, RIL. 1994 Oecologia 99, 322-328.
Smith, RIL. 2003 The enigma of Colobanthus quitensis 449 and Deschampsia antarctica in
Antarctica. In: Huiskes AHL, et al. (eds) Antarctic biology in a global context. Backhuys Publishers,
Leiden, pp 234–452.
Xiong, FS. and Day, TA. 2001 Plant Physiology 125, 738-751.
Zuñiga, GE., Alberdi, M. and Corcuera, LJ. 1996 Environmental and Experimental Botany 36, 396399.
ϱϭ
EXPRESIÓN E IDENTIFICACIÓN DE UNA PROTEÍNA DE
ESTRES TÉRMICO DE 70 kDa EN CÉLULAS INMUNES DE
STERECHINUS NEUMAYERI
(Expression and identification of a heat shock protein (Hsp70) in immune
cells of Sterechinus neumayeri)
Calfio, C. P.1, 2, Mercado, L.3, Bethke, J.3 & González, M.1
2
1
Laboratorio de Biorrecursos Antárticos, Instituto Antártico Chileno
Facultad de Cs. Agropecuarias y Forestales, Universidad de la Frontera
3
Instituto de Biología. Pontificia Universidad Católica de Valparaíso
Normalmente la exposición de un organismo a temperaturas elevadas induce una rápida y
transitoria expresión de proteínas de estrés térmico HSP. Sin embargo, en especies marinas
antárticas esta situación no es constante debido a la perdida, en algunos casos, de la
capacidad de inducción de este gen producto de la estabilidad térmica de las aguas
antárticas (Peck, 2002). Sterechinus neumayeri es uno los erizos de mar más comunes y
extensamente distribuidos en las costas antárticas. Puesto que estos organismos no sufren
grandes cambios térmicos podrían ser sensibles a pequeños incrementos de temperatura
(Gillw, 2002; King et al., 2003). En el contexto de la elevación de las temperaturas en
Antártica esta molécula se convierte en un interesante candidato para determinar si los
erizos poseen la capacidad de inducir esta molécula después de que son sometidos a estrés
térmico. Para evaluar esta respuesta primeramente se amplifico un fragmento de ADNc que
codifica para una HSP70 y para posteriormente evaluar su expresión. En paralelo se diseñó
y sintetizó químicamente una región conservada de la proteína para producir anticuerpos
policlonales en ratones. Con esto es posible disponer de herramientas moleculares para
poder evaluar la respuesta fisiológica del erizo antártico frente a un escenario de cambio
climático.
MATERIALES Y MÉTODOS
Organismos y experimentos de estrés térmico. Se recolectaron erizos antárticos (S.
neumayeri) desde la península Fildes (Isla Rey Jorge, Antártica). Se dividieron en grupos
de 3 individuos y se sometieron a temperaturas de 5 y 10°C durante 48 horas. Se
obtuvieron muestras de celomocitos a 1, 24 y 48 horas. El grupo control se mantuvo a 0.5 ±
0.5 °C.
Extracción de ARN y obtención de ADNc. Se aisló ARN total de celomocitos
proveniente del líquido celomico por medio del método de TRIZOL (Invitrogen). Se
sintetizo ADNc a partir de 1g de ARN siguiendo el protocolo de la transcriptasa inversa
de Invitrogen. Las reacciones fueron incubadas durante 5 minutos a 65°C, seguido de 55
minutos a 37°C y calentamiento a 72°C durante 15 minutos.
Amplificación y secuenciación parcial de Hsp70 en celomocitos. Se diseñaron distintos
juegos de partidores a partir de secuencias homologas de Hsp70 de invertebrados marinos.
Dos muestras de ADNc correspondiente a celomocitos de S.neumayeri fueron amplificadas
por PCR. La secuencia parcial obtenida por RT-PCR se usó para diseñar partidores
específicos de Hsp70 de S.neumayeri. Para los análisis de expresión relativa del gen Hsp70
se realizó una PCR semicuantitativa en el cual se utilizó el juego de partidores
ϱϮ
correspondiente a HspQ1Fw (GCAGAGGCATACCTTGGAAA) y HspQ2Rv
(AATGGCAGCTGCAGTAGGTT) que producen un amplicón de 198 pb. La expresión de
Hsp70 fue normalizada con respecto al gen control 18s de S.neumayeri.
Síntesis peptídica y producción del Anticuerpo anti-HSP e identificación en
celomocitos. A partir de los alineamientos realizados con varias HSP70 de invertebrados
marinos correspondientes a la región C- terminal de la proteína traducida, se obtuvo la
secuencia conservada CSEVITWLDANQLAEKDE. Esta fue sintetizada químicamente por
Fmoc. El péptido se precipitó y lavó con éter y la extracción se realizó con agua destiladadesionizada. Posteriormente la masa del péptido fue confirmada por MALDI-TOF. Este
péptido fue utilizado como inmunógeno para producir los anticuerpos policlonales en
ratones por medio de tumores ascíticos. El anticuerpo se validó por medio de técnicas de
dot-blot, western blot e inmunocitoquimica sobre cito-spin de celomocitos.
RESULTADOS Y DISCUSIÓN
Se obtuvo una secuencia parcial desde celomocitos con un tamaño de 650 pb, que se
traduce en 216 aminoácidos. La secuencia deducida presentó una fuerte identidad con otras
secuencias de la familia de proteínas de HSP70 perteneciente a otros géneros de erizos
(Tabla 1). Este resultado indicaría que al igual que otros equinodermos antárticos S.
neumayeri tendría la capacidad de expresar un tipo de ARN que codifica para una proteína
similar a HSP70. Para esta especie este sería el primer reporte para este tipo de chaperona.
Especies
Erizo de mar (Paracentrotus lividus)
Erizo de honduras (Echinus acutus)
Erizo purpura (S.purpuratus)
Chaparrudo (Gobius niger)
Tiburón toro (Carcharias taurus)
Caimán
(A.mississippiensis)
N° acceso
Nucleótidos
GenBank
(%) Identidad
X16544
FM877470
XM_001175646
AY762086
AF502521
AB306280
94%
93%
85%
82%
79%
78%
Amino ácidos
Identidad (%) Similaridad (%)
90%
97%
86%
94%
89%
87%
94%
98%
94%
99%
96%
94%
Tabla1. Homología de secuencias nucleotícas y de aminoácidos de la secuencia de ADNc en S. neumayeri
con otros miembros de la familia de hsp70 (The homology of nucleotide and deduced amino acid sequences
of S. neumayeri hsp70 cDNA with other members of hsp70 family).
Para obtener una estimación aproximada de los niveles de expresión relativa del gen
Hsp70 en erizos sometidos a estrés térmico. Las diferentes condiciones se analizaron
mediante RT-PCR, normalizando posteriormente en base a la expresión del gen ribosomal
18S. Considerando que los grupos difieren significativamente cuando el nivel crítico
obtenido sea < 0.05. Los resultados revelan que no existieron diferencias significativas en
la expresión de Hsp70 en celomocitos a distintas condiciones.Esta situación mostraría que
S. neumayeri al igual que otros organismos marinos antárticos habría perdido la capacidad
de sobre expresar este tipo de proteína (Clark et al, 2008a). Sin embargo es necesario
confirmar este resultado por técnicas más sensibles como el la PCR cuantitativa.
ϱϯ
Figura 1. Nivel de expresión de Hsp70 q diferentes tiempos y temperaturas. Los niveles de transcritos de
todas las muestras fueron realizados por semicuantitativa RT-PCR (Expression level of Hsp70 at different
time and temperatures. Transcript levels for all samples were assessed by semiquantitative RT-PCR).
El anticuerpo se validó por medio de la técnica de dot-blot, por el reconocimiento del
péptido sintético. Posteriormente a partir del extracto de proteínas totales de los
celomocitos, fue posible reconocer una banda de 70 kDa, por medio de la técnica de
western blot (Fig 2b). Esto indicaría que los celomocitos de erizo antártico expresan una
proteína de un peso aparente de 70 kDa. A través de inmunocitoquímica se determinó la
presencia de Hsp70 en celomocitos evidenciando marcaje positivo por parte del anticuerpo
purificado, puesto que las células tienden a tomar una coloración roja cuando se forma el
conjugado antígeno-anticuerpo (Fig 2c). A la fecha solo se han determinado secuencias
parciales de HSP70 en algunos invertebrados marinos antárticos determinándose la falta de
expresión en la estrella de mar (Odontaster validus) y el crustáceo (Paraceradocus gibber)
Clark et al, 2008a). Por el contrario en la almeja Laternula elliptica como en Nacella
concinna se reportó la inducción de la expresión de la Hsp70 (Park et al, 2007; Clark et al,
2008b). En el caso del erizo antártico se ha obtenido una secuencia parcial al igual que en el
caso de O. validus. Por el contrario, este viene a ser el primer trabajo en el cual se identifica
la expresión de la proteína en celomocitos. Es necesario en el futuro validar la expresión a
nivel de la transcripción y de la expresión de la proteína en la cinética de estrés térmico.
ϱϰ
Figura 2. Inmuno detección de la proteína Hsp70 en S. neumayeri. a. Región de la proteína usada para la
síntesis del péptido antigénico. b. Western blot de proteínas de celomocitos revelado por quimioluminicencia.
c. Reconocimiento de la HSP70 en celomocitos (Immune detection of Hsp70 protein in S. neumayeri. a.
Protein region using to chemical synthesis of antigen peptide. b. Western blot of coelomocytes proteins
reveled by chemiluminescence. c. Recognizing of HSP70 in coelomocytes).
AGRADECIMIENTOS
Proyecto Fondecyt de Iniciación N° 11090265.
REFERENCIAS BILBIOGRÁFICAS
•
•
•
•
•
•
Clark MS, Geissler P, Waller C, Fraser KPPF, Barnes DKA, Peck L(2008b) The environmental
HSP70 heat shock response in theAntarctic limpet: Nacella concinna. Cell Stress Chaperones
13.doi:10.1007/s12192-008-0015-7
Clark, M. S., Fraser, K. P. and Peck, L.S. (2008a) Lack of an HSP70 heat shock response in two
Antarctic marine invertebrates. Polar Biol. Doi10.1007/s00300-008-0447-7
Gillw, S.T. (2002) Warming of the Southern Ocean since the 1950s. Science. 295: 1275–1277.
King, J.C., Turner, J., Marshall, G.J., Connolley, W.M. and Lachlancope, T.A. (2003) Antarctic
Peninsula climate variability and its causes as revealed by instrumental records. Antarctic Research
Series. 79: 17–30.
Park, H., Ahn, I., Lee, H. E. (2007). Expression of heat shock protein 70 in the thermally stressed
Antarctic clam Laternula elliptica. Cell Stress & Chaperones (2007) 12 (3), 275–282.
Peck LS (2002) Ecophysiology of Antarctic marine ectotherms: limits to life. Polar Biol 25:31–40
ϱϱ
RANELIDOS SUBANTÁRTICOS (GASTROPODA) COMO
INDICADORES DE STABILIDAD DE BARRERAS
OCEANOGRÁFICAS Y NO-CONECTIVIDAD ARVAL ENTRE
LA ANTÁRTICA Y LA REGIÓN DE MAGALLANES, CHILE
(Subantarctic rannelids snails as indicators of oceanographic barriers
stability and non-larval connectivity between the Antarctic and the
Magellan zone, Chile)
Cañete J. I.1, Gallardo C.2 & Romero M.3
1
Departamento de Ciencias y Recursos Naturales, Universidad de Magallanes, Chile
2
Facultad de Ciencias -Universidad Austral de Chile, Chile
3
Facultad de Ciencias del Mar -Universidad Católica del Norte, Chile
This research wish will show biological and fossil evidence to relate the absence of
Subantarctic ranellids gastropods living in the Magellan coast to explain the absent of the
family in the Antarctic water. Three types of evidences are considered: i) teleplanic larvae
of ranellids gastropods are usually associated with major ocean current systems, through
which they can achieve transoceanic dispersal. As a result, many ranellids achieve a wide
geographic distribution, often with amphi-oceanic populations, ii) the comparison of
numbers of eggs/embryos/larvae in egg masses between Chilean, temperate species of the
family Ranellidae also allow us to predict that three sub-Antarctic ranellids Priene
scabrum, Fusitriton magellanicus and Argobuccinum pustulosum show developmental
attributes that define them as long-distance broadcasters and the planktotrophic
development pattern larvae appear to be a characteristic feature of Ranellidae because few
species have direct development (Sassia spp), and iii) finally, it is noteworthy that,
although they are species with high potentials for dispersal and colonization at a distance,
the Ranellidae are almost absent in the geological and current records of gastropods that
have colonised the Antarctic coast (Romero et al., 2002; Gallardo et al., 2011, in press;
Cañete et al., in prep., 2011).
We postulate that oceanographic barriers could be very effective that has prevented the
dispersal of rannelids larvae to successfully colonize the Antarctic Peninsula, and an
alternative explanation is that ranellids are just not cold-adapted enough to inhabit
Antarctica, rather than being kept away by the Antarctic Circumpolar Current and Polar
Front. We propose that the barriers to biological invasions into the Southern Ocean are
primarily physiological rather than geographic, where cold temperatures would impose
limits to performance that have excluded modern predators in Antarctic waters, where the
Ranellidae snails could be considered a good example.
MATERIAL AND METHODS
Reproductive and larval development of the three species of Chilean rannelids gastropods
are described by Romero et al. (2002), Gallardo et al. (2011, in press) and Cañete et al. (in
prep., 2011). The three studies postulate that this taxon show developmental attributes that
define them as long-distance broadcasters and the planktotrophic development pattern
larvae appear to be a characteristic feature of the family Ranellidae, where some species
with a Pan Pacific geographic distribution (Scheltema, 1966, 1971; Bandel et al., 1994;
Govan, 1995; Beu, 1998; Strathmann & Strathmann, 2007).
ϱϲ
Thus, in the present study we made a review about reproductive biology of tropical and
temperate rannelids gastropods to demonstrate that to spite the long pelagic larval life, this
group is absent in the Antarctic continent. Laboratory and field reproductive antecedents
are added to sustain the relationship between small size of egg, high fecundity and an
estimation of long planctotrophic larval development (Thorson, 1950).
RESULTS
The results of the three studies showed in Table 1 show that have small egg size, high
fecundity, developmental attributes that define them as long-distance broadcasters with
high dispersal potential. The Chilean coast is considered cold temperate. However, there
are not members of each genre living in the Antarctic sea, to spite to be distributed in the
Magellan region. The hatchling size of early veliger of all species are: 263 µ m in Priene
scabrum, 300 µ m in Fusitriton magellanicus and 260 µm in Argobuccinum pustulosum.
The absence of the family Ranellidae in the Antarctic waters, absence of fossils and the
large potential of larval dispersal of Sub Antarctic members of the family, allow sustain
that oceanographic barrier such as the Polar Front maintain isolated the Antarctic of this
predatory family of gastropod.
DISCUSSION
This research demonstrate that the three Chilean Rannnelids species shows indirect
development with the hatching of numerous typical planktotrophic veliger larvae, as also
seen for most other ranellid gastropods that have been studied to date (Govan, 1995;
Laxton, 1969; Muthiah & Sampath, 2000; Penchaszadeh & De Mahieu, 1975; Pilkington,
1974; Romero et al., 2008; Scheltema, (1971b). Features of their encapsulated stages, and
particularly of the hatching larvae, suggest that the larvae have a long planktonic existence.
Attributes like the number of eggs per mass and size of them, the duration of the
encapsulated development and characteristics of the larvae at hatching (Table 1) are within
the ranges observed among ranellids with long-lived planktotrophic larvae (Scheltema,
1966; Bandel et al., 1994; Govan, 1995; Beu, 1998; Strathmann & Strathmann, 2007). Eggs
of such species range between 150 to 200 µ m (Laxton, 1969), with a female fecundity that,
during the breeding season, amounts to various hundreds of thousands (Table 1).
Information available for other ranellids shows a certain variation, but all include at least
some months of planktonic larval life, varying from normally various months to an extreme
case (observed in laboratory) exceeding even of some years (Strathmann & Strathmann,
2007).
In this sense, adults of F. magellanicus and A. pustulosum are widely distributed as well,
with a circum-Southern Ocean distribution, being found along the coasts of Chile and
Argentina, as well as in South Africa, St. Paul and Amsterdam Islands, Tristan da Cunha
and Nightingale Islands, New Zealand and Southern Australia (Beu, 1998). Thus a high
level of larval connectivity and genetic flux is to be expected at least among South
American populations and those located on other continents or distant islands of their
distribution. Along the same lines, a growing number of works report the importance of
dispersal regimes associated with the West Wind Drift and Antarctic Circumpolar Current,
as vehicles for the transoceanic transport of propagules thus maintaining a historical
connectivity among distant populations of many taxa in the southern ocean (Beu et al.,
1997; Gordillo, 2006; Waters et al., 2007; Waters, 2008). Such studies lend special
importance to these southern current systems of transport and their role in the evolution of
ϱϳ
larval dispersal strategies maintaining such distant population’s connectivity, not only in
mollusks but also in many other taxa of marine invertebrates.
The attributes of intracapsular development of three Chilean rennelids species compared to
other members of the family, suggest that it is a ranellid whose planktotrophic larvae have
a relatively large planktonic drift, thereby achieving a wide spatial dispersion during its
planktonic stage in the Southern Ocean. This feature is common in the Ranellidae species
for which there is information (Scheltema 1966, Bandel et al. 1994, Govan 1995: Beu
1998, Strathmann & Strathmann 2007). In general, ranellids are characterised by having
eggs of approx. 150-200 µm (Laxton 1969), with a total female fertility that can reach
several hundreds of thousands (e.g., 200,000-250,000 eggs in Charonia lampas [Cazaux
1972 cited by Govan 1995], 602,000 in C. pileare [Muthiah & Sampath 2000], 660,000
larvae in C. nicobaricum [Purtymun 1974 cited by Govan 1995], 1,000,000 eggs in
Argobuccinum tumidum [Graham 1942] and up to 1,500,000 eggs in Fusitriton
oregonensis [Strathmann & Strathmann 2007]). Species recognised as having long
planktonic lives include F. oregonensis, F. laudandus, Cymatium parthenopeum,
Cymatium nicobaricum, C. pileare, Cymatoma kampala and Charonia lampas, according
to Strathmann & Strathmann (2007), Pilkington (1974), Scheltema (1966), Pechenik et al.
(1984) and Lebour (1945). When hatching, the larvae measure 230-250 um in Cymatium
species studied by Govan (1995), have approximately one turn, a bilobed veil, a small
triangular foot and a visible operculum and are slightly larger in F. laudandus and A.
tumidum (330 and 400 µm) (Pilkington 1974). Later in larval development, the veil is
tetralobular, as is characteristic in teleplanic gastropod larvae, particularly in ranellid
larvae (Scheltema 1966, Pilkington 1976, Bandel et al. 1994, Strathmann & Strathmann
2007). The veliger of a cymatid, illustrated by Pilkington 91974) begins to form four
lobules at approximately 1.5 whorls (510 µm shell length) that are clearly distinguished at
2.5 whorls (1.05 mm).
Finally, it is noteworthy that, although the three Chilean rannelids species here studied
have high potentials for dispersal and colonisation at the distance and are not found in the
geological and current records of gastropods that have colonised the Antarctic coast. The
only Antarctic ranellids seem to be Obscuranella papyrodes (Kantor & Harasewych,
2000). It appears as this species has populated the Antarctic for a long time, and it now
lives in the deep abyssal zone. We do not know how much the Antarctic Circumpolar
Current (ACC) or the Antarctic Polar Front have formed an effective barrier that has
prevented the dispersal of F. magellanicus larvae to successfully colonise the coast of the
Antarctic Peninsula (González-Wevar et al. 2010, 2011). An alternative explanation
argued by some authors (Beu, personal communication) is that the Chilean ranellids are
just not cold-adapted enough to inhabit Antarctica, rather than being kept away by the
ACC. Thus, the natural marine barriers to biological invasions into the Southern Ocean are
primarily physiological rather than geographic; cold temperatures would impose limits to
performance that have excluded modern predators, and the Ranellidae snails are
considered to be a good example.
ϱϴ
Species
Priene scabrum1
Female size
(mm)
45-55
Egg
size
Fecundity
(um)
(Nº
Veliger/female)
170
190,000
Duration of encapsulated
development (days)
38
(13-14 ºC)
Fusitriton
magellanicus2
80-90
180
436,000-600,000
55 – 67
(10 ºC)
Argobuccinum
pustulosum3
67-93
168
650,000
54-56
(11.2-11.7 ºC)
Table 1. Reproductive and larval features of three Chilean Rannelids gastropods used to demonstrate the
absent of larval connectivity and stability in the oceanographic barriers between Antarctic and Magellan
region (southern end of South America). References: 1. Romero et al. (2003), 2. Cañete et al. (in prep., 2011),
3. Gallardo et al. (in press, 2011).
ACKNOWLEDGEMENTS
DID UACH 2007-57 to C.S. Gallardo DIP PR-F2-03-RN-05 and PR-F2-01-CNR-10 to J.I
Cañete.
REFERENCES (This references more those cited in each manuscript)
•
•
•
Cañete, J.I., C.S. Gallardo, T. Céspedes, C.A. Cárdenas & M. Santana. 2011, en prep.
Reeproduction, spawning and early veligers of the ranellid snail Fusitriton magellanicus (Röding
1798) in the cold waters of the Magellan Strait, Chile. To be send to Scientia Marina.
Gallardo, C.S., D. Haro, C. Wagner, O. Garrido & JI Cañete. 2011, in press. Egg laying behaviour
and intracapsular development of Argobuccinum pustulosum (Gastropoda: Ranellidae) in temperate
waters at the South coast of Chile. Marine Biology Research.
Romero MK, Lohrmann K, Bellolio G, Dupré E. 2003. Comparative observations on reproduction,
spawning, and early veligers of three common subtidal mesogastropods from North Central Chile.
The Veliger 46(1): 50-59.
ϱϵ
EFECTO DEL APORTE EXÓGENO DE NITRÓGENO SOBRE
EL DESEMPEÑO DE COLOBANTHUS QUITENSIS EN LA
ANTÁRTICA MARÍTIMA
(Effect of exogenous nitrogen on the performance of Colobanthus
quitensis in the Maritime Antarctica)
Carrasco-Urra F.1, Ricote N.2 & Molina-Montenegro M. A.3
1
Departamento de Botánica, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción
2
Pontificia Universidad Católica de Chile
3
Centro de Estudios Avanzados en Zonas Áridas (CEAZA), e-mail: [email protected]
La Antártica presenta condiciones altamente estresantes para la vida (Kennedy 1995). Una
de las condiciones más estresantes es la baja disponibilidad de nutrientes combinada con la
escasez de agua, lo cual limita el desempeño ecofisiológico de la vegetación que la habita.
Se proyecta que los impactos del cambio climático sean mayores en latitudes altas (IPCC
2001), siendo la Antártica uno de los ecosistemas más sensibles a los efectos del cambio
climático. El aumento de la temperatura superficial y de las precipitaciones líquidas (IPCC
2001, Turner et al. 2005) han sido señalado como los cambios más importantes en este
hábitat. Ambos efectos conllevan a un aumento en la disponibilidad de agua y áreas libres
de hielo para el establecimiento de las plantas (Robinson et al. 2003 & Wasley et al. 2006).
En la Antártica Marítima la comunidad de plantas vasculares esta compuesta por dos
especies, Deschampsia antarctica (Poaceae) y Colobanthus quitensis (Caryophyllaceae)
(Green et al. 2007) las cuales se limitan a crecer en área libres de hielo, siendo altamente
restringidas por la disponibilidad de recursos. Se ha documentado que el aporte exógeno de
nutrientes, -principalmente fecas de pingüinos-, producen cambios en la abundancia y
distribución de las comunidades vegetales de la Antártica. En las islas Shetland del Sur
(Antártica Marítima) el retroceso del hielo en diversas áreas, ha provocado un aumento en
las poblaciones de pingüinos y por ende en la acumulación de las fecas, lo que sumado a
una mayor disponibilidad de agua en el suelo antártico aumentarían los niveles de nitrógeno
disponibles para las plantas que crecen en estos lugares. Esta investigación se muestra que
el aumento en el nivel exógenos de nutrientes y la mayor disponibilidad de agua afecta en
forma positiva a las poblaciones de Colobanthus quitensis.
MATERIALES Y MÉTODOS
Especie en estudio. Colobanthus quitensis (Kunth) Bartl. (Caryophyllaceae) conocido como
el clavelito antártico es la única angiosperma dicotiledónea que habita en la Antártica.
Tiene un hábito de crecimiento en forma de cojín. Sus flores son pequeñas y de color
blanco alcanzando una altura promedio de 8 cm. Esta especie se distribuye a lo largo de la
Cordillera de los Andes y América Central creciendo bajo condiciones de temperaturas
bajas y constantes (-2 a 6 °C temperatura del aire) y por lo general con un bajo PPFD (300600 umol fotones m2s-1) y con máximos de PPFD (2000 umol fotones m-2s-1) (BascuñanGodoy et al. 2010)
Áreas de muestreos y tratamientos. Este estudio fue llevado a cabo en los meses de Enero
y Febrero en dos estaciones de crecimiento consecutivas 2008-2009 y 2009-2010 durante la
Expedición Antártica Chilena (ECA). Las dos áreas se situaron en las Islas Shetland del
Sur: (a) en los alrededores de la Base Polaca Henryk Arctowski (62°09’ S, 58°28’ W)
ϲϬ
localizada en la Isla Rey Jorge en la Bahía Almirantazgo (Kejna 2008). La segunda área de
muestreo fue Punta Hannah (62°39'S, 60°36'W), playa ubicada en la costa sur de la Isla
Livingston. Ambas área fueron seleccionadas por la alta presencia de Colobanthus
quitensis. En cada área de muestreo se seleccionaron 4 tratamientos diferentes. Sitios con
baja disponibilidad de agua y nutrientes (A-N-), sitios con baja disponibilidad de agua, pero
alta disponibilidad de nutrientes (fecas de pingüino) (A-N+), sitios con alta disponibilidad
de agua y baja disponibilidad de nutrientes (A+N-) y sitios con alta disponibilidad de agua
y nutrientes (A+N+).
Atributos cuantificados. En los 4 tratamientos se cuantificaron la densidad (m2; N=5
tratamiento/año) y la eficiencia fotoquímica del PSII (Fv/Fm; N=10 tratamiento/año) de
individuos de C. quitensis. Además se cuantificaron las características microclimáticas de
los suelos en los 4 tratamientos. Específicamente, se caracterizó la humedad del suelo
(KPa; N=12 tratamiento/año) y la concentración de nitrógeno disponible (NO3- y NH4+;
N=12 tratamiento/año).
Análisis estadísticos. Se realizaron análisis de varianza (ANOVA) factorial siendo los
factores predictores el año de la cuantificación de loa atributos y los diferentes tratamientos
((A-N-, A-N+, A+N-, A+N+); mientras que las variables dependientes fueron los diferentes
atributos cuantificados en esta investigación (densidad y Fv/Fm). En el caso que las
diferencias entre las medias resultaron significativas, se aplicó un test a posteriori de Tukey
HSD para ver las diferencias intraespecíficas entre los tratamientos y años. Para el Fv/Fm
se realizó un análisis de varianza (ANOVA) de una vía debido a que cuantificaron
solamente el año 2010. El programa utilizado para los análisis estadísticos fue
STATISTICA 7.0 y las gráficas se realizaron con el programa SIGMA PLOT 10.0.
RESULTADOS
Los resultados indican que el promedio entre ambos años de estudio fue mayor en aquellos
tratamientos donde había una mayor disponibilidad de agua, no importando la
disponibilidad de nitrógeno (A+N- y A+N+: F3, 88= 0.017). La mayor disponibilidad de
nutrientes no fue significativamente diferente entre los años, pero si entre los tratamientos,
siendo mayor en A+N+ (F3, 48 =< 0.001). La densidad de los individuos de C. quitensis fue
significativamente mayor en ambos años en el tratamiento donde había una mayor
disponibilidad de agua y de nutrientes (A+N+: F 3,32= < 0.001). El desempeño fisiológico
fue significativamente mayor en los tratamientos A-N+, A+N-, A+N+ para el año 2010.
(Figura 1).
DISCUSIÓN Y CONCLUSIÓN
El aporte exógeno de nutrientes debido al aporte de las pingüineras y la mayor
disponibilidad de agua en el ecosistema Antártico pueden influir en la dinámica de C.
quitensis, produciendo un efecto positivo en sus poblaciones en que sentido. Esto último se
ve reflejado ya que los individuos provenientes de las poblaciones con una mayor
disponibilidad de recursos (nutrientes y agua) presentan mayores tamaños, densidades y
eficiencia del PSII, resultados que influyen en el desempeño ecofisiológico de esta especie.
ϲϭ
0
b
-10
b
b
-15
-20
Humedad de suelo (KPa)
Humedad de suelo (KPa)
-5
b
-25
a
-30
a
a
a
-35
A- N-
A- N+
A+ N-
A+ N+
A- N-
A- N+
2009
A+ N-
A+ N+
2010
Concentración de nutrientes (ppm)
30
25
c
bc
bc
b
20
15
10
a
a
a
a
5
0
A- N-
A- N+
A+ N-
A+ N+
A- N-
A- N+
A+ N-
A+ N+
2010
2009
80
e
70
d
Densidad (m2)
60
50
c
c
bc
b
40
30
20
a
a
10
0
A- N-
A- N+
A+ N2009
A+ N+
A- N-
A- N+
A+ N-
A+ N+
2010
ϲϮ
1,0
b
0,8
b
b
a
Fv/FM
0,6
0,4
0,2
0,0
A-N-
A- N+
A+ N-
A+ N+
2010
Figura 1. Atributos cuantificados en ambos años de investigación. Las barras negras indican el error
estándar y las letras el resultado del análisis a post-hoc de Tukey.
Figure 1. Attributes quantified in both years of investigation. The black bars indicate the standard error and
letters the result of post-hoc analysis of Tukey.
Por otro lado, el cambio climático estaría provocando efectos indirectos, ya que a mayor
temperatura, se estaría generando cambios en la disponibilidad de recursos (agua y
nutrientes) y un aumento en la superficie disponible debido al retroceso de los hielos. Estos
efectos indirectos pueden afectar la distribución y abundancia de poblaciones de C.
quitensis en las zonas en las cuales el aporte de nutrientes por las pingüineras sea
mantenido y la disponibilidad de agua aumente. Es más, si los actuales patrones de aumento
en las concentraciones de nutrientes, aumento del agua disponible y una mayor superficie
disponible para colonizar, podrían generarse condiciones propicias para la colonización de
especies exóticas en este hábitat.
AGRADECIMIENTOS
Los autores agradecen al Instituto Antártico Chileno (INACH) por la ayuda logística en la
Expedición Chilena Antártica 2009 y 2010 (ECA). Este estudio fue financiado por el
proyecto INACH (T_14_08).
REFERENCIA BIBLIOGRÁFICA
•
•
•
•
•
Bascuñan-Godoy, L., García-Plazaola, JI., Bravo, L y Corcuera, LJ. 2010 Leaf functional and micromorphological photoprotective attributes in two ecotypes of Colobanthus quitensis from the Andes
and Maritime Antarctic. Polar Biology, 33(7):885-896.
Green, A., Schroeter, B. y L., Sancho .2007. Plant life in Antarctica. In (eds) Pugnaire, F. y F.,
Valladares. Functional Plant Ecology. Second edition: 389-399. CRC Press Taylor & Francis Group.
Unitec States of America
IPCC.2001. Third Assessment Report- Climate Change 2001. Intergovernmental Pannel for Climate
Change.
Kejna, M. 2008. Topoclimatic conditions in the vicinity of the Arctowski Station (King George
Island, Antarctica) during the summer season of 2006/2007. Polish Polar Research, 29(2): 95-116.
Kennedy, D.1995. Terrestrial ecosystem response to global environmental change. Annual Review
of Ecology and Systematics, 26:683-704.
ϲϯ
•
•
•
Robinson, SA., Wasley, J y Tobin AK. 2003. Living on the Edge-plants and global change in
continental and maritime Antarctica. Global Biology, 9: 1681-1717.
Turner, J., Colwell, SR., Marshall, GJ., Lachlan-Cope, TA., Carleton, AM., Jones, PD.,Lagun, V.,
Reid, PA. y Iagovkina, S. 2005. Antarctic climate change during the last 50 years. International
Journal of Climatology, 25: 279-294.
Wasley, J., Robinson, SA., Lovelock CE. y Popp, M. 2006. Climate change manipulations show
flora is more strongly affected by elevated nutrients than water. Global Change Biology, 12: 18001812.
ϲϰ
IDENTIFICACIÓN MOLECULAR Y ANALISIS DE ACTIVIDAD
ANTIBIOTICA DE LEVADURAS AISLADAS DESDE LA ISLA
REY JORGE
(Molecular Identification and analysis of antibiotic activity of yeasts
isolated from the King George Island)
Carrasco, M.*, Rozas, J., Villarreal, P., Barahona, S., Cifuentes, V. & Baeza, M.
Depto. Facultad de Ciencias, Universidad de Chile, e-mail: [email protected]
El continente antártico representa un reservorio microbiológico poco explorado, en especial
respecto de las levaduras que allí habitan. Estos microorganismos poseen gran importancia
ecológica y un alto potencial para aplicaciones biotecnológicas. El objetivo de este trabajo
fue estudiar la diversidad de levaduras presentes en el territorio antártico chileno, para lo
cual en una primera etapa se recolectaron muestras de tierra y de agua desde la isla Rey
Jorge. Utilizando diferentes condiciones de cultivo se logró aislar gran cantidad
microorganismos, los que fueron seleccionados y agrupados de acuerdo a sus características
macromorfológicas, obteniéndose 64 grupos morfológicos. Levaduras representativas de
cada grupo fueron seleccionadas para su identificación usando métodos moleculares. Para
ello se amplificó y secuenció la región 5.8S y el espaciador transcrito interno (ITS) del
DNA ribosómico, utilizando los partidores ITS1 e ITS4. Esto permitió la identificación de
54 aislados, que correspondieron a 13 especies de levaduras distintas (Tabla 1). Sin
embargo, 24 aislados no se lograron identificar a nivel de especie mediante este marcador.
Por ello se utilizó un segundo marcador, que corresponde a la región D1/D2 del DNA
ribosómico, el cual fue amplificado y secuenciado utilizando los partidores LR3 y F63. Se
logró identificar 7 levaduras a nivel de especie (Tabla 1). En total se identificaron 17
especies de levaduras diferentes utilizando ambas regiones de DNA ribosómico, de las
cuales 9 no se han reportado previamente desde el territorio antártico.
Tabla 1. Levaduras identificadas a nivel molecular .
Especies identificadas
Usando rDNA ITS1-5.8S-ITS2.
Leucosporidium antarcticum
Mrakia psychrophilia
Leucosporidiella creatinivora
Sporidiobolus salmonicolor
Wickerhamomyces anomalus
Candida sake
Cryptococcus terricola
Cryptococcus gastricus
Cryptococcus victoriae
Metschnikowia bicuspidata
Mrakia robertii
Mrakia blollopis
Rhodotorula laryngis
Usando rDNA D1/D2
Cryptococcus gilvescens
Cryptococcus watticus
Rhodoturula glacialis
Nº de aislados
pba
Cobertura , % identidadb
3
4
9
24
3
1
1
1
2
1
1
1
3
579
595
603
544
505
411
618
611
506
370
614
624
551
579/579 ; 100
595/595 ; 100
600/601 ; 99
544/544 ; 100
505/505 ; 100
410/411 ; 99
612/618 ; 99
611/611 ; 100
506/506 ; 100
338/375 ; 90
613/614 ; 99
624/624 ; 100
546/548 ; 99
3
1
2
559 559/559 ; 100
368 368/368 ; 100
603 598/603 ; 99
ϲϱ
Dioszegia crocea
1
612 608/612 ; 99
a
Largo productos de amplificado.
Homología con respecto a la secuencia GenBank más cercana.
Para los estudios de actividad antibiótica, se seleccionó al menos un aislado de cada una de
las especies de levaduras identificadas. Para realizar los ensayos, primero fue necesario
determinar el rango y temperatura óptima de crecimiento para cada aislado. Se evaluó el
crecimiento para cada una de las levaduras identificadas, sembrándolas en placas YM
suplementadas con glucosa 2% a seis temperaturas diferentes (4, 10, 15, 22, 30 y 37°C). Se
registró a diario el aumento del diámetro de cada colonia (Figura 1B) comparándose con el
diámetro de estas al momento de iniciar el ensayo (Figura 1A), para cada una de las
temperaturas ensayadas.
Se definió la temperatura óptima de crecimiento para cada levadura como la temperatura a
la cual alcanzó el máximo diámetro. Interesantemente la mayoría de las levaduras
presentaron temperaturas óptimas de crecimiento entre 10 y 22°C. No se obtuvo ninguna
especie de levadura que tuviera temperatura óptima de crecimiento a 4°C, incluso algunas
tuvieron tasas óptimas de crecimiento a 30 y 37°C (Figura 1C).
b
Figura 1. Temperatura optima de crecimiento. Las levaduras fueron sembradas en placas YM- glucosa 2%
e incubadas a diferentes temperaturas. Se muestra como ejemplo placas incubadas a 10ºC por 0 (A) y 3 (B)
días. En C se muestras las temperaturas óptimas de crecimiento para diferentes levaduras.
Figure 1. Optimum temperature for growth. Yeasts were grown in YM- 2% glucose plates and incubated at
different temperatures. As example, plates that were incubated at 10°C for 0 (A) and 3 (B) days are shown. In
C we show the optimal growth temperature for different yeasts.
ϲϲ
Estudios previos han demostrado que distintas levaduras ambientales producen sustancias
que inhiben el crecimiento de otros microorganismos (MacWilliam, 1958; Jefferys y cols.,
1953; McCormack y cols., 1994). Se evaluó la existencia de actividad antibiótica de los
aislados antárticos contra diferentes bacterias, principalmente Gram negativas, y en ensayos
cruzados entre las distintas levaduras. Para los ensayos se confeccionaron “césped
celulares" mezclando 25 ml de medio fundido, 250 µl de 0,3% de azul de metileno y 2,5 ml
de cultivo celular (~ 107 células/ml), el cual fue vertido sobre una placa de Petri. Las
levaduras se sembraron sobre el césped y se incubaron a diferentes temperaturas, hasta el
desarrollo de las colonias. Colonias con actividad antimicrobiana muestran un precipitado
de azul de metileno (halo de muerte) que les rodea (Baeza y cols. 2010). Los ensayos
fueron realizados a la temperatura optima de crecimiento de cada levadura. Levaduras
pertenecientes a los géneros Mrakia y Cryptococcus no presentaron actividad antibiótica
contra las bacterias ensayadas, mientras que la levadura Leucosporidiella creatinivora
(Figura 2A) y especies de levaduras pertenecientes a los géneros Dioszegia y Rhodotorula
presentaron esta actividad contra las bacterias Gram (-) ensayadas. Se obtuvieron extractos
proteicos extracelulares desde cultivos líquidos de las levaduras que presentaron actividad
antibiótica, con el fin de relacionar si este efecto antibacteriano se debe a algún factor
proteico secretado al medio extracelular. Para la determinación de la actividad
antimicrobiana de estos extractos de proteínas, se depositó 100 µl de extracto en pocillos
(10 mm de diámetro) cortados en el césped celular. Los extractos de proteínas obtenidos
generaron halos de muerte al ser sembrados sobre los césped bacterianos, en cambio los
extractos proteicos
A denaturados (10 min aB65ºC) no generaron estos halos (Figura 2B).
Estos resultados sugieren que existe un factor de naturaleza proteica, secretado por estas
levaduras, que es capaz de matar a bacterias Gram (-). Serán necesarios otros tipos de
estudios para poder identificar esta proteína.
Ϯ
ϯ
ϭ
Figura 2. Ensayos de actividad antibiótica. A) Ensayo de colonia de levadura sobre el césped bacteriano. B)
Ensayo de extracto de proteico extracelular (100 µl, en un pocillo de 1 cm de diámetro) sobre el césped
bacteriano. 1, extracto sin tratar; 2, extracto incubado previamente por 10 min a 65ºC; 3 control sin extracto.
La fecha indica el halo de muerte (precipitado azul de metileno).
Figure 2. Antibiotic activity assay. A) Assay of yeast colony onto bacterial lawn. B) Test of extracellular
protein extract (100 µl, in a well of 10 mm in diameter) on the bacterial lawn. 1, untreated extract; 2, extract
previously incubated for 10 min at 65°C, 3 control without extract. The arrow indicates the halo of death
(methylene blue precipitate).
ϲϳ
En los ensayos de actividad cruzada entre las levaduras antárticas, se obtuvieron resultados
positivos en levaduras pertenecientes a distintos géneros. Levaduras de los géneros
Dioszegia, Mrakia y Rhodotorula mostraron los espectros de actividad más amplios. Un
resultado interesante fue la existencia de diferencias interespecíficas en cuanto a la
actividad micocida que presentaron especies dentro de un mismo género. Por ejemplo: dos
especies dentro del género Mrakia, que no se lograron identificar a nivel de especie,
presentaron actividad sobre levaduras pertenecientes a los géneros Rhodotorula y
Cryptococcus, en cambio las especies psychrophilia, robertii y blollopis no presentaron
actividad sobre levaduras de estos géneros. Estas diferencias interespecíficas en cuanto a
actividad micocida sugieren la futura utilización de estos tipos de ensayos para diferenciar
levaduras que no se han logrado diferenciar a través de taxonomía clásica de levaduras y
métodos moleculares como los que se emplearon en este trabajo.
AGRADECIMIENTOS
Al instituto chileno antártico que a través de su proyecto T-23-09 financió este trabajo.
REFERENCIAS
•
•
•
•
•
Baeza, M. Flores, O. Carrasco, M. Rozas, J. Oviedo, V. Barahona, S. y Cifuentes, V. 2010. The
Inter-generic Fungicidal Activity of Xanthophyllomyces dendrorhous. The Journal of Microbiology.
48(6): 822-828.
Jefferys, E. Brian, W. Hemming, H. y Lowe, D. 1953. Antibiotic Production by the Microfungi of
Acid
Heath Soils. J . gen. Microbiol. 9: 314-341.
MacWilliam, I. 1959. A Survey of the Antibiotic Powers of Yeasts. J . gen. Microbiol. 21: 410-414.
McCormack, P. Howard, T. WILDMAN, G. y Jeffries, P. 1994. Production of Antibacterial
Compounds by Phylloplane- Inhabiting Yeasts and Yeastlike Fungi. Applied and Environmental
Microbiology. 60(3): 927-931.
ϲϴ
INTERACCIONES POSITIVAS ENTRE UNA CARPETA DE
MUSGOS Y EL PASTO ANTARTICO DESCHAMSPIA
ANTARCTICA EN ISLA ROBERT
(Positive plant interaction between the moss carpets of Sanionia uncinata
and the antarctic hairgrass Deschampsia antarctica in Robert island)
Casanova-Katny, M. A.1 & Cavieres L.2, 3
2
1
Centro de Biotecnología, Universidad de Concepción
Departamento de Botánica, Universidad de Concepción,
Concepción, Chile
3
Instituto de Ecología y Biodiversidad (IEB),
Santiago, Chile
The vegetation of the Antarctic Tundra is dominated by mosses and lichens but
Deschampsia antarctica, the antarctic hairgrass, is one of two vascular plant species which
is forming permanent populations along the west coast of the Antarctic Peninsula.
However, little is known about its recruitment and interaction with non-vascular tundra
plants. Although several authors propose that tolerance and/or competition should be the
main forms of interaction between moss carpets and D. antarctica, no relevant studies exist
so far. We investigated if D. antarctica is positively associated to the moss carpet in Robert
Islands. We measured frequency, number and size of D. antarctica tussocks in moss carpets
and bare ground areas were measured. Across all sites studied, D. antarctica showed
significant association to moss carpets, with more and larger individuals than on bare
ground.
The detected positive interactions with mosses seem to be important for the expansion of D.
antactica, raising the question about their importance of the moss carpets for recruitment
and colonization under future climate change scenarios.
INTRODUCCIÓN
La tundra antÁrctica es una de los ecosistemas más extremos en el mundo, donde sólo
musgos, líquenes y dos especies vasculares han sido capaces de sobrevivir y establecer
poblaciones permanentes. Deschampsia antarctica Desv. (Poaceae) and Colobanthus
quitensis (Kunth) Bartl. (Caryophyllaceae) a lo largo de la costa oeste de la Peninsula
Antártica y las islas adyacentes(Komárková et al. 1985; Komárková et al. 1990). Sin
embargo, aunque la capacidad de pioneros y colonizadores, poco se sabe de la ecología de
estas especies y de su reclutamiento e interacciones con las otras especies que componen la
tundra. Se ha documentado, que en ambientes extremos es frecuente encontrar
interacciones positivas entre especies vasculares (Brooker 2006). En este sentido, los
musgos son el grupo más diverso en las Islas Shetland del Sur (Ochira 2008) y se conoce
que en la tundra ártica presentan diversos tipos de interacción con las especies vasculares,
las que fluctúan desde competencia hasta facilitación (Gornall et al. 2007). Es en este
contexto, nuestro objetivo fue establecer qué tipo de asociación existe entre la carpeta de
musgos y Deschampsia antartica.
MATERIALES Y MÉTODOS
El trabajo se realizó en la temporada 2009. Para este estudio se visitaron diversas sitios en
la isla Robert (62º24'S, 59º30'W), donde se lanzaron para cada sitio entre 20 y 35
ϲϵ
cuadrantes de 1m2 al azar, para determinar frecuencia y número de plantas de D. antarctica
creciendo sobre carpetas de musgos y en suelo sin musgo.
RESULTADOS
Se encontró una mayor frecuencia de cuadrantes con D. antarctica en las carpetas de
musgos que en suelo sin musgos (fig. 1), así como un mayor número de plantas en los
cuadrantes sobre carpetas de musgos (fig. 2). Las carpetas de musgos están preferentemente
dominadas por Sanionia uncinata y además se encuentra Synthrichia princeps y
Polytrichastrum alpinum.
&ƌĞĐƵĞŶĐŝĂ
ĐĂƌƉĞƚĂĚĞ
ŵƵƐŐŽƐ
EƷŵĞƌŽĚĞƉůĂŶƚĂƐ
FIGURA 1. Frecuencia de cuadrantes con presencia de plantas de D. antarctica en carpetas de musgos y
suelo sin musgo (n=135).
ĐĂƌƉĞƚĂĚĞ
ŵƵƐŐŽƐ
FIGURA 2. Número de plantas de D. antarctica en cuadrantes en carpetas de musgos y suelo desnudo.
Valores son promedios (n= 135) + ES.
ϳϬ
DISCUSIÓN Y CONCLUSIONES
En conclusión, estos primeros resultados muestran que D. antarctica se asocia
positivamente a carpetas de musgos en la isla Robert. Sin embargo, no se conoce como
favorece el musgo esta interacción. Esto plantea una serie de interrogantes acerca del rol
que juega la carpeta de musgos en el reclutamiento de plantas en la Antártica. Los primeros
resultados experimentales en la Peninsula Fildes indicarían que los musgos favorecen el
crecimiento de plántulas de D. antarctica. Claramente se requieren más estudios y de largo
plazo que permitan conocer la ecología de la planta, así como sus interacciones con los
componentes de la tundra en los diversos microclimas antárticos.
AGRADECIMIENTOS
Proyecto Financiado por INACH T0307.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
Brooker RW (2006) Plant-plant interactions and environmental change. New Phytologist 171:271284.
Gornall JL, Jonsdottir IS, Woodin SJ, Van der Wal R (2007) Arctic mosses govern below-ground
environment and ecosystem processes. Oecologia 153:931-941
Komárková V, Poncet S, Poncet J (1985) Two native Antarctic vascular plants, Deschampsia
antarctica and Colobanthus quitensis: a new southernmost locality and other localities in the
Antarctic peninsula area. . Arctic Alpine Research 17:401-416.
Komárková V, Poncet S, Poncet J (1990) Additional and revisited localities of vascular plants
Deschampsia antarctica Desv. and Colobanthus quitensis (Kunth) Bartl in the Antarctic Peninsula
Area. Arctic and Alpine Research 22:108-113.
ϳϭ
DESCHAMPSIA ANTARCTICA UNDER GLOBAL WARMING:
HOW LONG WE NEED TO OBSERVE PLANT RESPONSES?
(Deschampsia antarctica bajo calentamiento global: ¿cuánto tiempo se
necesita para observar las respuestas de las plantas?)
Casanova-Katny A.1, Heredia R.2 & Torres-Mellado G.3
1
3
Centro de Biotecnología, Universidad de Concepción
2
Colegio Concepción, Sede Chillán
Departamento de Botánica, Universidad de Concepción
The Antarctic Peninsula has experienced the highest temperature increase during the last 50
years. During this time, several changes have been documented in the terrestrial biota. The
Antarctic tundra, composed and dominated by lichens and mosses includes only two native
vascular plants (the hairgrass Deschampsia antarctica and the pearlworth Colobanthus
quitensis), whose populations have been positively affected by the amelioration of cold
temperatures. However few experimental data suggest that the hairgrass do not increase its
growth rate under increasing temperatures even after four years of experimental
manipulations. To evaluate plant responses under microclimatic conditions of the South
Shetland Islands, passive warming experiments were carried out in situ in Fildes Peninsula,
King George Island, during two seasons. We installed ten open top chambers (OTC) on an
herb tundra community dominated by Deschamspia antarctica. During the first season no
significant growth responses were observed. However during the second season, the
hairgrass produced significantly more spikes per plant inside than outside OTCs, many of
them in advanced state of anthesis. However vegetative growth was not enhanced in adult
plants under warming, whereas in warmed seedlings during one season a significant size
increase was found. The results suggests that the effect of plants is dependent on ontogeny
and that biomass allocation change under warming, increasing reproductive growth, with
more seeds compared with control plants. These changes could explain the increasing size
of natural populations observed in the west Coast of the Antarctic Peninsula. Clearly,
responses to warming experiments carried out under natural conditions are variable
according to microclimatic conditions and other environmental characteristics like soil
nutrients and water content. Long term experiments are a realistic approach to understand
those variability and adaptations.
INTRODUCCIÓN
El calentamiento climático global que afecta la Península Antártica ha sido el más alto que
se ha observado respecto de los eventos a nivel mundial, con un incremento en la
temperatura de casi 0,7°C por década, desde que se tiene registros climáticos continuos en
la zona antártica (Turner and Overland 2009; Turner et al. 2007). Este calentamiento ha
tenido efectos notorios sobre la biota terrestre, que en cuanto a la flora está formada por la
Tundra Antártica. La tundra está compuesta y dominada por criptógamas (por musgos y
líquenes) y por dos plantas vasculares nativas, Deschampsia antarctica y Colobanthus
quitensis. Las dos plantas han mostrado un aumento de sus poblaciones en su rango de
distribución en la costa oeste de la Península Antártica durante las 4 pasadas décadas
(Fowbert and Smith 1994; Gebauer et al. 1987; Gerighausen et al. 2003; Parnikoza et al.
2009; Smith 1990; Smith 1994; Torres-Mellado et al. 2011), cambios que han sido
atribuidos al incremento de las temperaturas asociadas al calentamiento climático. Sin
ϳϮ
embargo, pocos estudios han abordado las respuestas de las plantas al calentamiento
climático in situ. Estudios recientes muestran que D. antartica no aumenta
consistentemente su biomasa incluso después de cuatro estaciones de crecimiento bajo
calentamiento, no así C. quitensis que presenta una mejor respuesta (Day et al. 1999; Day et
al. 2009; Day et al. 2008)). Tampoco se conoce si la respuesta de las plantas en distintos
estado de desarrollo es la misma frente al calentamiento. En este contexto nuestro objetivo
fue evaluar las respuestas de crecimiento tanto vegetativo como reproductivo de plantas
adultas, así como la supervivencia y crecimiento de plántulas de D. antarctica crecidas en
cámaras de calentamiento pasivo (open top chamber, OTC) respecto de plantas en
condiciones naturales.
MATERIALES Y MÉTODOS
Durante la temporada de crecimiento del año 2008 se instalaron OTC en la Península
Fildes, Isla Rey Jorge, para evaluar las respuestas de Deschampsia antartica. Las cámaras
poseen un diseño hexagonal abierto de placas de acrílico, utilizado internacionalmente en
experimentos de calentamiento. Además se instalaron registradores de temperatura HOBO
tanto al interior como al exterior de las cámaras. Se instalaron 10 cámaras sobre 3-6 plantas
adultas en su interior naturalmente crecidas. El tamaño de las plantas fue medido al inicio
del experimento, así como durante dos temporadas (2009 y 2010) de crecimiento. En un
experimento separado se trasplantaron plántulas compuestas de sólo un macollo
provenientes de plantas madres de similares características, tanto a cámaras de
calentamiento como a sitios controles sin cámaras, para evaluar supervivencia y
crecimiento después de un año de tratamiento.
RESULTADOS Y DISCUSIÓN
Durante el primer año de crecimiento bajo calentamiento pasivo, las plantas de D.
antarctica mostraron un crecimiento mayor estadísticamente no significativo (no
mostrado). Durante el segundo año, se aprecia un aumento significativo del número de
macollos reproductivos abiertos y cerrados (referidos a aquellos que han comenzado la
antesis) (Fig. 1), con cambios no significativos en el número de macollos totales que
incluyen los macollos vegetativos (Fig. 2).
ϳϯ
Figura 1. Macollos reproductivos abiertos (inicio antesis) y cerrados presentes en plantas de Deschampsia
antarctica crecidas durante dos años bajo calentamiento pasivo in situ en Peninsula Fildes. Valores son
promedios + EE (n= 6).
Figure 1. Open (beginning of anthesis) and closed reproductive tillers of Deschampsia antarctica plants
grown for two years under in situ passive warming in Fildes Peninsula. Values are means + SE (n=6).
Los resultados del trasplante de plántulas muestran cambios no significativos en la
supervivencia comparando los tratamientos con cámaras y sin cámaras, sin embargo el
crecimiento de las plántulas fue mejorado bajo calentamiento.
ϯϱϬ
EƷŵĞƌŽĚĞŵĂĐŽůůŽƐƚŽƚĂů
ϯϬϬ
ϮϱϬ
ϮϬϬ
ϭϱϬ
ϭϬϬ
ϱϬ
Ϭ
Kd
KEdZK>
Figura 2. Macollos totales de plantas de Deschampsia antarctica crecidas durante dos estaciones bajo
calentamiento pasivo in situ en Península Fildes. Valores son promedios + EE (n=6).
Figure 2. Total tillers in Deschampsia antarctica plants grown for two seasons under in situ passive
warming in Fildes Peninsula. Values are means + SE (n=6).
Los resultados indican que el calentamiento afecta positivamente el crecimiento de las
plantas de D. antarctica, sin embargo, este efecto es principalmente dado por el incremento
de los macollos reproductivos, los que producen finalmente semillas. Al respecto, las
semillas producidas son muy escasas y en más de un 50% las espiguillas son vanas. Más
aún, es probable que la falta de semillas viables se deba a la época de cosecha, más que al
calentamiento, dado que se ha descrito para D. antarctica creciendo en Isla Signy, que las
semillas requieren al menos 18 meses para su completo desarrollo.
Por otro lado, el estudio de trasplante muestra que la supervivencia no ha sido afectada por
el calentamiento, pero que las plántulas bajo calentamiento crecen más. Esto implica que
estas plántulas pueden enfrentar de mejor forma el invierno, guardando una mayor cantidad
de fotoasimilados de reserva, los que permiten a la temporada siguiente tener una mayor
tasa de crecimiento.
ϳϰ
CONCLUSIONES
Se concluye que el calentamiento global tiene un efecto positivo sobre el crecimiento de las
plantas de D. antarctica.
Sin embargo, el efecto puede ser mayor en algunos estadios ontogenéticos, como las
plántulas, en que mejores condiciones aseguran su supervivencia.
En plantas adultas, el calentamiento ha afectado la asignación de recursos entre el
crecimiento vegetativo y reproductivo, favoreciéndose este último.
Se resalta la relevancia de estudios de largo plazo para evaluar el efecto del calentamiento
global sobre la flora nativa antártica, ya que como muestran nuestros resultados, el impacto
mayor se vio sobre el segundo año de calentamiento. Otros parámetros, como producción
de semillas viables, podrían requerir aún más tiempo para mostrar respuestas.
AGRADECIMIENTOS
Se agradece especialmente Ricardo Ávila Rodrigo Enríquez y Walter Chaperón, alumnos
del Colegio Concepción, sede Chillán, quienes analizaron las estructuras de las plantas
como parte de un proyecto para presentar a la Feria Antártica Escolar (FAE) organizada por
INACH. Financiado por INACH T0307.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
Day TA, Ruhland CT, Grobe CW, Xiong F (1999) Oecologia 119:24-35
Day TA et al. (2009) Global Change Biology 15:1640-1651
Day TA, Ruhland CT, Xiong FS (2008) Global Change Biology 14:1827-1843
Fowbert JA, Smith RIL (1994) Arctic and Alpine Research 26:290-296
Gebauer A, Peter HU, Kaiser M (1987) Wissenschaftliche Zeitschrift der Friedrich SchillerUniversitat Jena. Naturwissenschaftliche Reihe 36:505-515
Gerighausen U, Bräutigam K, Mustafa O, Peter HU (2003) Antarctic biology in a global context.
Backhuys, Leiden, pp 79–83
Parnikoza I et al. (2009) Global Change Biology 15:1685-1693
Smith RIL (1990) In: Kerry KR, Hempel G (eds) Antarctic Ecosystems. Springer-Verlag, Berlin
Smith RIL (1994) Oecologia 99:322-328
Torres-Mellado GA, Jaña R, Casanova-Katny MA (2011) Polar Biology:(In press)
Turner J, Overland J (2009) Polar Research 28:146-164
Turner J, Overland JE, Walsh JE (2007) International Journal of Climatology 27:277-293
ϳϱ
MOVIMIENTOS MIGRATORIOS DE LAS BALLENAS
JOROBADAS Megaptera novaeangliae ENTRE EL ECUADOR,
ESTRECHO DE MAGALLANES–CHILE Y LA ANTÁRTICA
(1992-2008)
(Migratory movements of humpback whales Megaptera novaeangliae
between Ecuador, Strait of Magellan-Chile and Antarctic (1992-2008))
Castro C.1, Acevedo J.2, Aguayo-Lobo A. 3, Allen J. 4, Dalla Rosa L.5, Forestell P.6,7, Kaufman G.6, Olavarria
C., Scheidat M.8, Secchi E. R.5& Santos M.9
1
Pacific Whale Foundation-Ecuador, Asunción 529 y Av. América, Edificio Cajiao. 4to.piso. Quito, Ecuador,
2
Fundación Centro de Estudios del Cuaternario. Avda. Bulnes 01890, Punta ArenasChile
3
Instituto Antártico Chileno, Depto. Científico. Plaza Muñoz Gamero 1055, Punta Arenas, Chile
4
College of the Atlantic. 105 Eden Street, Bar Harbour, ME 04609, USA.
5
Laboratório de Tartarugas e Mamíferos Marinhos. Universidade Federal do Rio Grande, Brazil
6
Pacific Whale Foundation, 300 Ma’alaea Rd., Suite 211, Wailuku, HI, USA 96793.
7
Long Island University, 720 Northern Blvd., Brookville, New York, USA 11548
8
Institute for Marine Resources and Ecosystem Studies, P.O. Box 167, 1790 AD Den Burg.
9
The Netherlands, Laboratório de Biologia da Conservação de Mamíferos Aquáticos, Universidade de São Paulo, Brazil
Las ballenas jorobadas son animales migratorios. Viajan cada año desde sus áreas de
alimentación ubicadas en los polos (Ártico y Antártica) hacia las áreas de reproducción en
los trópicos (Matthews, 1937). El Ecuador es parte de una gran área de reproducción de
ballenas jorobadas Megaptera novaeangliae, del pacífico Sudeste, conocida como Stock G
(IWC) que se extiende desde Costa Rica (Acevedo and Smultea, 1995; Rasmussen et al.
2007), Panamá (Flórez-González et al., 1998; Rasmussen et al. 2007), Colombia (FlórezGonzález, 1991), Ecuador (Scheidat et al., 2000; Félix & Haase, 2001) y recientemente se
conoce que se amplía hasta Perú (Pacheco et al. 2009; 2011; Castro et al. 2011).
Se ha comprobado que el área de alimentación de las jorobadas del stock G se extiende
desde la Península Antártica hasta el Estrecho de Magallanes en Chile (Stevick et al 2004
& Acevedo et al. 2008). Adicionalmente, se han descrito las conexiones entre ciertos
lugares del área de reproducción G, al Estrecho de Magallanes y la Antártica (Stone et al.
1990; Florez-Gonzalez et al. 1998; Acevedo et al. 2007; Rassmusen et al. 2007; Castro et
al. 2008; Capella et al. 2008). Este documento amplia y actualiza la información sobre las
áreas de alimentación de las jorobadas y analiza en frecuencias las conexiones entre
Ecuador, Estrecho de Magallanes y la Antártica. Estos resultados son basados en la
identificación individual de las colas de las ballenas jorobadas esfuerzo realizado por
muchos investigadores, ONG´s e instituciones gubernamentales en Latinoamérica.
MATERIALES Y MÉTODOS
Las ballenas jorobadas fueron fotografiadas e identificadas a través de las marcas naturales
o adquiridas y permanentes ubicadas en la parte ventral de la cola (Katona et al., 1979).
Diferentes grupos de investigadores en Ecuador, Chile y la Antártica hicieron viajes
sistemáticos desde embarcaciones de turismo y buques de investigación entre 1992 al 2008.
Para el presente estudio, se han considerado cinco catálogos de foto-identificación de
ballenas jorobadas: Instituto Antártico Chileno (INACH), Proyecto Antártico Brasileño
(PROANTAR), College of the Atlantic (COA), Centro de Investigación del Cuaternario
(CEQUA) y Fundación Ballenas del Pacífico (PWF). El área de investigación en la
Antártica fue desde 53°S al 63°S - 61°al 72° W. En el Estrecho de Magallanes desde 54°S-
ϳϲ
74°W y en Ecuador en el Parque Nacional Machalilla se incluyen observaciones en la
Reserva Marina Costera Península de Santa Elena (01°S al 02°S - 81°W).
En la Península Antártica se han analizado tres catálogos (PROANTAR, INACH y COA),
con un total de 689 fotografías tomadas por diferentes grupos de investigadores entre 1992
y 2007. En el Estrecho de Magallanes en Chile se analizo un catálogo del CEQUA, con un
total de 78 fotos tomadas entre el 2003 y 2007. Y en Ecuador el catálogo de la PWF, con un
total de 1302 fotografías tomadas entre 1996 hasta el 2008 (Ver Tabla No. 1). Solamente
las fotografías con calidad media y alta han sido consideradas para el presente estudio. En
el caso de re-observar las ballenas, las fotografías fueron sometidas a los autores de las
mismas para confirmar la recaptura.
RESULTADOS
Se analizaron en total 1991 ballenas foto-identificadas (1302 en Ecuador, 78 en Chile y 611
en la Antártica) a través de su cola. Se encontraron 64 jorobadas identificadas entre
Ecuador y sus áreas de alimentación. El 92% (n= 59) de ballenas jorobadas fueron reobservadas en la Antártica (Área I y II, IWC). Y apenas el 7,8% (n= 5) fueron
recapturadas a través de las fotografías de sus colas en el Estrecho de Magallanes (Ver
Tabla No. 1).
AREA DE
REPRODUCCION
AREA DE
ALIMENTACION
LUGAR
#
CATALOGOS
AÑOS
# ANIMALES
COMPARADOS
# ANIMALES
REOBSERVADOS
ECUADOR
1 CATALOGO
1996 - 2008
1302
64
CHILE
1 CATALOGO
3
CATALOGOS
2003 - 2007
78
5
1992 - 2007
611
59
ANTARTICA
Tabla 1. Esfuerzo entre Ecuador, Estrecho de Magallanes y Antártica. Effort between Ecuador, Estrecho de
Magallanes and Antarctic.
De los 59 casos de ballenas jorobadas que migraron a la Antártica, la frecuencia de retorno
por años, evidencia que los mayores porcentajes de retorno son los años seguidos (Ver
Figura No. 1). El 20% (n=12) han sido observados al año de su primera observación. El
23,7% (n=14) han regresado al área después de dos años de su primera observación.
Dieciséis ballenas tienen una frecuencia de meses entre Ecuador y su área de alimentación
(Estrecho de Magallanes y la Antártica). La máxima frecuencia de retorno fue después de
12 años desde la Antàrtica. Quince ballenas jorobadas tienen múltiples observaciones en
diferentes años entre la Antártica y Ecuador. La ballena jorobada EC503 que fue observada
por primera vez el 18 de diciembre de 1992 en la Antártica (Catálogo COA), re-observada
en enero de 1996 (catálogo INACH), re-observada en enero del 2002 (catálogo
PROANTAR) y finalmente observada en Ecuador el 28 de julio del 2004 (Catálogo PWF).
La jorobada EC1309 fue observada por primera vez en marzo del 2003 en el Estrecho de
Magallanes y re-observada en el mismo lugar por varios años hasta el 2007. Fue
identificada en el Parque Nacional Machalilla el 23 de junio del 2008.
ϳϳ
EŽ͘ĂŶŝŵĂůĞƐ
ϭϲ
ϭϰ
ϭϮ
ϭϬ
ϴ
ϲ
ϰ
Ϯ
Ϭ
ϭϰ
ϭϮ
ϭϭ
ϳ
ϴ
ϲ
ϱ
ϯ
ϭ
Ϯ
ϯ
ϰ
ϱ
ϲ
ϳ
ϴ
ϯ
ϵ
Ϯ
ϭϬ
ϯ
ϭ
ϭϭ
ϭϮ
EŽ͘ĚĞĂŹŽƐŽďƐĞƌǀĂĐŝſŶĞŶƚƌĞĐƵĂĚŽƌLJůĂŶƚĄƌƚŝĐĂ
Figura 1. Frecuencia de retorno por años entre Ecuador y la Antártica. Rate of return for years between
Ecuador and the Antarctic
Tres ballenas (5%) observadas entre Ecuador y en la Antártica también han sido
observadas en Colombia. No se ha observado ninguna ballena jorobada entre Ecuador, la
Antártica y Costa Rica. Un solo animal ha sido identificado entre Ecuador, Colombia y el
Estrecho de Magallanes. Las ballenas identificadas en Ecuador han sido re-observadas en el
área I y II (IWC) en los siguientes sitios: Estrecho de Gerlache, Estrecho de Bransfield,
Paso Drake, Archipielago de Melchor, Mar de Wedell, Islas Orcadas, Whale Sound,
Tortuoso Passage, Canales de Jerónimo y Barbara.
DISCUSIÓN Y CONCLUSIONES
El presente estudio confirma que el sitio de alimentación de ballenas jorobadas del Stock G
(IWC), del área frente a las costas del Ecuador es la Antártica. Confirmado con el 92%
de animales recapturados con esta área. Además, el 23,7% (n=14) de animales que
migraron a la Antártica tienen una conexión directa anual con el Ecuador. Sin embargo el
área de alimentación estaba limitada a la Península Antártica. Este estudio podría sugerir
que las ballenas identificadas en Ecuador tienen sitios más amplios de alimentación hasta el
Mar de Wedell y las Islas Orcadas. Curiosamente la ballena jorobada identificada en marzo
del 2003 y con observaciones múltiples anuales hasta 2007 en el Estrecho de Magallanes ha
sido re-observada en Ecuador una sola ocasión en junio del 2008. La información fortalece
la hipótesis que las ballenas podrían mantener fidelidad a ciertas áreas de alimentación y
reproducción y posiblemente durante los meses de mayo y junio el Ecuador es un corredor
de migración para las ballenas que van más al norte. Conocemos todavía poco sobre los
corredores marinos de migración y los movimientos entre áreas de alimentación y
reproducción. Necesitamos ampliar los esfuerzos de investigación durante los meses de
mayo y junio y comparar otros catálogos de la región. Se han comparada fotos de la
Antártica con Ecuador con 16 años de distancia (1992-2008). El 20% (n=12) de animales
identificados entre Ecuador y la Antártica, han sido observados en Ecuador después de 8, 9,
10, 11 y hasta 12 años después de su primera observación.
Los resultados de este estudio aportan nuevos destinos migratorios de las poblaciones de
ballenas jorobadas del Ecuador a la Antártica. Y fortalecen el conocimiento de las mismas.
Sugerimos priorizar programas de conservación de las poblaciones de jorobadas y
ecosistemas en el Santuario Antártico, ya que las jorobadas se han convertido en recursos
compartidos por varios países, los cuales mantienen actividades sostenibles como por
ϳϴ
ejemplo el turismo observador de ballenas en Ecuador, base de la economía de miles de
pobladores de la costa ecuatoriana.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Acevedo A and Smultea MA (1995) First records of humpback whales including calves at Golfo
Dulce and Isla del Coco, Costa Rica, suggesting geographical overlap of northern and southern
hemisphere populations. Marine Mammals Science 11: 554-560
Acevedo J, Rasmussen K, Félix F, Castro C, Llano M, Secchi E, Saborío M, Aguayo-Lobo A, Haase
B, Scheidat M, Dalla-Rosa L, Olavarría C, Forestell P, Acuña P, Kaufman G and Pastene LA (2007).
Migratory destinations of humpback whales from the Magellan Strait feeding ground, Southeast
Pacific. Marine Mammal Science 23(2): 453-463.
Castro, C., Acevedo, J., Allen, J., Dalla Rosa, L., Flórez-González, L., Aguayo-Lobo, A.,
Rasmussen, K., Llano, M., Garita, F., Forestell, P., Sexy, E.R., García-Godos, I., Ferrina, D.,
Kaufman, G., Scheidat, M., and Pastene, L.A. 2008. Migratory movements of humpback whales
(Megaptera novaeangliae) between Machalilla Nacional Park, Ecuador and Southeast Pacific. Paper
SC/60/SH presented to the 60th Scientific Committee of the International Whaling Commission.
Santiago, Chile, June 2008. 6p.
Castro, C., Alcorta, B., Allen, J., Caceres, C., Forestell, P., Kaufman, G., Mattila, D., Pacheco, A.S.,
Robbins, J., Santillan, L., Scheidat, M., Silva, S. and Tagarino, A. Comparison of the humpback
whale catalogues between Ecuador, Peru and American Samoa. Evidence of the enlargement of the
Breeding Stock G to Peru. International Whaling Commission, Tromso, Norway. SC/63/SH19.
Capella, J., J. Gibbons, L. Flórez-González, M. Llano, C. Valladares, V. Sabaj & Y. Vilina 2008.
Migratory round-trip of individually identified humpback whales of the Strait of Magellan: clues on
transit times and phylopatry to destinations. Revista Chilena de Historia NaturalVol 81 No. 4.
Félix F and Haase B (2001) The humpback whale off the coast of Ecuador, population parameters
and behavior. Revista de Biología Marina y Oceanografía 36:61–74.
Florez -Gonzalez L., Capella J., Haase B., Bravo G.A., Felix F. and Gerrodette T. (1998). Changes in
Winter destinations and the most record of southeastern pacific humpback whales. Mar. Mammal
Sci. 14(1)189-96.
Mathews L.H. 1937. The humpback whale, Megaptera nodosa. Discovery Rep. 17 (7) 92.
Pacheco, A., Silva S. & Alcorta B. 2009. Winter Distribution And Group Composition Of
Humpback Whales (Megaptera Novaeangliae) Off Northern Peru. Lat. Am. J. Aquat. Mamm. 7(1-2):
33-38.
Pacheco, A., Silva S. & Alcorta B. 2011. Is it possible to go whale watching off the coast of Peru? A
case study of humpback whales. Lat. Am. J. Aquat. Res. 39(1): 189-196.
Scheidat M, Castro C, Denkinger J, González J and Adelung D (2000) A breeding area for
humpback whales (Megaptera novaeangliae) off Ecuador. Journal of Cetacean Research and
Management 2:165–172.
Stevick P, Aguayo-Lobo A, Allen J, Avila IC, Capella J, Castro C, Chater K, Dalla Rosa L, Engel
MH, Félix F, Flórez-González L, Freitas A, Haase B, Llano M, Lodi L, Muñoz E, Olavarría C,
Secchi E, Scheidat M and Siciliano S (2004) Migrations of individually identified humpback whales
between the Antarctic Peninsula and South America. Journal of Cetacean Research and Management
6: 109-113.
Stone G, Flórez-González L and Katona S (1990) Whale migration record. Nature 346: 705.
Rasmussen K, Palacios DM, Calambokidis J, Saborío MT, Dalla Rosa L, Secchi E, Steiger GH,
Allen J and Stone G (2007) Southern Hemisphere humpback whales wintering off Central America:
insights from water temperature into the longest mammalian migration. Biology Letters
doi:10.1098/rsbl.2007.0067.
Los investigadores agradecen la colaboración de operadores turísticos, instituciones gubernamentales
como el Ministerio de Ambiente en Ecuador, Brasil y Chile. En Ecuador la investigación fue
financiada por la PWF. En Chile y la Antártica por CEQUA y el Instituto Antártico Chileno y en
Brazil por el Brazilian Council for Scientific and Technological Development (CNPq) y la
Comisión para Recursos del Mar (CIRM)/Brazilian Navy.
ϳϵ
BACTERIAS CON ACTIVIDAD PROTEOLÍTICA Y
LIPOLÍTICA AISLADAS DESDE EL TERRITORIO
ANTÁRTICO CHILENO
(Protelytic and Lipolytic isolated from the Chilean Antarctic territory)
Cid-Ramírez, K.1,2, Fernández, E.2, Bello, H.2, Domínguez, M.2 & González-Rocha, G.2
2
1
Estudiante de Biología. Facultad de Ciencias Naturales y Oceanográficas. Universidad de Concepción
Laboratorio de Investigación en Agentes Antibacterianos. Departamento de Microbiología. Facultad de Ciencias Biológicas. Universidad
de Concepción. Barrio Universitario s/n. Concepción. Chile. e-mail: [email protected]
La Antártica posee una microbiota bacteriana específica y adaptada a las condiciones
extremas del ambiente. Para hacer frente a estas condiciones, estos microorganismos han
desarrollado estrategias bioquímicas que les permiten sobrevivir a este hábitat. Estas
bacterias poseen enzimas que se caracterizan por tener una alta eficiencia a bajas
temperaturas, las cuales presentan una alta termosensibilidad, lo que puede ser una nueva
herramienta para uso biotecnológico. Estas enzimas tienen múltiples aplicaciones, tales
como síntesis de biopolímeros, biodiesel, agroquímicos, cosméticos, saborizantes (Haki et
al, 2003), como también el uso en detergentes, para la degradación de lípidos, fabricación
de ingredientes alimentarios, producción de pulpa-papel, industria farmacéutica para la
producción de drogas, etc. (Bajpai et al, 1999; Jaeger et al, 1999). Adicionalmente, se ha
investigado que estas enzimas pueden ser empleadas en la eliminación de desechos tóxicos
y se evalúa la utilización de estas bacterias en la extracción de petróleo en derrames
petrolíferos. Por las diversas aplicaciones biotecnológicas que pueden tener estas enzimas
ha aumentado el interés y la importancia de investigarlas. En este trabajo se investigó la
actividad lipolítica y proteolítica de cepas bacterianas aisladas desde el continente
Antártico.
MATERIALES Y MÉTODOS
Cepas bacterianas. Se trabajó con 147 bacterias aisladas de diferentes muestras en
diversos sectores de la península Fildes, isla Rey Jorge: playas Agathas (62 11' 40,4''S, 58
56' 8,7''W), península Ardley (62 12' 33,7''S, 58 56' 14,8''W), glaciar Collins (62 10' 9,5''S,
58 51' 7,1''W), lago Globokoe (62 11' 12,6''S, 58 54' 48,2''W), playa Elefantes Marinos (62
11'52,8''S, 58 59' 37,2''W) y río Jin Quan (62 13' 37,9''S, 58 57' 11,7''W) (figura 1) . La
recuperación de las cepas almacenadas a -80°C se realizó en caldo R2A (Reasoner &
Geldreich, 1985), para luego cultivarlas en agar R2A a 15°C durante 40 h.
ϴϬ
Figura 1. Sitios de muestreos en península Fildes.
Figure 1. Sample sites in Fildes peninsula.
Glaciar Collins (19), lago Globokoe (1-3), playa Agathas (20), playa Elefantes Marinos (4), península Ardley
(27, 29) y río Jin Quan (7, 8).
CARACTERIZACIÓN DE LAS CEPAS BACTERIANAS
Tinción Gram. Se utilizó el método de tinción de Gram modificado por Hucker y Conn
(1923). Se realizó frotis de las cepas bacterianas y se tiñó con cristal violeta de Hucker,
solución lugol para fijar, alcohol etílico como decolorante, y safranina como colorante de
contraste. Luego se visualizó en microscopio óptico y las cepas se catalogaron con Gram
positivas o Gram negativas.
Actividad proteolítica. Se preparó placas con 12 ml de agar caseína (15g/L de agar-agar,
más 0,2 g/L de leche en polvo descremada), una vez solidificado el agar caseína se agregó
sobre éste 12 mL de agar R2A (18,2 g/L). Se sembró un pequeño inóculo de cada cepa a
estudiar. Se utilizó 20 cepas por placa y como control negativo la cepa Escherichia coli SI
y control positivo una cepa de Pseudomonas aeruginosa. Los ensayos se realizaron con
réplicas y las placas se incubaron a 4°C y 15°C. Un resultado positivo de proteólisis se
evidenció por un halo transparente alrededor del crecimiento bacteriano.
Actividad lipolítica. Se preparó placas de agar tributirina (15 g/L de agar base tributirina)
y se adicionó tributirina (10 g/L de glicerina tributirato 99,9%). Se sembró un pequeño
inóculo de cada cepa, hasta un total de 20 por placa, se realizó en duplicado y se incubó a
4°C y 15°C. Un resultado positivo de actividad lipolítica se evidenció por un halo
transparente alrededor del crecimiento bacteriano.
ϴϭ
RESULTADOS
Afinidad tintorial de las cepas. La distribución de cepas Gram negativas y Gram positivas
entre las bacterias antárticas ensayadas se muestra en la Tabla 1. Por otra parte, la
distribución de las bacterias con actividad proteolítica y/o lipolítica, según lugar de
muestreo y tipo de muestra, se presentan en la Tabla 2.
Tabla 1. Distribución de bacterias antárticas proteolíticas y lipolítica según afinidad tintorial
Table 1. Distribution of proteolytic and lipolytic Antarctic bacteria according to Gram stain affinity
Actividad enzimática
Lipolítica
Proteolítica
Lipolítica y Proteolítica
número de cepas
Gram +
55
2
29
Gram 20
2
15
Total
74
4
44
Tabla 2. Distribución de bacterias antárticas proteolíticas y lipolítica según sitio de muestreo
Table 2. Distribution of proteolytic and lipolytic Antarctic bacteria according to the sample site
Zona
Playa Agathas
Península
Ardley
Península
Ardley
Península
Ardley
Glaciar Collins
Lago Globokoe
Lago Globokoe
Lago Globokoe
Playa
E.
Marinos
Playa
E.
Marinos
Rio Jin Quan
tipo
de
muestra
agua de mar
agua dulce
Nº
cepas
1
6
suelo
Sin
actividad
1
3
proteolí
-ticas
0
0
lipolítica +
proteolíticas
0
0
0
3
16
9
0
3
4
suelo
22
12
1
5
4
Deschampsia
sedimento
suelo
suelo
arena
27
10
18
17
19
17
5
5
7
8
1
0
0
0
1
6
5
8
9
6
3
0
5
1
4
agua dulce
3
2
0
0
1
sedimento
Total
8
147
5
74
1
4
2
44
0
25
lipolítica
DISCUSIÓN
Al estudiar la presencia de actividad proteolítica, se encontrarón 48 cepas de bacterias
antárticas con esta actividad enzimática, 118 cepas presentaron actividad lipolítica y 44
cepas demostraron poseer ambas actividades, tanto a 4°C como a 15°C. Sin embargo, se
ϴϮ
produjo diferencias en los diámetros de los halos de hidrólisis, con reducción a temperatura
de cultivo de 4°C en comparación con la de 15°C. Además, la diferencia en los halos de
actividad enzimática, puede ser producida por la menor temperatura que afecta
directamente la velocidad de reacción de las enzimas donde la velocidad de reacción se
incrementa al aumentar la temperatura (Mathews, 2004). Por otra parte, la disminución de
la temperatura puede alterar el crecimiento de las colonias bacterianas provocando una
reducción de la velocidad de reacción de las enzimas proteolíticas y lipolíticas
inhibiéndolas. Esto explicaría la diferencia de halos de proteólisis y lipólisis encontrados a
distintas temperaturas. Los resultados del control positivo fueron determinantes para
explicar el por qué es necesario utilizar estas bacterias psicrófilas, como las que habitan
zonas de temperaturas frías extremas, tal como la Antártica Chilena. P. aeruginosa no
presentó actividad proteolítica a temperatura de cultivo de 4°C ni a 15°C, sólo cuando se
cambió la condición de temperatura de incubación a 27°C se obtuvo hidrólisis de caseína
luego de 48 horas de cultivo. Esto demuestra que sólo es viable utilizar bacterias psicrófilas
o psicrotróficas cuando el ambiente al que se quiere exponer las bacterias o enzimas tiene
temperaturas entre 8°C y 18ºC. Las bacterias psicrotolerantes encontradas en zonas
extremas frías como la Antártica de Chile sirven de un muy buen reservorio de bacterias
productoras de moléculas interesantes, como estas proteasas y lipasas.
CONCLUSIÓN
En península Fildes, Isla Rey Jorge, es posible aislar una gran cantidad de bacterias con
actividad lipolítica y en menor proporción con actividad proteolítica, lo que constituye un
importante potencial de aplicación biotecnológica.
La actividad enzimática observada es más eficiente a los 15°C, lo que indicaría que estas
bacterias son preferentemente psicrófilas.
AGRADECIMIENTOS
Al INACH por el financiamiento del proyecto T-17-08 y apoyo logístico en terreno.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
Haki G. and Rakshit S. 2003. Developments in industrially important thermostable enzymes: a
review. Bioresour Technol., 89:17–34.
Bajpai, P. 1999. Application of enzymes in the pulp and paper industry. Biotec Prog 15: 147–157.
Hucker G. and Conn H. 1923. Methods of Gram staining. New York State Agricultural Experiment.
Station Technical Bulletin no. 93. Ithaca, NY: New York State Agricultural Experiment Station.
Jaeger K., Dijkstra B. and Reetz M. 1999. Bacterial biocatalysts: molecular biology, three
dimensional structures, and biotechnological applications of lipases. Rev Microb. 53: 315–351.
Mathews C., Holde K. and Ahern K. 2004. Bioquímica Tercera edición por Editorial Pearson.403406.
Reasoner, D.J. and Geldreich, E.E. 1985. A new medium for the enumeration and subculture of
bacteria from potable water. Appl. Environ. Microbiol. 49:1-7.
ϴϯ
CRECIMIENTO EN DIFERENTES CONDICIONES DE
CULTIVO DE BACTERIAS AISLADAS EN EL TERRITORIO
CHILENO ANTÁRTICO
(Growth in different culture conditions of bacteria isolated in the Chilean
Antarctic Territory)
Cid-Ramírez, K.1, 2, Bello, H.2, Domínguez, M.2 & González-Rocha, G.2
2
1
Estudiante de Biología. Facultad de Ciencias Naturales y Oceanográficas. Universidad de Concepción
Laboratorio de Investigación en Antibióticos. Departamento de Microbiología. Facultad de Ciencias Biológicas. Universidad de
Concepción. Barrio Universitario s/n. Concepción. Chile. E-mail: [email protected]
La Antártica posee uno de los ambientes más prístinos y poco explorado de la Tierra,
siendo el continente más elevado, con una altitud promedio de 2.000 msnm. Contiene cerca
del 80% de agua dulce del planeta, con el promedio de temperaturas más bajo del planeta;
sin embargo aún en estas inhóspitas condiciones se han encontrado diversos
microorganismos, que incluyen diatomeas, protozoos, flagelados y bacterias (Bowman et
al., 1997). Estos organismos presentes en el mar, sedimento, hielo y lagos de la Antártica,
se desarrollan bajo diferentes condiciones de temperatura, pH, salinidad, nutrientes,
disponibilidad de luz, etc., las cuales son imprescindibles para su desarrollo. Los
extremófilos son organismos especialmente adaptados para colonizar y sobrevivir en nichos
ecológicos hostiles, que poseen condiciones estresantes para la mayoría de los organismos.
Dentro de este grupo se encuentran las bacterias psicrófilas, las cuales están adaptadas a
crecer en medios extremadamente fríos, como son los encontrados en el continente
Antártico. Durante las últimas décadas el interés por estos organismos ha aumentado, ya
que poseen enzimas que permiten ciertas reacciones bioquímicas en las que una enzima
“habitual” generalmente no tendría la misma eficiencia, por lo que poseen gran importancia
científica y proyección biotecnológica. Sin embargo, la información referente a este tipo de
bacterias en el Territorio Chileno Antártico es escasa y poco se conoce acerca de las
condiciones óptimas de cultivo en el laboratorio.
El objetivo de esta investigación fue determinar la capacidad de crecimiento en el
laboratorio de bacterias antárticas heterótrofas cultivables, en diferentes condiciones físicoquímicas de cultivo y así determinar las condiciones óptimas, para su crecimiento,
aportando al conocimiento acerca de estos microorganismos antárticos. Esta información
será útil en futuras investigaciones que proyecten a estas bacterias y sus enzimas como
compuestos con potenciales aplicaciones biotecnológicas.
MATERIALES Y MÉTODOS
Cepas Bacterianas. Se utilizó 30 cepas bacterianas aisladas de diferentes tipos de muestras
(hielo, agua, suelo, etc.) recolectadas en Península Fildes, Isla Rey Jorge y Cabo Shirref,
Isla Livingstone, en campañas del Instituto Antártico Chileno (INACH) 2009 y 2010. Las
cepas se encontraban almacenadas a -80°C en crioviales con anillos de porcelana.
Crecimiento bacteriano en diferentes condiciones de cultivo
Temperatura. se preparó un inóculo de concentración equivalente a una turbidez de
McFarland 0,5 (aproximadamente 108 UFC/ml) para cada cepa, a partir de un cultivo de
toda la noche en caldo R2A (Reasoner & Geldreich, 1985). Luego se extrajo 4 µL de
cultivo y se adicionaron a tubos con 4 ml de caldo R2A obteniendo una concentración
ϴϰ
inicial de 105 UFC/ml. Los tubos se sellaron con parafilm®M y se incubaron a 4°C, 15°C,
30°C y 45°C. Se monitoreó el crecimiento desde el tiempo 0 por DO a 540 nm (Isaksen &
Jorgensen, 1996) en un espectrofotómetro COLEMAN cada 24 h, durante 6 días.
Determinada la temperatura óptima de crecimiento, ésta se utilizó para cultivar las cepas en
todos los otros experimentos.
pH: se utilizó R2A como medio de cultivo y se modificó el pH del caldo con HCl 1,2 M y
NaOH 12 N, para obtener los siguientes valores de pH: 4, 6, 7 y 9. Luego se utilizó un
inóculo similar al descrito anteriormente y los tubos se sellaron con la membrana
parafilm®M y se incubaron a la temperatura óptima determinada para cada cepa. Se
monitoreó el crecimiento por DO a 540 nm durante 6 días.
Salinidad. A caldo R2A se le adicionó NaCl para obtener concentraciones de 0%, 2%, 4% y
6% de NaCl. Para inocular los tubos y hacer el seguimiento se procedió de la misma forma
que en las otras condiciones de cultivo.
Crecimiento en anaerobiosis. Se sembró las cepas bacterianas en cuadrantes de placas de
agar R2A y se incubó en sistema de anaerobiosis Gas Pak®, a temperatura ambiente durante
9 días, realizando 2 réplicas por tratamiento.
RESULTADOS
Crecimiento en diferentes temperaturas. Todas las cepas se desarrollaron en el rango de
temperatura entre 4 y 30°C y la mayoría (23) fueron catalogadas como psicrófilas con
temperatura óptima de 15° C. Siete de las cepas ensayadas resultaron ser psicrótrofas, pues
su crecimiento fue más abundante (mayor DO) a temperatura de 30°C (Figura 1A y 1B).
No se observó desarrollo bacteriano cuando las cepas fueron cultivadas a 45ºC.
Crecimiento en diferentes pH. Para 27 cepas se determinó que su pH óptimo de
crecimiento fue 7 y las 3 restantes presentaron pH óptimo de 6. El rango de pH en el cual
creció la mayoría de las cepas fue de 4 a 9 (23 cepas) y sólo siete lo hicieron en un rango de
pH más restringido de 6 a 9 (Figura 2).
ϴϱ
WϰDϮͲϳ;WƐŝĐƌſĨŝůĂͿ
K;ϱϰϬŶŵͿ
ϰΣ
ϭϱΣ
ϯϬΣ
K;ϱϰϬŶŵͿ
>ϮϭͲϰ;WƐŝĐƌſƚƌŽĨĂƐͿ
ϰΣĐ
ϭϱΣĐ
ϯϬΣ
ϰϱΣ
ϰϱΣ
dŝĞŵƉŽ;ŚŽƌĂƐͿ
dŝĞŵƉŽ;ŚŽƌĂƐͿ
Figura 1. Crecimiento en caldo R2A de cepa bacteriana antártica psicrófila (1A) y cepa psicrótrofa (1B) en
diferentes temperaturas.
Figure 1. Growth in R2A broth of psychrophilic (1A) and psychrotrophic (1B) strains of Antarctic bacteria
to different temperatures.
K;ϱϰϬŶŵͿ
Ɖ,ĐĞƉĂWϮDϭͲϭϰ
Ɖ,ϰ
Ɖ,ϲ
Ɖ,ϳ
Ɖ,ϵ
dŝĞŵƉŽ;ŚŽƌĂƐͿ
Figura 2: Crecimiento de cepa bacteriana antártica en caldo R2A con diferentes pH.
Figure 2. Growth of Antarctic bacteria in R2A broth to different pH
Crecimiento a diferentes concentraciones de NaCl. De las cepas sometidas a las
diferentes concentraciones salinas, 17 se desarrollaron en presencia de NaCl en un rango de
0 a 6%, correspondiendo la mayoría a bacterias que no requirieron NaCl para crecer. Sólo 6
cepas mostraron mejor crecimiento cuando el caldo R2A fue suplementado con 2% de
NaCl.
ϴϲ
Crecimiento en anaerobiosis. Catorce cepas fueron capaces de crecer en aerobiosis y
anaerobiosis, y el resto de las cepas restantes sólo se desarrollaron en presencia de oxígeno.
DISCUSIÓN
Las cepas estudiadas fueron capaces de crecer a las diferentes temperaturas expuestas y en
su mayoría son bacterias psicrófilas pero también se encontró bacterias psicrótrofas
(Morita, 1975) capaces de crecer a 30°C, lo que se puede explicar porque en ciertas zonas,
sobretodo en la costa, la temperatura no es tan baja como al interior del continente. Estas
cepas poseen un pH óptimo de 7, pero tienen la capacidad de crecer en un amplio rango de
pH, de ácido a básico. Información acerca del pH hay poca, pero generalmente utilizan un
pH neutro (7 a 7,5), aunque en algunos casos, estudios informan que pueden crecer entre
pH 5 y 9 (Carpenter et al. 2000) lo que explica el porque la alta tolerancia a los cambios de
pH y, aunque pueden crecer con diferentes concentraciones de NaCl, su óptimo desarrollo
lo presentan en ausencia de NaCl. En diversas investigaciones (Rampelotto, 2010) se
concluye que algunas de estas bacterias antárticas pueden ser halófilas, ya que cuando el
agua de mar se congela la concentración salina aumenta, lo que explicaría el porqué estas
bacterias toleran diferentes concentraciones salinas.
Al exponerlas a anaerobiosis fue posible evidenciar que, aunque la población estudiada es
reducida, en este ambiente se encuentran bacterias aerobias estrictas y también bacterias
capaces de crecer en ausencia de oxígeno, con metabolismo anaeróbico facultativo, por lo
que es probable que, en su hábitat natural deban hacer frente también a la ausencia de este
factor.
CONCLUSIÓN
Se concluye que el grupo de cepas antárticas estudiadas corresponde a bacterias aerobias
estrictas y anaerobias facultativas y, principalmente, a psicrófilas, neutrófilas y que no
requieren NaCl para su crecimiento, que, sin embargo, pueden considerarse como bacterias
halotolerantes, debido a su capacidad de crecer en un amplio rango de salinidad.
AGRADECIMIENTOS
Al INACH por el financiamiento del proyecto T-17-08 y apoyo logístico en terreno.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
Bowman, J.P., McCammon, S.A., Brown, M.V., Nichols, D.S. and McMeekin, T.A. 1997. Diversity
and association of psychrophilic bacteria in Antarctic Sea ice. Appl. Environ. Microbiol. 63: 3068–
3078.
Carpenter, E.J., Lin, S. and Capone, D.G. 2000. Bacterial activity in South Pole snow. Appl.
Environ. Microbiol. 66:4514–4517
Ingraham, J.L. and Stokes, J.L. 1959. Psychrophilic Bacteria. Bacteriol Rev. 23: 97-108.
Isaksen, M.F. and Jorgensen, B.B. 1996. Adaptation of psychrophilic and psychrotrophic sulfatereducing bacteria to permanently cold marine environments. Appl. Environ. Microbiol. 62, 408-414.
Morita, R.Y. 1975. Psychrophilic Bacteria. Bacteriological Reviews. 39(2), 144-167.
Rampelotto, P. H. 2010. Resistance of microorganisms to extreme environmental conditions and its
contribution to Astrobiology. Sustainability 2:1602-1623.
Reasoner, D.J. and Geldreich, E.E. 1985. A new medium for the enumeration and subculture of
bacteria from potable water. Appl. Environ. Microbiol. 49:1-7.
ϴϳ
EVOLUCIÓN Y RELACIONES PALEOFITOGEOGRÁFICAS A
TRAVÉS DE ANÁLISIS PALEO-PALINOLÓGICOS DE
LOCALIDADES DEL CRETÁCICO SUPERIOR DEL SUR DE
PATAGONIA Y LA PENÍNSULA ANTÁRTICA
Evolution and palaeophytogeographical relationship through paleopalynological analysis of Upper Cretaceous localities in southern
Patagonia and Antarctic Peninsula
Cisterna K.1, Leppe M.2, Mihoc M.1, Varela N.1, Stinnesbeck W.3, Juhijara A.T.4, Mansilla H.2 & Bierma H.1
2
1
Universidad de Concepción, Chile
Laboratorio de Paleobiología, Instituto Antártico Chileno Plaza Muñoz Gamero 1055, Punta Arenas, Chile
3
Institut fur Geowissenschaft, Heidelberg Universitat, Alemania
4
Universidad de Magallanes, Chile
El diastrofismo y los continuos eventos de transgresión y regresión marina durante el
periodo Cretácico fueron uno de los causales principales del modelamiento actual de los
bosques del sur de Sudamérica. Se sabe que Antártica y Sudamérica permanecieron unidas
durante la primera mitad del Mesozoico, pero durante el Jurasico superior - Cretácico
inferior ambas masas de tierra habrían estado separadas (apertura del mar de Proto-Weddell
y la formación de la Cuenca de Rocas Verdes hacia el noroeste). Esta separación habría
actuado como un evento vicariante produciendo la aparición de especies únicas en cada
porción de tierra. Durante el Cretácico superior, entre Antártica y Sudamérica, habría
ocurrido su reconexión y esto podría evidenciarse a través de la mezcla de elementos
florísticos, antes únicos en cada porción de tierra.
Dentro de las formaciones correspondientes al Cretácico superior se encuentran la
Formación Cerro Dorotea de edad Campaniano-Maastrichtiano. Su fauna de invertebrados
en la parte superior ha sido frecuentemente relacionada con otras faunas de la misma edad
de la Península Antártica y Formación Quiriquina, en el centro sur de Chile. Esta formación
precisar cual formación suprayace a la Formación Dorotea y su relación estratigráfica
parece ser concordante. Esta última es la más estudiada en la región de Magallanes y
corresponde a una edad Maastrichtiano-Paleoceno. Una de las sucesiones relevantes de esta
formación es Cerro Guido, la cual posee una rica palinoflora asignada al Maastrichtiano.
Sus afloramientos son también parte importante de este trabajo.
El objeto de este estudio es analizar y comparar a través de análisis paleo-palinológicos, las
floras Cretácico superiores de tres afloramientos del sur de Patagonia y tres de la Península
Antártica para así estimar tiempo, afinidades paleoclimáticas y palinogeográficas. Se
escogieron tres localidades de Patagonia, correspondientes a Cerro Guido , Rio de Las
Chinas y Dumestre las cuales se muestrearon usando criterios estratigráficos. Para el
análisis palinológico se utilizó una nueva técnica no destructiva, que ofrece la posibilidad
de recuperar palinomorfos frecuentemente colapsados por las técnicas clásicas.
Posteriormente las muestras fueron montadas y observadas en un microscopio Axioscope
Carl Zeiss. Los resultados se contrastaron usando métodos de panbiogeografía.
El análisis estaría indicando una relación entre las tres localidades patagónicas,
asignándoseles tentativamente una edad Campaniano-Maastrichtiano, lo que se vería
corroborado por la fauna de amonites se podría especificar? encontrados en las sucesiones
Nota : no es apropiado utilizar la palabra secuencia en este sentido pues ella tiene ahora un
significadio más específico estudiadas. También se halló una estrecha relación entre las
ϴϴ
localidades y su posición relativa dentro de la paleocuenca de Magallanes, una gran cuenca
marina que se habría proyectado desde el Proto-Weddell hacia el norte, encontrándose Las
Chinas en un ambiente de sedimentación margino-litoral a continental. En cambio
Dumestre, se encuentra dentro de la cuenca marina, de ahí la presencia de especies algales
de Botryoccocaceae. La presencia relativamente abundante de pteridofitas y briófitas nos
habla de condiciones templado húmedas, con un estrato arbóreo y arbustivo dominado por
angiospermas, una clara remembranza de la Selva Valdiviana. Sin embargo, llama la
atención la baja presencia de gimnospermas, presentes solo como elementos subordinados.
Asimismo, destaca el hallazgo del registro más antiguo de Asteraceae, presente en estratos
patagónicos asignados al Maastrichtiano.
Este trabajo es producto de una tesis en desarrollo del proyecto Fondecyt 11080223
“Palaeophytogeographical and evolutionary relationships between southern Patagonia and
Antarctic Peninsula floras during the Cretaceous” y ha recibido apoyo del proyecto de
cooperación internacional Chile.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
ARCHANGELSKY, S., Césari, S.N., (2004). Comparación de algunas floras aptianas de Patagonia y
Antártida. In: Actas del 5_ Simposio Argentino y 1_ Latinoamericano sobre Investigaciones
Antárticas (Buenos Aires) CD-ROM. Resumen 109GP, 1pp.
GULLER, M.V., Guerstein, G.R., Casadío, S., (2004). Newdinoflagellate cyst species from the
Calafate Formation (Maastrichtian), Austral Basin, Argentina. Ameghiniana 42, 419–428.
HILL, R. y L. Scriven (1995). The Angiosperm-dominated woody vegetation of Antarctica: a
review. Review of Paleobotany ad Palynology 86:175-198.
MARENSSI, S., Guler, M.V., Casadío, S., Guerstein, G.R., Papú, O., (2004). Sedimentology and
bioestratigraphy of Maastrichtian deposits from Austral Basin, Argentina. Cretaceous Research 25,
907–918.
MACELLARI, C. E. 1988. Stratigraphy, sedimentology and paleoecology of
UpperCretaceous/Paleocene shelf-deltaic sediments of Seymour Island (Antarctic Peninsula). In
Geology and paleontology of Seymour Island, Antarctic Peninsula (eds Feldmann, R. M. &
Woodburne, M. O.), Geological Society of America, Memoir 169, 25–53.
POOLE I, Mennega AMW, Cantrill DJ (2003) Valdivian ecosystems in the late Cretaceous and
early Tertiary of Antarctica as evidenced from fossil wood. Review of Palaeobotany and Palynology.
124: 9-27.
POVILAUSKA L., Barreda V., Marenssi S. (2008). Polen y esporas de la Formación La Irene
(Maastrichtiano), sudoeste de la provincia de Santa Cruz, Argentina: primeros resultados. GEOBIOS
41: 819–831
RUTHSATZT, B., C. Villagrán. (1991). Vegetation pattern and soil nutrients of a Magellanic
moorland on the Cordillera de Piuchué, Chiloé Island, Chile. Revista Chilena de Historia Natural 64:
461-478.
VILLAGRAN, C., L. Hinojosa. (2005). Capítulo 33: 551-577 en: Regionalización Biogeográfica en
Iberoamérica y tópicos afines (Jorge Llorente Bousquets & Juan J. Morrone, Editores). Ediciones de
la Universidad Nacional Autónoma de México, Jiménez Editores, México, 577 pp.
VOLKHEIMER, W. (1971). Aspectos paleoclimatologicos del Terciario Argentino. Revista Museo
Argentino de Ciencias “Bernardino Rivadavia” 8:241-264.
QUEZADA, I., (2003). Palinofloras de localidades Meso-Cenozoicas de Isla Rey Jorge, Antártica
Insular. Seminario de Titulo presentado para optar al Título de Biólogo. Fc. De Cs. Naturales y
Oceanográficas, Universidad de Concepción, Chile, 65 pp.
ϴϵ
Figura 1. Escala geológica con las Formaciones del Cretácico superior de la Cuenca de Magallanes y
Península Antártica.
Figura 3. Localidades de Patagonia e Isla Rey Jorge al noreste de la Península Antártica y al sureste
localidades de la Cuenca Marina de James Ross.
ϵϬ
ϵϭ
ϵϮ
ACUMULACIÓN DE FITOQUELATINAS Y RESPUESTAS
ANTIOXIDANTES DE COLOBANTHUS QUITENSIS (KUNTH)
BARTL. (CARYOPHYLLACEAE) EXPUESTO A EXCESO DE
COBRE Y ALUMINIO IN VITRO
[Phytochelatin accumulation and antioxidant responses of Colobanthus
quitensis (Kunth) Bartl. (Caryophyllaceae) in copper and aluminum
excess in vitro]
Contreras, R. A., Pizarro, M. & Zúñiga, G.E.
1
Laboratorio de Fisiología y Biotecnología Vegetal – Depto. de Biología, Universidad de Santiago de Chile
Colobanthus quitensis. es la única dicotiledónea del territorio Antártico, en condiciones
naturales campo está constantemente sometida a una serie de diversos factores abióticos
que se consideran como limitantes para el desarrollo del ciclo de vida normal de las plantas,
entre de ellos destacan alteraciones en los ciclos luz/día durante el año, fuertes vientos,
altos índices de radiación UV, salinidad de los suelos y espray marítimo, bajas temperaturas
y reducida disponibilidad hídrica (Alberdi et al., 2002).
Pese a las condiciones adversas, su colonización en el territorio ha sido exitosa. En esta
investigación se evaluó la capacidad de respuesta fisiológica de C. quitensis cultivado in
vitro (Zúñiga et al., 2009) a dos elicitores, exceso de cobre (150 y 300 ˇ M) y aluminio (50
y 100 ˇ M).
Se evaluaron como parámetros de estrés el contenido de especies reactivas de oxígeno
(ROS) mediante método fluorimétrico (Ross et al., 2008) y el contenido de
malondialdehído (MDA) como sustancias reactivas al ácido tiobarbitúrico (TBARS) (Ederli
et al., 2004). Se evaluó además, el sistema antioxidante enzimático mediante la medición
de la actividad de las enzimas superóxido dismutasa (SOD) (Giannopolitis & Ries, 1977),
ascorbato peroxidasa (APX) (Zhao & Blumwald, 1998), glutatión reductasa (GR) (Schaedle
& Bassham, 1977), peroxidasas totales (POD) y catalasa (CAT) (Pinhero et al., 1997). La
actividad de antioxidantes no enzimáticos se evaluó por los métodos de atrapamiento del
radical difenilpicrilhidrazil (DPPH) (Brand-Williams et al. 1995) y mediante el método de
poder reductor (FRAP) (Benzie & Strain, 1996). Como parámetros de estatus metabólico se
evaluó el contenido de azúcares reductores mediante el método de antrona sulfúrica
(Zúñiga et al., 1996) y el contenido de fenoles totales según Folin-Ciocalteu (Singleton &
Rossi, 1965). El contenido de ácido abscísico (ABA) fue evaluado mediante LC-MS.
Finalmente es evaluó el contenido de glutatión reducido (GSH), y el contenido de
fitoquelatinas (PCn) mediante cromatografía líquida de alta eficiencia con detector de
fluorescencia, utilizando el método de la derivatización de tioles con el fluoróforo
monobromobimano (Zhang et al., 2008).
Los resultados mostraron un efectivo mecanismo de respuesta, induciéndose en ambos
tratamientos la acumulación de ABA y un aumento en la actividad antioxidante no
enzimática.
En el caso de las enzimas antioxidantes se observó incrementos en las actividades SOD,
CAT y POD, reducción en la actividad APX y no presentó cambios en la actividad GR. Los
parámetros oxidativos mostraron un significativo incremento. Finalmente se observó
incremento en la acumulación de GSH y en las fitoquelatinas PC2, PC3, PC4 y PC5 en
respuesta a ambos elicitores.
ϵϯ
Los resultados sugieren que C. quitensis tiene un mecanismo efectivo de respuesta a cobre
y aluminio, ya que no se vería afectada el metabolismo básico (pigmentos no varían, dato
no mostrado), por otro lado, el sistema enzimático de respuesta seguiría un camino
alternativo al del ciclo ASC-GSH, debido a que el GSH estaría probablemente siendo
utilizado como sustrato para la síntesis de fitoquelatinas.
Finalmente, con estos resultados se formuló el siguiente modelo de respuesta:
Figura 1. Modelo de respuesta de C. quitensis a Cu2+ y Al3+. Me= metal/metaloide, GCS= gamaglutamilcisteína sintasa, GS= glutatión sintasa, PCS= fitoquelatina sintasa.
En este modelo el metal o metaloide al ingresar a la célula, generaría un aumento en el
contenido de iones superóxido, los que serían dismutados por la SOD hacia peróxido de
hidrógeno, a su vez el metal o metaloide estaría inactivando la APX y por lo tanto el ciclo
ASC-GSH. El sistema enzimático encargado de destoxificar del peróxido de hidrógeno
estará integrado por PODs y CAT. Por otro lado la presencia de estos metales en el entorno
celular activaría la síntesis de GSH y PC2-5 los que ayudarían a destoxificar el medio a
través de procesos de quelación. Finalmente, por mecanismos aún no determinados, la
presencia de peróxido de hidrógeno (quien desplazaría parcialmente el entorno celular de
una condición reductora, hacia una oxidativa) estaría regulando los niveles de ABA
(hormona que actúa como señalizador para activar mecanismos de respuesta a estrés) y los
niveles de metabolitos secundarios de naturaleza fenólica con actividad antioxidante.
ϵϰ
AGRADECIMIENTOS
CONICYT y su programa de formación y capital humano avanzado, instituto Antártico
Chileno (INACH), CORFO-Innova (proyecto 07CN13_X-26).
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
Alberdi, M; Bravo, L.; Gutiérrez, A.; Gidekel, M.; & Corcuera, L. (2002). Ecophysiology of
Antarctic vascular plants. Physiol. Plant. 115: 479-486.
Benzie, I.F.F.; & Strain, J.J. (1996). The ferric reducing ability of plasma (FRAP) as a measure of
“antioxidant power”: the FRAP assay. Anal. Biochem. 239: 70-76.
Brand-Williams, W.; Cuvelier, M.E.; & Berset, C. (1995). Use of a free radical method to evaluate
antioxidant activity. Lebensmittel - Wissenschaft + Technologie 28: 25-30.
Ederli, L.; Reale, L.; Ferranti, F.; & Pasqualini, S. (2004). Responses induced by high concentration
of cadmium in Phragmites australis roots. Physiol. Plant. 121: 66-74.
Giannopolitis, C.N.; & Ries, S.K. (1977). Superoxide dismutases. I. Occurrence in higher plants.
Plant Physiol. 59: 309-314.
Pinhero, R.; Rao, M.; Paliyath, G.; Murr, D.; & Fletcher, R. (1997). Changes in activities of
antioxidant enzymes and their relationship to genetic and paclobutrazol-induced chilling tolerance of
maize seedling. Plant Physiol. 114: 695-704.
Ross, C.; Puglisi, M.P.; & Paul, V.J. (2008). Antifungal defenses of seagrasses from the Indian River
Lagoon, Florida. Aquat. Bot. 88: 134-141.
Schaedle, M.; & Bassham, J.A. (1977). Chloroplast glutathione reductase. Plant Physiol. 59: 10111012.
Singleton, V.L.; & Rossi, J.A. (1965). Colorimetry of total phenolics with phosphomolybducphosphotungstic acid reagents. Am. J. Enol. Vitic. 16(3): 114-158.
Zhang, Z.; Gao, X.; & Qiu, B. (2008). Detection of phytochelatins in the hyperaccumulator Sedum
alfredii exposed to cadmium and lead. Phytochemistry 69: 911-918.
Zhao, S.; & Blumwald, E. (1998). Changes in oxidation-reduction state and antioxidant enzymes in
the roots of jack pine seedlings during cold acclimation. Physiol. Plant. 104: 134-142.
Zúñiga, G.E.; Alberdi, M.; & Corcuera, L.J. (1996). Non-structural carbohydrates in Deschampsia
Antarctica Desv. from South Shetland Islands, Maritime Antarctic. Env. Exp. Bot. 36(4): 393-399.
Zúñiga, G.E.; Zamora, P.; Ortega, M.; & Obrecht, A. (2009). Micropropagation of Antarctic
Colobanthus quitensis. Antarctic Sci. 21: 149-150.
ϵϱ
Alicyclobacillus sp. cepa CC2, BACTERIA TERMOFILICA UVTOLERANTE AISLADA DE ISLA DECEPCION, ANTARTICA
(Alicyclobacillus sp. strain CC2, a UV-tolerant thermophilic bacterium
isolated from Deception Island, Antarctica.)
Correa-Llantén, D. N.1, 2, Amenábar, M. J.1, Muñoz, P. A.1, 2, Monsalves, M. T.1, 3 & Blamey, J. M.1
2
1
Fundación Científica y Cultural Biociencia, José Domingo Cañas 2280, Santiago, Chile
Doctorado en Biotecnología, Universidad de Santiago de Chile, Avenida Libertador Bernardo O’Higgins 3363, Santiago, Chile
3
Universidad Tecnológica de Chile, Av. Vitacura 10151, Santiago, Chile
Isla Decepción es un estratovolcán activo localizado en las islas Shetland del sur, Antártica.
Sus altas temperaturas en áreas específicas proveen condiciones excelentes para el
crecimiento de bacterias termofílicas. Uno de los sitios con las más altas temperaturas
registradas es “Cerro Caliente” (S 62° 58.045', W 60° 42.609'), lo que permite el
crecimiento de microorganismos termofílicos. A la fecha, pocos microorganismos han sido
aislados desde Isla Decepción. Sin embargo, la presencia de bacterias termoacidofílicas
nunca ha sido descrita en este sitio. En este trabajo presentamos el aislamiento y
caracterización de una de ellas, la cual fue encontrada en muestras tomadas en “Cerro
Caliente” y relacionamos su tolerancia a los altos índices de radiación UVB encontrados en
la Antártica con su sistema antioxidante. Con éste fin, realizamos una purificación parcial
de la superóxido dismutasa (SOD), la cual fue la primera enzima descrita con directa acción
sobre un radical libre. Su descubrimiento en 1968 constituyó una prueba de la existencia de
estos radicales en los organismos vivos (McCord and Fridovich 1968). Esta enzima es una
metaloproteina que dismuta al anión superóxido, radical libre producido en los procesos de
respiración celular, convirtiéndola en una de las principales enzimas pertenecientes al
sistema antioxidante de los organismos.
MATERIALES Y MÉTODOS
Para realizar el estudio, se utilizaron muestras de suelo que fueron tomadas a 40 cm de
profundidad. Las muestras fueron obtenidas en la Expedición Chilena Antártica ECA-45,
de áreas totalmente descongeladas de “Cerro Caliente” en Isla Decepción, Antártica. Para
aislar al microorganismo, se realizaron diluciones seriadas y cultivo en medio sólido
(Gelrite 2%). Para determinar las condiciones óptimas de crecimiento, se midió la densidad
óptima a 600 nm a temperaturas entre 30-70 °C y a pH entre 2-7.
Para la purificación de la enzima SOD se utilizó el extracto crudo de la cepa CC2, el que
fue cargado en una columna de intercambio iónico. Para determinar el pH óptimo se realizó
un ensayo de actividad específico, incubando la enzima en distintos tampones a diferentes
pH. Para determinar la termoestabilidad se incubó la enzima a 50 y 70 ºC y se midió su
actividad cada 15 minutos.
RESULTADOS, DISCUSIÓN Y CONCLUSIÓN
Análisis moleculares de la secuencia parcial del gen ribosomal 16S de la bacteria obtenida,
indicaron que pertenece al género Alicyclobacillus, mostrando un alto porcentaje de
identidad con la subespecie acidocaldarius. Este microorganismo presentó morfología
bacilar, creciendo aeróbicamente entre el rango de temperaturas 30-60°C (óptimo 55°C),
rango de pH 2.0-6.0 (óptimo pH 4.0) y fue capaz de producir ácido a partir de diferentes
azúcares. Este microorganismo presentó tolerancia a la radiación UV, sobreviviendo por 20
ϵϲ
min y más de 2 horas bajo radiación UVC y UVB, respectivamente. A la fecha, solo dos
miembros del género Alicyclobacillus han sido aislados desde la Antártica:
Alicyclobacillus acidocaldarius sub. sp. rittmannii y Alicyclobacillus pohliae siendo
Alicyclobacillus cepa CC2 el primer miembro de este género aislado desde isla Decepción.
Por otro lado, la enzima SOD tiene una actividad óptima a pH 7,4. Presentó una actividad
específica: 12 U/mg y es capaz de mantener el 80% de su actividad luego de ser incubada
por 6 horas a 50 ºC. Probablemente la actividad antioxidante de esta enzima le permite al
microorganismo ser tolerante a la radiación UV, protegiéndolo frente a las especies
oxidantes producidas por la alta incidencia de ésta radiación en la Antártica.
AGRADECIMIENTOS
INACH. Proyecto Gabinete G04-09, INACH. Proyecto Biorecursos Antárticos-Innova
07CN13PXT-264.
REFERENCIAS BIBLIOGRÁFICAS
•
•
McCord, J.M. & Fridovich I. 1968. The reduction of cytichrome c by milk Xanthine Oxidase. The
Journal Biology and Chemistry. 273, 5753-5760.
Stroupe, E., DiDonato, M. & Tainer, J. 2001. Manganese superoxide dismutase Handbook of
Metalloproteins © John Wiley & Sons, Ltd 940-951.
ϵϳ
LA EXPRESIÓN DE SACAROSA FOSFATO SINTASA (SPS)
REGULADA POR FRÍO Y EL FOTOPERIODO FAVORECE LA
ACUMULACIÓN DE SACAROSA EN COLOBANTHUS
QUITENSIS DURANTE EL VERANO ANTÁRTICO
(Cold and photoperiod regulated expression of sucrose phosphate
synthase (SPS) favors sucrose accumulation in Colobanthus quitensis
during the Antarctic summer)
Cuba-Díaz, M.1, 2, Cid, K.1, 2, Navarrete, A.3, Retamal, C.3 & Bravo, L.A.4, 5
1
Lab. Biotecnología y Estudios Ambientales
Depto. Cs. y Tecnología Vegetal, Esc. Cs. y Tecnología, Campus Los Ángeles, Universidad de Concepción
3
Lab. Fisiología Vegetal, Fac. Cs. Nat. y Oceanográficas, Universidad de Concepción
4
Lab. Fisiología y Biol. Mol. Vegetal, Depto. Cs. Agronómicas y Recursos Nat., Fac. Cs. Agropecuarias y Forestales
5
Center of Plant, Soil Interaction and Nat. Resources Biotech., Scientific and Technological Bioresource Nucleus, Universidad de La
Frontera
2
Plants develop many biochemical and physiological adjustments in order to cope with
abiotic stress. Colobanthus quitensis (Kunth) Bartl. (Caryophyllaceae) is the only dicot
plant living in Antarctic, besides this plant has a wide distributional range from Mexico to
southern Antarctic Peninsula (Moore, 1970; Lewis Smith, 2003). Some populations have
developed particular responses to their prevalent environment, so, some studies have
established ecotype differences between the Antarctic populations and the Andes
populations (La Parva) (Gianoli et al., 2004; Bascuñán-Godoy et al., 2010). On the other
hand, Antarctic ecotypes have high photosynthesis rate at low temperature (Xiong et al.,
1999, 2000), have cold resistance and it is more freezing tolerant (Gianoli et al., 2004,
Bravo et al. 2007), have develop mechanism of photoprotection and is able to induce high
levels of sucrose accumulation (Bravo et al, 2001, Bascuñán-Godoy et al, 2006; Zúñiga et
al., 2009). The sucrose content has been correlated with freezing tolerance because its
accumulation plays a role cryoprotecting the protoplast and macromolecular structures
(Santarius, 1992). The main enzyme involved in the Sucrose synthesis in higher plants is
the sucrose phosphate synthase (SPS; EC 2.4.1.14). SPS is not confined to photosynthetic
tissues but also occurs in heterotrophic tissues (Geingenberger et al. 1997; Xu et al. 2007;
Choudhury et al. 2008; Aleman et al. 2010). At the transcription level SPS can be regulated
both developmentally (Komatsu et al. 1999; Chávez- Bárcenas et al. 2000) and in response
to specific environmental stimuli (Ingram et al. 1997; Langenkämper et al. 1998), at the
level of enzyme, it is regulated by allosteric effectors (Glc-6-P and Pi), and by reversible
seryl phosphorylation (Huber and Huber 1996) and binding to 14-3-3 proteins (Winter and
Huber 2000). Plants have multiple forms of SPS and at least there are three SPS gene
family in dicot species named A, B and C (Reimholtz et al. 1997; Langenkämper et al.
2002; Castleden et al. 2004; Chen et al. 2005) From the available evidence, it is tempting to
speculate that specific SPS isoforms show differential regulation and their expression
patterns have functional significance (Lutfiyya et. al. 2007). It seems that both
transcriptional and post-translational regulation of SPS isoforms are used by higher plants
to respond to certain environmental signals. In C. quitensis, SPS activity appears to be
positively modulated, leading to sucrose accumulation under cold acclimation conditions
(16/8 ligh/dark and 4ºC), although the specific activity of CqSPS after 21 days of cold
acclimation doubled there was not a concomitant increase in CqSPS protein synthesis
(Bascuñán-Godoy et. al. 2006). Cold acclimation caused a decrease of the affinity of SPS
ϵϴ
for inorganic phosphate (Pi-allosterical inhibitor) and an increase of the affinity for
glucose-6-phosphate (allosterical activator) with respect to non-acclimated plants
(Bascuñán-Godoy et al. 2006). Several mechanisms could explain these; i.e.: a
conformational change in the enzyme could modify the affinity of the allosteric binding
sites, covalent modification by phosphorylation –dephosphorylation or expression of new
isoform induced by cold acclimation (Langekämper et al. 2002; Castedlen et al. 2004;
Lutfiyya et al. 2007). We hypothesize that the high sucrose accumulation and the high SPS
activity observed in cold acclimated Antarctic ecotype of C. quitensis is due to a low
temperature induced differential pattern expression of SPS isoforms, maybe the Antarctic
ecotype posses a constitutive SPS isoforms guarantees the high sucrose and SPS activity
but this wills contrast with other continental ecotypes. Our main objective is to identify SPS
isoforms in C. quitensis and to study its expression pattern (transcripts and protein) and
associate it with enzymatic activity and sucrose accumulation, under laboratory conditions
(cold acclimation at two day length), using Antarctic populations as model; and to compare
it with a continental populations (Punta Arenas) under natural growing conditions.
Colobanthus quitensis (Kunth) Bartl. plants were collected in two sites, Antarctic
population: King George Island, (62º10'S;58º28'W) in the Maritime Antarctic and Punta
Arenas population: 28 km south of Punta Arenas city (52º22’S;70º58’W). Plants were
vegetatively reproduced in control conditions at 14±1ºC, PFD of 100-120 mol m-2 s-1 and
16/8 h light/dark period (control plants). For cold acclimation treatment, control plants were
transferred at 21/3 light/dark period (long day: LD) at 4ºC or 15ºC or at 8/16 light/dark
period (short day: SD) at 4ºC or 15ºC for 7 days. Samples of mature leaves were taken at 0,
1, 4, 7 days for transcripts, relative protein content, SPS activity, phosphorus inhibition and
sucrose content measurements. In the field, samples (leaves and roots) were taken at three
times of daily course (at 6:00, 13:00 and 19:00 hours) and at the beginning and late during
the growing season (January and March). The samples were kept in liquid nitrogen and
then at -80ºC until the analysis. Transcripts analysis was made from leaves and roots total
RNA using SPS A and SPS B specific transcripts primers, designed from conserved region
in other dicotyledonous (Ingram et al. 1997; Langenkämper et al. 2002; Chen et al. 2005).
Protein expression was analyzed by mean immunodetection using fresh protein extracts
from leaves samples from the different treatments and SPS specific detection was by using
an anti-SPS antibody (1:5000) (Agrisera AB, Vännäs, Sweden). SPS activity was measured
from fresh protein extracts and the activity values were expressed as velocity of NADH
oxidation (mol of oxidized NADH per minute) at 30 ºC and pH 7.5 in conditions of initial
velocity. Inhibition assays where performed by using 10mM Pi in the mixture buffer.
Sucrose content was determined by high performance thin layer chromatography (HPTLC)
according to Lee et al. (1979), using a Silicagel plate 60 F 254 (Merck, Darmstadt,
Germany).
Transcripts belonging to A and B SPS gene family were amplified, SPSA transcript was
amplified from leaves and roots, while SPSB transcript was only amplified from leaves.
SPSA transcript level was negatively affected by day length. When plants were transferred
from LD to SD, SPSA transcripts quickly disappears after one day at SD at 15ºC (Fig. 1a,
b). Low temperature seems to protect RNA transcription because when plants were
transferred to SD but at 4ºC, SPSA transcript level was maintained during the first day of
exposure until fully decline at fourth day. On the contrary, when plants were maintained at
LD and cold acclimated at 4ºC transcripts slowly decreased until it disappeared at seventh
day (Fig. 1a, b). Instead, SPSB transcripts were not significantly affected in any studied
ϵϵ
conditions, only a slight decreased was observed when plants were transferred from LD to
SD at both temperatures (fig.1a, c).
Figure 1. Transcript analysis of SPSA and SPSB
in C. quitensis during cold acclimation and different
day length (LD and SD). Total RNA was isolated
from leaf tissue at different times of cold acclimation
and at different day length. Total RNA was isolated
from leaves tissues and SPS family specific primers
were used to RT-PCR. 18S serves as reaction
control.
There was a significant interaction between
photoperiod
and
cold
acclimation
determining the increase in SPS protein and
affecting leaf SPS activity. Cold
acclimation exhibited a more significant
effect under LD than under SD, showing
significant higher values after 4 days of
exposure and reaching about 25% higher
SPS content than at 15ºC at 7 days of cold
acclimation.
Only a slightly higher SPS protein level was observed in cold acclimated plants only at 7
days of exposure. Under LD conditions there was an increase in SPS activity only at 4ºC
but under SD conditions both 4 and 15ºC treated plants increase SPS activity. About 80%
of leaf SPS activity was lost by the addition of 10 mM Pi in the extracts from nonacclimated leaves at LD and SD in an in vitro experiment. As expected, cold acclimation
decreased Pi sensitivity of the SPS enzyme to Pi maintaining about 50% of SPS activity at
10 mM Pi. Inhibition by Pi was not significantly different between non-acclimated and
cold-acclimated plants under SD. Consistently with the SPS activity; there was a significant
effect of photoperiod, exhibiting higher sucrose content in cold acclimated plants under LD,
while not significant differences were observed under cold acclimation at short photoperiod
(Fig. 2).
SD
LD
Figure 2. Effect of cold acclimation at
Sucrose (mg/gFW)
5
4ºC
15ºC
4
3
2
1
0
0
1
2
3
4
Days
5
6
7
8
0
1
2
3
4
5
6
7
8
different photoperiods on sucrose
contents.
Sucrose
content
was
determined in leaves of C. quitensis
during cold acclimation (4ºC) and under
control temperature (15ºC) LD:21/3
hours light/dark (A) and SD:8/16 light
/dark (B) for seven days.
Days
Unlike the laboratory, under natural conditions both SPSA and SPSB were amplified in
leaves and roots tissue in Antarctic and Punta Arenas populations. SPSA was differentially
regulated during the day (daily course), depending on the collection moment within the
growing season, with higher expression in January, at least in Antarctic populations. For
SPSB, like in laboratory conditions, no perceptible changes were showed, at least in the
study conditions. Not direct relationship was observed between protein content and
ϭϬϬ
enzymatic activity on natural populations, but a relation between transcripts expression and
enzymatic activity was observed (fig. 3.) except for Punta Arenas populations in January.
Leaves January
Roots January
Activity SPS/gFW
300
Punta Arenas
Antartida
250
200
150
b
b
ab
ab
a
ab
b
ab
ab
a
a
a
Figure 3. SPS activity of C. quitensis tissue
collecting under natural conditions in Antarctic and
Punta Arenas locations.
100
Our results allow us to conclude that at least
two members of SPS gene family are
expressed in C. quitensis, (SPSA and
Leaves March
Roots March
SPSB). They have differential organ
expression and day length and low
temperature differential regulation but its
*
*
*
*
regulation under natural conditions is not
clear yet, however SPSB does not appear to
be largely affected.
Consistently, SPS transcripts was associated to higher SPS protein and SPS activity, which
finally resulted in increased sucrose accumulation under laboratory conditions but there
was not a clear relationship between transcripts expression, protein content and enzymatic
activity in plant from the field, although at least in Antarctic populations, transcripts
expression and enzymatic activity were most related. Currently, we are studying the sucrose
contents on both populations; as this is the first report from Punta Arenas populations,
laboratory studies are being conducted. Also we are trying to amplify a complete C.
quitensis SPS cDNA and in order to compare our SPS members with other species in the
data base and trying to amplify SPSC member, if there is any in C. quitensis.
50
0
6:00
13:00
19:00
6:00
Hour
13:00
19:00
Hour
Activity SPS/gFW
300
Punta Arenas
Antartida
250
200
ab
b
ab
b
ab
a
a
150
ab
a
ab
a
a
100
50
0
6:00
13:00
Hour
19:00
6:00
13:00
19:00
Hour
ACKNOWLEDGMENTS
DIUC 208-112-044-1.0, INACH T_03-09. INACH, Polish Antarctic Station-Arctowski and
technical contribution of Ixia Cid and Felipe Ruiz.
REFERENCES
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Aleman, L. et al. 2010 Planta 231:233-244.
Bascuñán-Godoy, L .et al. 2006 Polar Biol. 29:1011-1017.
Bascuñán-Godoy, L. et al 2010 Polar Biol. 33:885-896.
Bravo, LA. et al. 2001 Physiol Plant 111:55-65.
Bravo, LA. et al. 2007. J Exp. Bot. 58:3581-3590.
Castleden, CK. et al. 2004 Plant Physiol. 135:1753–64.
Chávez- Bárcenas, AT. et al. 2000 Plant Physiol 124:641–653.
Chen, S. et al. 2005 Plant Physiol. 139:1163–1174.
Choudhury, SR. et al. 2008 Planta 229:207-223.
Geingenberger, P. et al. 1997 Planta 201:502–518.
Gianoli, E. et al. 2004 Art. Ant. and Alp. Res. 36:484-489.
Huber, SC.; Huber, JL. 1996 Annu Rev Plant Physiol Plant Mol Biol. 17:431–444.
Ingram, J.et al. 1997 Plant Physiol. 115:113–21.
Komatsu, A. et al. 1999 Plant Sci 140:169–178.
Langenkämper, G. et al. 1998 Plant Mol Biol 36:857–869.
Langekämper, R. et al. 2002 Evol. 54:322–332.
Lee, KY., Nurok, D., Zlatkis, A. 1979 J Chromatogr 174:187–193.
ϭϬϭ
•
•
•
•
•
•
•
•
•
•
Lewis-Smith, RI. 2003 The enigma of Colobanthus quitensis 449 and Deschampsia antarctica in
Antarctica. In: Huiskes AHL, et al. (eds) Antarctic biology in a global context. Backhuys Publishers,
Leiden, pp 234–452.
Lutfiyya, LL. et al. 2007 J. Plant Physiol. 164:923—933.
Moore, DM. 1970 British Antarctic Survey Bulletin, 23: 63–80.
Reimholz, R. et al. 1997 Cell Environ 20:291–305.
Santarius, KA. 1992 Physiol Plant 84:87–93.
Winter, H., Huber, SC. 2000 Crit Rev Plant Sci 19:31–67.
Xiong, FS., Ruhland, CT., Day, TA. 1999 Physiol Plant 106:276–495 286.
Xiong, FS., Mueller, EC., Day, TA. 2000 American Journalof Botany 87:700–710
Xu, Y., Li, HB., Zhu, YX. 2007 J Int Plant Biol 49:69–74.
Zúñiga-Feest, A. et al. 2009 Polar Biol 32:583-591.
ϭϬϮ
ACTIVIDAD ANTIBACTERIANA DE METALES PESADOS
SOBRE BACTERIAS ANTÁRTICAS
(Antibacterial activity of heavy metal against Antarctic bacteria)
Del Campo, K.1, 2, Bello, H.2, Domínguez, M.2 & González-Rocha, G.2
1
2
Estudiante de Biología. Facultad de Ciencias Naturales y Oceanográficas. Universidad de Concepción
Laboratorio de Investigación en Antibióticos. Departamento de Microbiología. Facultad de Ciencias Biológicas. Universidad de
Concepción. Barrio Universitario s/n. Concepción. Chile. [email protected]
Las bacterias que habitan en la Antártica, que se caracteriza por condiciones ambientales
adversas, adoptan diversas estrategias para lograr ventajas competitivas en su hábitat (Lo
Giudice et al. 2007).
La presencia de metales pesados en el ambiente se considera una presión selectiva para la
microbiota (Moraga et al. 2003). La relación contaminante-microorganismo origina una
serie de procesos adaptativos que, finalmente, se expresan como mecanismos de resistencia
hacia el contaminante (Montuelle et al., 1994; Anisimova et al., 1993).
Los mecanismos más conocidos de defensa se basan en movilizar el elemento tóxico hacia
el exterior del organismo, inmovilizarlo al unirlo a compuestos estructurales o encapsularlo
en polímeros externos al microorganismo (Suárez et al. 2002).
Debido a que la Antártica es un ambiente donde la contaminación antropogénica es aún
mínima, es posible develar los niveles basales de resistencia a metales que los organismos
pueden tener en ambientes poco contaminados (Vodopívez et al 2007).
El objetivo de este trabajo fue investigar la actividad de los metales pesados cinc (ZnSO4),
mercurio (HgCl2) y plata (AgNO3) sobre bacterias antárticas aisladas en Isla Rey Jorge e
Isla Livingstone.
MATERIALES Y MÉTODOS
Cepas Bacterianas. Se trabajó con 60 cepas bacterianas aisladas de diferentes tipos de
muestras (hielo, agua de lagunas, agua de mar, sedimentos, suelo, etc.) recolectadas en
Península Fildes, Isla Rey Jorge, Isla Ardley y Cabo Shirref, Isla Livingstone, en campañas
del Instituto Antártico Chileno (INACH) 2007, 2009 y 2010. Las cepas se encontraban
almacenadas a -80°C en crioviales con anillos de porcelana.
Actividad antibacteriana de metales pesados. Se determinó la concentración mínima
inhibitoria (CMI) de cada metal sobre las cepas bacterianas seleccionadas, empleando el
método de dilución seriada en agar (González, 1993). Se ensayó ZnSO4 en el rango de 1281.024 µ g/mL; HgCl2 entre 2-16 µ g/mL y AgNO3 entre 2-128 µ g/mL. Todas los ensayos se
realizaron en agar Mueller-Hinton (MH) o MH suplementado con 2 % de NaCl, en el caso
de bacterias marinas. Para el inóculo bacteriano se preparó una suspensión correspondiente
al estándar de turbidez McFarland 0,5 la que fue diluida 10 veces para obtener una
concentración bacteriana de ~ 107 UFC/mL). Cada serie de placas fue inoculada con 1-2
µ l, utilizando replicador de Steer y se incubó a 15 ºC por un máximo de 72 h. Cualquier
evidencia de desarrollo bacteriano se consideró como crecimiento positivo. Los puntos de
corte para definir resistencia o tolerancia a los metales fueron los utilizados por Moraga y
colaboradores (2003) para Zn (800 µ g/mL) y Hg (10 µg/mL) y para Ag se usó el punto de
corte descrito por Lambert et al (2000) de 9 µ g/mL.
ϭϬϯ
RESULTADOS
Frente a los tres metales ensayados se encontró cepas bacterianas resistentes. El mayor
número correspondió a cepas resistentes a plata (22/60), seguido por resistencia a cinc
(16/60) y a mercurio (6/60) (Tabla 1).
Rango*
CMI50
CMI90
%R
ZnSO4
128 - 1024
256
1024
26,6
HgCl2
<2 - >16
<2
8
10
AgNO3
*µ g/ml.
<2 - 128
4
16
36,6
Tabla 1. Concentración mínima inhibitoria (CMI) de metales pesados sobre bacterias antárticas.
De las cepas bacterianas resistentes a cinc, 93,7% correspondió a bacterias aisladas de
muestras de agua de mar y 6,3 % a cepas bacterianas continentales. En la resistencia a plata
y mercurio, también predominaron cepas marinas, con 83,4% y 83,3% respectivamente.
DISCUSIÓN
Los resultados obtenidos frente mercurio y plata son coincidentes, para un reducido número
de cepas, con los informados por González (1993) y Moraga et al. (2003). Esto podría ser
explicado por el hecho que la Antártica se encuentra alejada de las fuentes de emisión de
contaminantes. Sin embargo, para mercurio se encontró resistencia comparable a lo
reportado en ambientes contaminados, que podría deberse a la facilidad con que este metal
se puede transportar por el ambiente; de esta manera, las cepas resistentes podrían dar
indicios tempranos de presencia de metales pesados en los lugares estudiados.
Las concentraciones mínimas inhibitorias obtenidas para cinc son elevadas en comparación
a las descritas por Santos et al. (2005) en un ambiente similar, esto podría revelar que
podría existir un aumento de la presión selectiva por este metal sobre la microbiota
antártica. Las CMI para cinc son comparables a las descritas por Moraga et al. (2003) en un
ambiente cercano a contaminación costera. En muestras de origen marino se encuentra
mayor porcentaje de cepas bacterianas resistentes en comparación con las de origen
terrestre, lo que podría indicar circulación de metales por corrientes oceánicas.
CONCLUSIÓN
Bacterias ambientales aisladas en Península Fildes e Isla Livingstone son resistentes a cinc
y plata mientras que se presenta una moderada frecuencia de resistencia a mercurio. Hubo
predominancia de resistencia en cepas marítimas por sobre las continentales.
AGRADECIMIENTOS
Al INACH por el financiamiento del proyecto T-17-08 y apoyo logístico en terreno.
ϭϬϰ
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
Anisimova L., T. Siunova & Boronin, A. 1993. Resistance to metals gram negative bacteria isolated
from sewage and soils of industrials regions. Microbiology, 62: 505-508.
González-Rocha, G. E. 1993. Bacilos Gram negativos aerobios heterotróficos resistentes a mercurio
aislados de agua del río Andalién. Origen genético de la resistencia. Tesis para optar al grado de
Magister en Ciencias mención Microbiología Concepción, Universidad de Concepción, Chile pp:
109
Lambert, R. J., Pearson, J,. 2000. Susceptibility testing: accurate and reproducible minimum
inhibitory concentration (MIC) and non-inhibitory concentration (NIC) values. J of app
microbiology. 88(5): 784-790
Lo Giudice, A., Michaud, L. & Bruni, V. 2007. Characterization of Antarctic psychrotrophic bacteria
with antibacterial activities against terrestrial microorganisms. J Basic Microbiol, 47: 496–505
Montuelle, B., Latour, X., Volat B. & Gounet, A. 1994. Toxicity of heavy metals to bacteria in
sediments. Bull. Environ Contam Toxicol, 53: 753-758.
Moraga, R., Merino, C. & Mondaca, M.A. 2003. Resistencia a metales pesados en bacterias aisladas
de la Bahía de Iquique. Investig Mar 31(1):91-95
Santos I.R., Silva-Filho E. V., Schaefer E.G.R. C., Albuquerque-Filho M. R., Campos, S. Lúcia.
2005. Heavy metal contamination in coastal sediments and soils near the Brazilian Antarctic Station,
King George Island. Mar pollution bulletin, 50(2):185-194
Suárez, P., Reyes R. 2002. La incorporación de metales pesados en las bacterias y su importancia
para el ambiente. Interciencia, 27(4): 160-164
Vodopívez, C., Curtosi, A., Smichowski, P. & Villaamil L, E. C. 2007. Metales pesados en el
molusco antártico Laternula elliptica. VI Simposio argentino y III latinoamericano sobre
investigaciones antárticas. Instituto antártico argentino.
ϭϬϱ
ESTIMACION DE TIEMPOS DE DIVERGENCIA Y PATRONES
CONTRASTANTES DE DIVERSIDAD GENETICA ENTRE
INVERTEBRADOS BENTONICOS MARINOS SOMEROS DE
ANTARTICA Y MAGALLANES
(Divergence time estimation and contrasting patterns of genetic diversity
between Antarctic and Magellanic near-shore marine benthic
invertebrates).
Díaz, A. 1, González-Wevar, C.A. 1, Gérard, K. 1, Cañete, J.I.2, Poulin, E. 1
1
Laboratorio de Ecología Molecular, Instituto de Ecología y Biodiversidad (IEB), Departamento de Ciencias Ecológicas, Facultad de
Ciencias, Universidad de Chile, Las Palmeras # 3425, Ñuñoa, Santiago, Chile
2
Facultad de Ciencias, Universidad de Magallanes, Avenida Bulnes # 01855, Punta Arenas - Chile
La fauna marina bentónica que habita el océano austral (OA) ha sido históricamente
considerada como parte del ecosistema más aislado del planeta, debido a la existencia de
barreras supuestamente infranqueables que se instalaron hace decenas de millones de años
(Clarke et al 2005, Thatje 2005). Este aislamiento comienza a fines del Jurásico, con la
fragmentación y distanciamiento de los bloques que conformaban el supercontinente
Gondwana y finaliza con el completo aislamiento geográfico del continente Antártico, que
corresponde a la apertura del Paso de Drake entre Suramérica y la península Antártica. La
formación de este paso oceánico, permitió la formación de la corriente circumpolar
antártica (CCA), el mayor sistema de transporte de corriente de nuestro planeta, delimitado
por el frente polar al norte y por el continente Antártico por el sur. Desde la formación de la
CCA, tres periodos son relevantes en la modelación de su circulación y en el clima del OA:
Transición Eoceno/Oligoceno; Mioceno medio y más recientemente; el período
Cuaternario, caracterizado por los ciclos glaciales - interglaciales. Estos sucesos habrían
contribuido a la paulatina disminución de las temperaturas que se inició durante el Mioceno
Medio y que provocó la extinción casi total de la macro-flora y –fauna del continente
antártico, situación que perdura hasta hoy.
En cuanto a la fauna marina somera, su distribución, abundancia y composición son
resultado de la interacción de factores geológicos, oceanográficos y biológicos a través del
tiempo y el espacio (Crame, 1999; Zachos et al., 2001; Aronson et al., 2007; Griffiths et
al., 2009). Es así como varios grupos de invertebrados marinos que son abundantes y
diversos en regiones adyacentes, están escasamente representados o incluso ausentes dentro
de la convergencia antártica (e.g., gastrópodos, bivalvos, decápodos y peces). Sin embargo
otros grupos son altamente abundantes y diversos, sugiriendo que los mayores cambios
climáticos y oceanográficos no impidieron su éxito evolutivo en esta región (e.g., porífera,
briozoos, equinodermos, poliquetos, ascidias, amphipodos e isópodos). Por otra parte es
interesante la considerable la afinidad faunística observada entre antártica y sudamérica,
comúnmente denominada como conexión Antartica-Magallanica, cuya tradicional
interpretación es que precisamente estas regiones fueron las últimas en mantener contacto
antes de la apertura del Paso de Drake. Sin embargo, el reciente descubrimiento en aguas
antárticas de larvas de decápodos y especímenes adultos de la “jaiba araña” (Hyas
araneus), grupo históricamente ausente dentro de los límites de la convergencia antártica,
podría indicar una permeabilidad del frente polar que insta a preguntas acerca de cómo
organismos ingresan al OA y qué mecanismos permiten que estos procesos ocurran (Thatje
y Fuentes 2003, Tavares & De Melo 2004). En este contexto, se plantea la probable
ϭϬϲ
existencia de contactos esporádicos y reiterados entre las faunas bentónicas de Antártica y
Sudamérica desde la separación de ambos continentes, a raíz de variaciones en la magnitud
de la CCA que podrían ocurrir durante los diferentes períodos interglaciales que marcaron
el Pleistoceno. En este caso, la presente penetración de especies subantárticas hacia la
Península Antártica podría ser parte de un fenómeno “natural” en el actual periodo
interglacial que conoce nuestro planeta y no representar un fenómeno único, directamente
ligado a la acción antrópica.
En este contexto, se plantea evaluar si la CCA constituye una barrera oceanográfica
efectiva para la dispersión larval entre las regiones del OA y estimar desde cuando ésta
opera. Para este propósito se seleccionaron especies de tres géneros de distribución
antártica y subantártica, todos caracterizados por tener un estado larval planctónico. Para
descartar la posibilidad de conexión a través de las grandes profundidades luego de la
apertura del paso de Drake, se trabajo con organismos con un rango de distribución
batimétrico somero, restringido a la plataforma continental en ambas zonas. Se determino el
nivel de divergencia molecular entre especies congéneres de invertebrados marinos de la
península antártica y extremo sur de Sudamérica. Primero se comparo Sterechinus
neumayeri, un erizo regular con distribución circumantártica con S. agassizi de la
plataforma continental de Argentina. Segundo, se comparo a la lapa antártica Nacella
concinna con su congénere Magallánico N. magellanica. Y finalmente comparamos al
bivalvo antártico Yoldia eightsi con la especie magallánica Yoldia woodwardi.
MÉTODOS
Se analizó un fragmento parcial del gen mitocondrial COI en Sterechinus (950 bp; Díaz et
al., 2011), Nacella (662 bp; González-Wevar et al., 2011) y Yoldia (688 bp). Individuos de
las distintas especies fueron colectados en localidades de la península Antártica y
Magallanes. Se estimo el tiempo de divergencia entre especies congéneres de Antártica y
Magallanes considerando el número de diferencias entre especies de ambas provincias,
asumiendo la hipótesis de reloj molecular estricto. Previo a la elección de esta hipótesis se
realizó un likelihood ratio test (LRT) utilizando DAMBE (Xia & Xie, 2001). La estimación
del tiempo de divergencia fue realizada utilizando tasas de mutación específicas para cada
género.
Se construyeron las relaciones genealógicas para los tres géneros a través de una red de
haplotipos utilizando el algoritmo de Median-Joining con Network 4.6 (Röhl, 2002;
http://www.fluxus-engineering.com). Fueron estimados los niveles de polimorfismo
genético para las species de Nacella y Sterechinus utilizando los indices estandar de
diversidad como el número de haplotipos (k) y diversidad haplotípica (H), además del
número promedio de diferencias entre par de secuencias (Π) y diversidad nucleotídica (π),
para cada provincia con el programa DnaSP 5.00.07 (Librado y Rozas, 2009). Por otra parte
se analizó la mismatch de cada especie utilizando la distancia en pares de bases para
determinar la historia demográfica poblacional para determinar cuando las poblaciones han
experimentado un repentino crecimiento.
RESULTADOS
Se detectó una discontinuidad genética entre las especies de antártica y magallanes para los
géneros estudiados. Los resultados mostraron elevados niveles de divergencia genética (>
7.0 %) entre especies congéneres de ambas regiones. Los tiempos de divergencia estimados
entre las especies de ambas provincias indican que las especies se separaron en los
ϭϬϳ
siguientes tiempos mutacionales: Sterechinus (28), Nacella (26.2) y Yoldia (24.1).
Sterechinus neumayeri (Antártica) y S. agassizi (SudAmérica) exhiben un 7.2% de
diferencias con un promedio de 56 diferencias nucleotídicas entre especies (Figura 1A). De
similar manera N. concinna (Antártica) y N. magellanica (Magallanes) exhiben un 7.7% de
diferencias con un promedio de 51,4 diferencias nucleotídicas entre especies (Figura 1B).
Mientras que Yoldia eighsi de Antártica exhibe un 7.0% de diferencias con Y. woodwardi
de Sudamérica y un promedio de 48.2 diferencias nucleotídicas entre especies (Figura 1C).
En el caso de Sterechinus, el último contacto entre las especies S. neumayeri y S. agassizi
ocurrió entre 5.6 y 7.9 Ma. La separación entre la lapa antártica N. concinna y N.
magellanica se ubica en ∼ 3,5 Ma. Finalmente, la separación entre Yoldia eightsi de
antártica y Y. woodwardi de sudamérica ocurrió hace ∼ 3.9 Ma. Por otra parte, tal como se
observó en las redes de haplotipos, las especies provenientes de Sudamérica exhiben
mayores niveles de diversidad genética (Tabla 1).
Tabla 1. Índices de diversidad genética para las especies Nacella y Sterechinus de Antártica y la provincia
de Magallanes. n = número de individuos muestreados; k = número de haplotipos; S = sitios polimórficos; H =
diversidad haplotípica; Π = número promedio de diferencias nucleotídicas; π = diversidad nucleotídica.
Especies
Sterechinus
neumayeri
(Antártica)
Sterechinus
agassizi
(Provincia de Magallanes)
Nacella concinna
(Antártica)
Nacella
magellanica
(Provincia de Magallanes)
N
110
K
15
H
0.239
S
17
Π
π
0.309
0.0003
40
16
0.768
21
1.885
0.0019
161
15
0.630
18
0.850
0.0012
81
38
0.828
29
2.338
0.0035
Figura 1. Red de haplotipos para los tres géneros bajo estudio. (A) Género Sterechinus, (B) Género Nacella
y (C) Género Yoldia.
ϭϬϴ
DISCUSIÓN
Los resultados derivados de datos moleculares revelan una importante información sobre
patrones biogeográficos, relaciones sistemáticas y estimaciones de tiempo de divergencia.
Los resultados obtenidos soportan las relaciones entre especies marinas congéneres de la
península antártica y el extremo sur de sudamérica, además de una clara diferenciación
entre ellas. Los taxa analizados se encuentran relacionados pero constituyen linajes
distintos, debido a los elevados niveles de divergencia genética entre las especies de los
grupos analizados (Equinodermos, Patellogastropodos y Bivalvos).
De acuerdo a los resultados se pueden descartar recientes procesos de flujo génico a través
de la CCA en Sterechinus, Nacella y Yoldia. Debido a las diferencias observadas entre las
especies congéneres, cuyos tiempos de separación ocurren durante el período Mio-Plioceno
(3.5 – 7.0 Ma), muy posterior a la separación de los continentes, entre 41 Ma (Livermore et
al., 2005) y 23.9 Ma (Pfühl y McCave, 2005). Época en la que según evidencia
paleoclimática ocurre una rápida disminución de las temperaturas del continente Antártico,
que generó su completa cobertura por una densa masa de hielo (principalmente en el zona
oeste). Sin embargo, estos resultados también descartan posibles contactos entre especies
antárticas y subantárticas durante el Pleistoceno (1,8 Ma – actual). En cuanto a los índices
de diversidad molecular, se demostró una menor diversidad genética para los individuos
provenientes de la Península Antártica en comparación a las de Suramérica, lo que podría
reflejar el impacto mayor del último periodo glacial sobre las especies antárticas (Poulin et
al. 2002).
Es interesante como especies de Antártica y Sudamérica que pertenecen a linajes evolutivos
distintos muestren tiempos evolutivos similares, entre 28 a 24.1. En este sentido toma
relevancia el modo de desarrollo de los tres grupos, ya que la presencia de un estado larval
habría o podría haber permitido la mantención de un cierto grado de flujo génico mientras
ambos continentes progresaban en su distanciamiento. Los resultados también indican que
los procesos oceanográficos y climáticos posteriores a esta separación no constituyeron una
barrera efectiva durante un periodo de tiempo importante y que, por otra parte, el periodo
de la separación definitiva debe haber constituido un proceso de grandes magnitudes, como
pudo ser una intensificación de la corriente y/o una aceleración en la disminución de las
temperaturas en todo el OA, de manera que pudo afectar a los grupos bajo estudio de una
manera muy similar. Ante esto, Zachos et al 2001 describen que durante este periodo de
tiempo se habría producido el mayor aumento de la capa de hielo sobre la parte Este del
continente antártico y que desde entonces, en su magnitud esta capa se encuentra estable.
AGRADECIMIENTOS
Beca CONICYT, INACH B05-09, Instituto de Ecología y Biodiversidad proyecto ICM
P05-002 y PFB -23.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
Aronson R.B., S. Thatje, A. Clarke, L.S. Peck, D.B. Blake, C.D. Wilga, and B.A. Seibel (2007)
Climate Change and Invasibility of the Antarctic Benthos. The Annual Review of Ecology,
Evolution, and Systematics 38: 129 – 54
Clarke, A., Barnes, D.K.A. y Hodgson, D.A. (2005). How isolated is Antarctica? TREE 1:1-3.
Crame, J.A., 1999. An evolutionary perspective on marine faunal connection between southernmost
South America and Antarctica. Scientia Marina 63, 1–14.
ϭϬϵ
•
•
•
•
•
•
•
•
•
•
•
Díaz, A.D.,Féral, J.-P.,David,B.,Saucede, T.,Poulin,E., (2011). Evolutionary pathways among
shallow and deep sea echinoids of the genus Sterechinus in the Southern Ocean. Deep-Sea Research
II 58 (1–2), 205–211.
González-Wevar, C.A., David,B y Poulin,E. (2011) Phylogeography and demographic inference in
Nacella (Patinigera) concinna (Strebel, 1908) in the western Antarctic Peninsula. Deep-Sea Research
II 58 (1–2), 220–229.
Griffiths, H.J., Barnes D.K.A. y Linse K. (2009). Towards a generalized biogeography of the
Southern Ocean bentos. Journal of Biogeography 36: 162 – 177.
Livermore, R., Nankivell, A., Eagles, G. y Morris, P. (2005). Paleogene opening of Drake Passage.
Earth and Planetary Science Letters, 236, 459-470
Pfuhl H. A. and I. N. McCave (2005) Evidence for late Oligocene establishment of the Antarctic
Circumpolar Current. Earth and Planetary Science Letters 235: 715–728.
Poulin, E., Palma, A.T., Féral, J.-P., (2002). Evolutionary versus ecological success of
developmental modes in coastal Antarctic benthic invertebrates. Trends in Ecology and Evolution
17, 218–222.
Tavares, M., y De Melo, G.A.S. (2004) Discovery of the first known benthic invasive species in the
Southern Ocean: the North Atlantic spider crab Hyas araneus found in the Antarctic Peninsula.
Antarctic Science. 16, 129–131
Thatje, S. y Fuentes, V. (2003). First record of anomuran and brachyuran larvae (Crustacea:
Decapoda) from Antarctic waters. Polar Biol. 26, 279–282
Thatje, S. (2005) The future fate of the Antarctic marine biota. TREE 8: 418-419.
Zachos J.C, Pagani, M., Sloan, L., Thomas, E. y Billups, K. (2001). Trends, rhythms, and aberrations
in global climate 65 Ma to present.Science, 292, 686–69.
ϭϭϬ
AGUAS ACIDAS DE ROCA COMO NUEVA FUENTE DE FE EN
LA ANTÁRTICA – IMPLICACIONES PARA EL
CALENTAMIENTO GLOBAL
Acid rock drainage as a new source of iron in Antarctica – implications
for global warming
Dold, B.* †, Gonzalez-Toril, E.°, Aguilera, A.°, Cisternas, M.E.*, Lopez Pamo, E. & Amils, R.°+
1
Instituto de Geología Económica Aplicada (GEA), Universidad de Concepción, Concepción, Chile, New Address: Departamento de
Geologia, Universidad de Chile, Plaza Ercilla 803, Santiago de Chile
2
Centro de Astrobiologia (INTA-CSIC), Madrid, Spain
3
Centro de Biología Molecular Severo Ochoa (UAM-CSIC), Universidad Autónoma de Madrid, Madrid, Spain
4
Instituto Geológico y Minero de España (IGME), Ríos Rosas 23, Madrid, Spain.
Iron is a limiting nutrient for phytoplankton growth in oceanic waters and therefore an
important parameter for the global carbon cycle. During the course of three Chilean
National Antarctic Institute (INACH; Project No. T-08-08) expeditions in 2009 - 2011 we
examined two sites in the South Shetland Islands in Antarctica that display intensive
sulphide mineralization (up to 7 wt.% pyrite and low carbonate presence) and generate
acidic (pH 3.2 – 4.5), iron-rich drainage waters. These data are the first clear evidence that
acid rock drainage occurs in the extremely cold Antarctic climate as a result of sulphide
oxidation, catalyzed by microorganisms related with acid mine drainage, including
Acidithiobacillus ferrivorans, “Thiobacillus plumbophilus”, and acidophilic Actinobacteria.
During the January 2011 expedition the oceanic Fe input (up to 100 mg/L) was detected as
submarine groundwater discharge by piezometer nests at the shoreline, and was visible in
2010 by the formation of orange-ochre schwertmannite on the sea-ice. The iron input was
correlated to an increase in the phytoplankton biomass. The accelerating melt rate of the
Antarctic glaciers, especially that observed on the Antarctic Peninsula, would increase the
surface area of exposed sulphidic rock and therefore the amount of iron released into the
sea, thus potentially increasing photosynthesis and counterbalancing global warming.
ϭϭϭ
ANTARCTIC COSMIC RAY OBSERVATORY INSIDE THE
CHILEAN NETWORK OF COSMIC RAY DETECTOR
Enrique G. C.1, Enrique F. Olivares 2
1
Cosmic Rays Laboratory. Physic Dept. Faculty of Physics and Mathematical Sciences. University of Chile. Blanco Encalada Av. 2008.
Santiago. Chile, e-mail: [email protected]
2
Cosmic Rays Laboratory. Salomon Sack Av.840 .Los Cerrillos. Santiago. Chile
The Chilean cosmic ray stations are installed in three main zones: Antarctica, King George
Island, Andes Mountain ,Altiplanic zone in Putre and in the middle latitude Los Cerrillos
in South America. There are two observatories inside the South Atlantic Magnetic
Anomaly (SAMA) both separated by a distance 1706 Km, along Andes Mountain around
70º meridian zones. We analysed and compare the main data from the stations near of
Pacific Ocean for years 1955 to 20190, the cut off rigidity and South Atlantic Magnetic
Anomaly (SAMA) .The most recent neutron monitor of He 3 was installed in the Antarctic
Cosmic Ray and geo-magnetic Observatory(LARC); operation starting in January of 2008.
A summary of the obtained results is reported in this paper.
The Chilean cosmic rays stations are located in two different regions of South America
and one in Antarctica, with the high latitude one on King George Island (LARC: Spanish
acronym for Antarctic Laboratory for Cosmic Rays), the middle latitude in LOS
CERRILLOS (Santiago of Chile) and the low latitude one in PUTRE (Andes Mountain,
part of the International Centre for Andean Studies – INCAS - of University of Chile), both
Cerrillos and Putre Anomaly and separated by a distance 1706 inside the South Atlantic
Magnetic Km, along Andes Mountain around 70º meridian zones. They are covering more
than six thousand kilometer of the South cone of America and Antarctica. The main
characteristics for the stations (location, altitude, atmospheric deep, type of detectors,
operation times and time variability of the vertical rigidity cut-off) are summarized in Table
1.
Station
Location
Geographical coordinate
Altitude
Atmospheric
deep [g/cm2]
[m.a.s.l.]
PUTRE
Andes mountain, Chile
18° 11’ 47.8” S
3,589
666
570
955
40
980
2
980
69° 33' 10.9" W
LOS CERRILLOS Santiago de Chile
33° 27' S
70° 36' W
LARC
King George Island, Antarctic
62° 12' 9" S
58° 57' 42" W
O’HIGGINS
Antarctica peninsula
63° 19' 00" S
57° 54' 00" W
ϭϭϮ
Station
Detector type
PUTRE
Muon Telescope, 3 channels. Neutron monitor IGY, 3 channels, He-3
Magnetometer, UCLA-FluxGate
UTC by GPS receiver.
LOS CERRILLOS Multi-directional Muon Telescope, 7 channels. Neutron monitor 6NM64, 3 channels,
BF-3,Magnetometer, UCLA-FluxGate UTC by GPS receiver.
LARC
Neutron monitor 6NM64-BF3, 6 channels, Neutron monitor 3NM64-He3, 3 channels
Neutron monitor 3NM64-He3 [Flux meter], 3 channels,Magnetometer, UCLAFluxGate,UTC by GPS receiver.
Table 1. Main characteristic for Chilean Cosmic Rays and Geomagnetic Stations.
COSMIC RAY ACCESS TO THE CHILEAN DETECTOR NETWORK
LARC, LOS CERRILLOS and PUTRE stations are reached by charged particles with about
2.98 [GeV], 9.92 [GeV] and 12.23 [GeV] respectively (2010), how its variability it’s easy
seen in all stations for measure and theoretical calculus in the last time. Until now we have
specially observes of the particles data rigidities in the LARC station and it linked with
LOS CERRILLOS station because the geomagnetic shield effect minor in the Antarctic
zone, in opposition now we add PUTRE station related with one zone of strong
geomagnetic shielding. The particles that arrived to detectors in all sector of South
Hemisphere present a peculiar geophysical feature related with Atlantic magnetic anomaly.
Figure 1. Asymptotic directions of approach of vertical incident cosmic rays particles for LARC, LOS
CERRILLOS and PUTRE , using DGRF 75 and DGRF 80. Variation of South Atlantic Magnetic
Anomaly/SAMA) from year 1975 to 2010. SAMA variation from 1975-2011., AP8MIN model.
ϭϭϯ
The cut-off rigidities have been calculated for neutron monitor inside Chilean stations from
the spectrum for vertical particles access on the stations its possible to identify the rigidity
values at cosmic rays penumbra, transition region between allowed and forbidden for
particles access, generally in the rigidity interval from 20 [GeV] to 0.2 [GeV] .
The significant changes found in the R C estimates for the South America region confirm
past findings on secular variation effects of the geomagnetic field
This implies that
effective cut-off rigidities and the corresponding cosmic ray asymptotic directions should
be evaluated carefully and very often, specially for detector locations near the South
Oriental Pacific Ocean and Weddell Sea. As an example, we show in Fig. 1 the Asymptotic
directions of approach of vertical incident cosmic rays particles for LARC, LOS
CERRILLOS and PUTRE , using DGRF 75 and DGRF 80. in a narrow rigidity interval (1
GV to 300GV). As can be seen, while the PUTRE and LOS CERRILLOS directions cover
several meridians, the LARC directions are nearly along a meridian. The resulting change
in the particle directions is a downward movement for the considered rigidity interval.
RESULTS OF OBSERVATIONS
The enhancement of atmospheric ionisation in the high latitude is for examples in LARC
stations is due to solar or galactic energetic protons of cosmic rays that penetrate deeper
stratospheric levels, near 15 [Km] to 20 [Km], same results has similar explain for the
energetic particle precipitation (different energy) associated with solar and geomagnetic
activity with a classic modification of atmospheric electrodynamics conditions, producing
transient interplanetary perturbations on the Earth the low speed stream the origin solar that
arrived present perturbations with enhanced magnetic field additional reffort with the
particles travel trough South Atlantic magnetic anomaly
The transit of a lot of allowed particles in the penumbra regions before to arrived at top of
atmosphere are associated with trajectories transverse large longitudinal range apparent
confirmed with the decreasing of geomagnetic component how is showed by with the
decreasing trend in the time variability effective (RC) cut-off rigidities at geographical
latitude South for a period 1975 to 2010.
Figure 2. Rigidity spectrum for vertical charged particle access at Putre-Incas, Los Cerrillos y LARC
Observatories. Black and white areas are respectively allowed and forbidden particles rigidity.
ϭϭϰ
In Fig 2 for the calculated Effective (RC) Rigidity cutoff for years 1975,1995 and 2010 we
used one version the model and program development for Shea-Smart for calculated the
magnetic field used IGRF 1975 to 2010.Is evident a modification of particles trajectories,
specially those refers to penumbra region that arrived at the top of atmosphere over the
station in high latitude in Antarctic extensive at middle an low latitude in South America
cover more than six thousand kilometre between extreme stations installed in the Pacific
oriental sector in South Hemisphere are related with changed of geomagnetic activity
reflected by variations in time of cut-off rigidity in the locations of stations place.
This property can be used to calculate the contemporary particles flux with geomagnetic
fields and Nasa radiation models. The decreased values detected in geomagnetic field and
its minimum of values detected in the South Atlantic Magnetic Anomaly (SAA) placed
around 5° North to 55° South in latitude, and 15° to 265° East (100W) in longitude, and the
increased of secondary particles flux detected for period 1980 to 2010 or part of its in the
three stations confirms this asseveration.
RESULTS AND DISCUSSION
The main scientific goal for the Chilean cosmic rays network is the study of the cosmic
radiation from high, middle and low latitude in the Antarctic and South America sectors, in
the oriental Pacific Ocean and its natural projection and continuity the Antarctic zone in the
Weddell Sea. These stations give now a good tool in situ for the study in the different solar
activity phases the longitudinal a latitudinal cosmic rays anisotropy.
The values obtained, testify a decreasing cut-off rigidity trend in the region of the South
Atlantic magnetic anomaly and zones between 18° and 62° of latitude inside the Andes
Mountain in the Pacific oriental sectors and Antarctic zones in South Hemisphere. For low
latitude values obtained for Putre station confirmed in situ one minor increase access of
cosmic rays particles due the altitude over the sea level and its high cut-off rigidity in the
location. How we expected from decreasing geomagnetic component and field intensity
vectors have a more increased for access particles in the Antarctic station linkage with low
values of its cut-off and secular decreasing of magnetic field.
ACKNOWLEDGEMENTS
The Chilean cosmic rays network program for 1990 – 2010.
Work partly supported by Chilean Antarctic Institute (INACH).
Authors are indebted with M. Storini (IFSI/CNR. Italy) .The Antarctic Research Program
of Italy (PNRA/MURST). The Chile / Italy International Collaboration for LARC and
OLC.
M. Parisi .University of Rome 3 – Italy.
CAPTIONS
Table I. – Main characteristic for Chilean Cosmic Rays Stations.
Fig.1. – Asymptotic directions of approach of vertical incident cosmic rays particles for
LARC, LOS CERRILLOS and PUTRE, using DGRF 75 and DGRF 80. Variation of South
Atlantic Magnetic Anomaly for year 1970 and year 2000.
Fig.2. – Time variability of RC cut-off rigidities at LARC, LOS CERRILLOS and PUTRE
locations for years 1975, 1995 and 2010.
ϭϭϱ
REFERENCES
•
•
•
•
E. G. Cordaro, D. Laroze, E. Olivares, D. Galvez, D. Salazar, "New 3He Neutron Monitor for
Chilean
Cosmic Ray Observatories from Altiplanic Zone to Antarctic zone". Submitted in Advances in Space
Research. December 2010.Submited to Advances in Space Research. December 2010.
D. F. Smart and M. A. Shea. GEOMAGNETIC CUTOFF RIGIDITY COMPUTER PROGRAM
Theory, Software Description and Example. Center for Space Plasmas and Aeronomic Research The
University of Alabama in Huntsville. Huntsville, Alabama 35889. 2000
D. Laroze, E.G. Cordaro, C. Utreras-Diaz & D. Urzagasti, "Thermodynamics of magnetic particles
with different uniaxial anisotropy order". Journal of Physics: Condensed Matter.2011
ϭϭϲ
THE TRANSANTARCTIC MOUNTAINS; A CORNERSTONE IN
RODINIA AND GONDWANA
*
Fanning, M.
Research School of Earth Sciences, Australian National University, Canberra ATC 0200, Australia
*
[email protected]
The majority of the Precambrian East Antarctic shield lies beneath ice, with few places
where one can examine exposures, let alone geological relationships. Along the Pacific or
Ross Sea Margin, only in the central Transantarctic Mountains (TAM) does that basement
crop out. In the Miller and Geologist Ranges metamorphic and igneous rocks of the ~3.0–
1.7 Ga Nimrod Group provide a direct window into the East Antarctic shield. These rocks
record the presence of an Archaean craton that has been significantly modified both by
Proterozoic granitoid magmatism and deformation, and by Late Neoproterozoic to early
Palaeozoic the Ross orogenic events with associated granitic intrusives. From a study of
glacial clasts and detrital zircon provenance along the length of the Transantarctic
Mountains, a previously unknown Proterozoic igneous province has been revealed with
ages of 1.88, 1.58, 1.46 and 1.06 Ga. Using the age and isotopic character of the 1.46 &
1.06 Ga rocks, direct links can be made to North America in the classic SWEAT Rodina
reconstruction. TAM is a key element in Rodinia reconstruction. Stepping forward in time,
the Cambrian-Ordovician Ross orogenic belt is an essential element of the Pacific margin
of Gondwana. Voluminous calc-alkaline magmatism comprising mainly post-orogenic
granitoids, reflects subduction of paleo-Pacific oceanic lithosphere beneath cratonic East
Antarctica. This extends along the margin to both the Delamerian orogeny in Southern
Australia and Pampean orogeny of South America. Moving further forward, the Beacon
sediments are an important resource for characterising and tracing Permian detritus and
deposition. The abundant Permian to Triassic detrital zircons are an important record of
Gandwanide sources and geologic evolution.
ϭϭϳ
AISLAMIENTO INTENSIVO DE MICROSATELITES A TRAVES
DE PIROSECUENCIACION PARA ESTUDIOS DE
ADAPTACION LOCAL EN LA LAPA ANTARTICA NACELLA
(PATINIGERA) CONCINNA (STREBEL, 1908)
(High-throughput microsatellite isolation through Pyrosequencing to
study local adaptation in the Antartic limpet Nacella concinna)
Fuenzalida, G.1, Gonzales, C.2, Poulin, E.2 & Cardenas, L.1
1
Instituto de Ecología y Evolución, Universidad Austral de Chile. Valdivia
2
Departamento Ciencias Ecológicas, Universidad de Chile. Santiago
El patrón de distribución de los gastrópodos de las especies del género Nacella, se
caracteriza porque presentan una distribución disjunta en Chile Central, Provincia
Magallánica, Provincia Kergueleniana, Provincia Antipodeana al Sur de Nueva Zelanda, y
Antártica (Fig. 1). Las especies de este género presentan características morfológicas que
las diferencian con respecto a otros gastropodos como por ejemplo la alta variabilidad de la
concha, la forma de las branquias y la estructura de la rádula entre otras (Valdovinos &
Ruth, 2005), lo cual a llevado a continuos replanteamientos taxonómicos. Un ejemplo de lo
anterior es el caso de la especie Nacella concinna, la cual es endémica de la Antártica y
dominante en el ambiente inter y submareal con una alta variación morfológica (Powel,
1973), lo cual ha llevado que varios autores pongan aprueba lo explicado anteriormente
usando caracteres morfológicos y también marcadores moleculares como COI, Isoenzimas,
AFLP (Beaumont & Wei 1991, de Aranzamendi et al., 2008, Gonzalez-Wevar et al 2011,
Hoffman et al. 2011). Sin embargo el uso de estos marcadores neutrales solo permite tener
aproximaciones relacionadas con el flujo genético y deriva genética principalmente,
dejando de lado el efecto de la selección natural, la cual podría explicar diferencia
morfológicas con fenómenos de adaptación local.
Figura 1. Distribución de especies del genero Nacella en las distintas regiones biogeograficas.
ϭϭϴ
Figure 1. Distribution of species of the genus Nacella in different biogeographic regions.
Con el desarrollo de nuevas técnicas de secuenciación, una nueva herramienta genómica
que permite utilizar marcadores moleculares ligados a genes para identificar e interpretar
como las especies interactúan con su ambiente sobre múltiples niveles de la organización
biológica, un ejemplo son los EST-SSR, que corresponden a microsatélites (SSR) ubicados
en zonas codificantes del genoma los cuales son identificados mediante el desarrollo de una
librería transcriptómica o ESTs (expressed sequences tag). El rápido desarrollo de los
microsatélites ligados a genes expresados (EST-SSRs) ha demostrado ser una opción
viable, para la obtención de marcadores de alta calidad. Su desarrollo se basa en la
secuenciación completa o parcial del ADN complementario (ADNc). La mayoría de los
EST-SSRs están localizados en las regiones UTRs (regiones transcritas del ARNm). Como
el ARNm es la copia fiel de la parte codificante de un gen, un EST es un fragmento del gen
que representa un resumen de la información de los genes expresados en un determinado
tejido y/o en una etapa del desarrollo (Hemmer-Hansen et al, 2007; Andersen et al, 2009).
Estos marcadores han permitido obtener aproximaciones sobre adaptación local y presiones
selectivas en especies marinas, lo que explicaría los patrones de distribución de las especies
(Salmo salar. Vessamägi et al., 2005) y determinar estructuración genética asociados a
procesos de selección divergente (Zostera marina. Oetjen & Reush, 2007). El mayor uso
que se les ha dado a los EST-SSRs es en los estudios de genome wide association y su
correlación a rasgos fenotípicos asociados al fitness, por lo que pueden ser usados para
determinar patrones de selección e identificación de patrones de adaptación local. Otra
ventaja de este tipo de marcadores es que tienen un alto porcentaje de transferibilidad, lo
que permite su uso en varias especies cercanamente relacionadas (Bouck & Vision 2007).
Este trabajo propone buscar y generar marcadores moleculares del última generación (ESTSSR) que permitirán responder preguntas como Cuál es el papel de la selección natural en
los patrones de diversidad genética actual en estos ambientes? La selección natural está
ejerciendo la misma presión en todas las áreas de distribución de la especie? Existe
adaptación local en la especie antártica?
La construcción de la librería se realizo a partir de la especie Nacella clypeater, la cual se
recolecto del intermareal rocoso de la playa La Misión (39°46´ - 73°23´). Se escogió esta
especie por la cercanía filogenética con Nacella concinna y además la posibilidad de
obtener muestras fácilmente. La extracción del RNA total se realizo con el método de
Trizol cloroformo (descrito según el proveedor) en tres diferentes tejidos (cabeza, manto y
pie). La cantidad y la pureza del RNA extraído se realizo mediante mediciones en el equipo
Nanodrop, mientras que su integridad fue medida en un Bioanalyzer.
Las muestras fueron enviadas al Centro de Genómica y Bioinformática de la Universidad
Mayor (http://www.umayor.cl/genomica) donde mediante el uso de un secuenciador de
última generación (Genome Sequencer FLX 454-Roche), se generaron las secuencias del
transcriptoma de la especie. El ensamblaje se realizará utilizando el programa CLC
Genomics Workbench. Los contings seran ensamblados y anotados en base al protocolo de
Gene Ontology mediante el programa Blast2GO, el cual examina la distribución de genes
en base a 3 categorías: función molecular, procesos biológicos y componentes celulares
(Ashburner et al., 2000). Esta anotación con el programa Blast2GO sera complementada
con una búsqueda de estos genes en la base de datos de NCBI para confirmar la correcta
anotación de estos genes. Posterior a esto se realizara una búsqueda de microsatélites dentro
de la base de datos generada según la metodología descrita por Provan et al., (2007). Para la
búsqueda
de
microsatélites
se
utilizará
el
programa
Troll
ϭϭϵ
(http://wsmartins.net/webtroll/troll.html) en base a motivos repetidos: di-, tri-, tetra-, pentay hexanucleotidos con un mínimo de cuatro repeticiones. Posteriormente, para la
construcción de primers para estos motivos se ocupara el programa Primer 3
(http://frodo.wi.mit.edu) en base a tres parámetros: la longitud entre 18 y 22 nucleotidos
con un optimo de 20, un producto de PCR entre 100 y 300 Pb y una temperatura de
annealing de 50°C con un porcentaje de G-C de 50%.
La generación de esta base de datos permitirá aumentar la información genómica en
organismos marinos, la cual será de libre acceso para la realización de futuras
investigaciones en esta área. Permitirá el desarrollo de marcadores moleculares para
estudios de evolución, para estudios de genética de poblaciones, para comparar esta base de
datos con otras especies de gastropodos etc. Además el tipo de marcadores antes descrito
permite la realización de una amplificación cruzada en otras especies del mismo o distinto
género cercanamente relacionadas, técnica que ya ha sido implementada en otras especies
utilizando ete enfoque en nuestro laboratorio (Cardenas et al 2011).
AGRADECIMIENTO.
Proyecto INACH T-22-10.
REFERENCIAS BIBLIOGRÁFICAS.
•
•
•
•
•
•
•
•
•
•
•
Andersen, O., Wetten, O.F., De Rosa, M.C., André, C., Alinovi, C. C. & Colafranceschi, M. 2009.
Haemoglobin polymorphisms affect the oxygen-binding properties in Atlantic cod populations.
Proceeding of the Royal Society, 276: 833–841.
Ashburner, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M., Davis, A.P., Dolinski,
K., Dwight, S.S., Eppig, J.T., Harris, M.A., Hill, D.P., Issel-Tarver, L., Kasarskis, A., Lewis, S.,
Matese, J.C., Richardson, J.E., Ringwald, M., Rubin, G.M., Sherlock, G., 2000. Gene ontology: tool
for the unification of biology. The Gene Ontology Consortium. Nature Genetics, 25: 25–29.
Beaumont, A.R. & Wei, J.H.C., 1991. Morphological and genetic variation in the Antarctica limpet
Nacella concinna (Strebel, 1908). Journal Molluscan Studies, 57: 443-450.
Bouck, A. & Vision, T. 2007. The molecular ecologist's guide to expressed sequence tags. Molecular
Ecology, 16: 907-924.
Cárdenas L, Sánchez R, Gómez D, Fuenzalida G, Gallardo-Escárate C, Tanguy A. 2011.
Transcriptome analysis by pyrosequencing in Concholepas concholepas (Gastropoda, Muricidae):
discovery of new genomic and molecular markers. Marine Genomics 4 (3): 197-205.
de Aranzamendi, M.C., Sahade, R., Tatián, M., Chiappero, B., 2008. Genetic differentiation between
morphotypes in the Antarctic limpet Nacella concinna as revealed by inter-simple sequence repeat
markers. Marine Biology, 154: 875-885.
González-Wevar, C.A., David, B., Poulin, E. 2011. Phylogeography and demographic inference in
Nacella (Patinigera) concinna (Strebel, 1908) in the western Antarctic Peninsula. Deep Sea
Research II, 58: 120 - 129.
Hemmer-Hansen, J, Nielsen, EE, Grønkjær, P, Loeschcke, V., 2007. Evolutionary mechanisms
shaping the genetic population structure of marine fishes; lessons from the European flounder
(Platichthys flesus L.) Molecular Ecology, 16 (15): 3104-3118.
Hoffman, J.I., Peck, L.S., Hillyard, G., Zieritz, A., Clark, M.S., 2011. No evidence for genetic
differentiation between Antarctic limpet Nacella concinna morphotypes. Marine Biology, 157: 765778.
Oetjen, K. & Reusch, T.B.H. 2007. Genome scans detect consistent divergent selection among
subtidal vs. intertidal populations of the marine angiosperm Zostera marina. Molecular Ecology, 16:
5156-5167.
Powell, A.W.R., 1973. The Patellid limpets of the World (Patellidae), in: Abbot R.T (Ed.), Indo
Pacific- Mollusca. Vol. 3. The Department of Mollusks, Greenville, 75-206.
ϭϮϬ
•
•
•
Provan, J., Beatty, G.E., Maggs, C.A. Savidge, G. 2007. Expressed sequence tag-derived
microsatellites for the cool-water marine copepod Calanus finmarchicus. Molecular Ecology Notes.
7: 1369-1371.
Valdovinos, C. & Rüth, M., 2005. Nacellidae limpets of the southern end of South America:
taxonomy and distribution. Revista Chilena Historia Natural, 78: 497-517.
Vasemägi, A., Nilsson, J. & Primmer, C.R. 2005. Seventy-five EST-linked Atlantic salmon (Salmo
salar) microsatellite markers and their cross-amplification in five salmonid species. Molecular
Ecology Notes, 5: 282-288.
ϭϮϭ
DIVERSIDAD GENÉTICA EN POBLACIONES DE
COLOBANTHUS QUITENSIS PRESENTES EN ANTÁRTICA
MARÍTIMA Y EL CONTINENTE
(Genetic diversity in Colobanthus quitensis populations present in
Antarctic sea and continent.)
Flores, T. S. M.1, Torres, M. G.1, Molina-Montenegro, M. A.1 & Torres-Díaz, C.2
1
Departamento de Botánica, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción, Casilla 160-C, Concepción,
Chile
2
Laboratorio de Genómica y Biodiversidad, Facultad de Ciencias, Universidad del Bio-Bío, Chillan, Chile
3
Centro de Estudios Avanzados en Zonas Áridas (CEAZA), La Serena, Chile
La Antártida es un ambiente hostil para el crecimiento de las plantas (Smith, 1984).
Factores abióticos como bajas temperaturas, escasez de precipitaciones, disponibilidad de
agua (Smith, 1993) y el bajo contenido de nutrientes (Smith, 1985; Hall y Walton 1992),
son las condiciones restrictivas para la mayoría de las plantas (Kennedy 1996). Sólo dos
plantas vasculares fanerógamas se encuentran nativas en la Antártida, Deschampsia
antarctica Desv. y Colobanthus quitensis (Kunth) Bartl (Smith, 1994). Esta última es una
planta perenne de vida corta que forma cojines compactos de pequeño tamaño, y su
anatomía de la hoja es típica de xerófitas con mesófilo de espesor, pequeños estomas y
cutícula cerosa (Mantovani y Vieira 2000). Su distribución abarca desde los Andes de
Ecuador hasta la Antártica marítima (Smith 2003),
En este estudio se realizaron análisis moleculares a poblaciones de C. quitensis presentes
en las localidades de la Antártica marítima (Arctowski (A) y Hanna-Point (HP)) y en el sur
del continente Americano (Punta Arenas (PA)). La hipótesis de trabajo es que la diversidad
genética en individuos de C. quitensis provenientes de sitios de Pta. Arenas, debiese ser
mayor que en aquellos provenientes de la Antártica Marítima, debido al patrón de
dispersión de la especies desde su centro de origen.
MATERIALES Y MÉTODOS
EXTRACCIÓN DE ADN
El ADN total fue aislado desde el tejido foliar utilizando el Método del CTAB de Doyle &
Doyle (1987). Los extractos de ADN fueron tratados con RNAsa a 37ºC por 30 min. La
calidad de las extracciones de ADN fue evaluada mediante su visualización en geles de
agarosa al 1%. La concentración de ADN fue cuantificada en un espectrofotómetro UV
(UV 160 A Spectrophotometer, Shimadzu). El ADN total fue almacenado a -20°C hasta su
posterior análisis.
PROTOCOLO DE AFLP
La técnica de AFLP se realizó para el análisis de fragmentos en secuenciador capilar. El
método consiste de tres pasos: (1) Digestión-ligación: En un solo paso, el ADN genómico
(~. 0.5 µ g) fue digerido con dos endonucleasas de restricción EcoRI y MseI, y en los
extremos de corte se ligaron adaptadores de secuencia conocida (adaptadores EcoRI y
MseI). Estos dos procesos se realizaron a 37ºC por 2 horas. (2) PCR preselectiva: Los
fragmentos con los respectivos adaptadores ligados, fueron diluidos 10 veces con buffer TE
ϭϮϮ
1X. A partir de esta dilución de procedió a realizar las amplificaciones preselectivas con
partidores de secuencia complementaria a los adaptadores más una base selectiva (EcoRI-A
y MseI-C), lo que produce en una reducción de aproximadamente 16-veces (4x4) en el
número de fragmentos amplificados. (3) PCR selectivas: Los productos de la reacción
preselectiva fueron diluidos 10 veces con buffer TE 1X. Los productos de la reacción
preselectiva fueron amplificados con partidores de secuencia complementaria a los
adaptadores más tres bases selectivas, de las cuales la primera es la misma que la base extra
de los partidores preselectivos. El número de fragmentos que originalmente resultó de la
digestión se redujo 256 veces (16x16). Todas las amplificaciones se llevaron a cabo en un
termociclador Gene Amp® PCR system 970 de PE Applied Biosystems. Los partidores
selectivos (EcoRI-3-bases) fueron marcados fluorométricamente. Los fragmentos
amplificados en esta última etapa fueron separados en un secuenciador automático (ABI
310 Applied Biosystems). Se evaluaron 16 combinaciones de pares de partidores selectivos,
de las cuales 3 arrojaron los patrones de bandeo más claros y lejibles (picos más definidos ,
intensos y claramente separados), y reproducibles.
El tamaño de los fragmentos fue determinado mediante un estándar de tamaño interno
(LIX® 500, PE Applied Biosystems). La calidad de los perfiles y de los estándares de
tamaño fueron determinadas mediante el programa ABI Prims GeneScan Analysis versión
2.1 (PE Applied Biosystems). Posteriormente los archivos de los perfiles fueron importados
en el programa Genographer versión 1.1.0 (Montana State University 1998;
Http://hordeum.oscs.montana.edu/genographer) para visualizar los fragmentos. Los
resultados del análisis fueron exportados como una matriz de presencia/ausencia en que
cada fragmento AFLP fue codificado como presencia=1, o ausencia=0 sobre todas las
muestras.
La repetibilidad del protocolo de AFLP fue evaluada mediante la comparación de los
genotipos de 4 individuos a los cuales se les realizaron 3-4 extracciones independientes de
ADN. Dichos individuos no presentaron ninguna diferencia en sus patrones de bandeo de
manera que no eliminamos ninguna locus de los análisis posteriores.
Finalmente los análisis moleculares (diversidad genética intra-poblacional y estructuración
poblacional) fueron realizados mediante el programa GENALEX 6 (Peakall & Smouse
2006).
RESULTADOS Y DISCUSIÓN
Se obtuvieron los genotipos multi-locus de un total de 45 individuos provenientes de 3
poblaciones en números iguales. Se obtuvieron un total de 301 loci a partir de dos
combinaciones de partidores selectivos (M+CA / E+ACA y M+CA / E+ACT).
DIVERSIDAD Y ESTRUCTURACIÓN GENÉTICA
El número de bandas polimorfitas fue de 182, 173 y 210 en las poblaciones de Punta
Arenas (PA), Arctowski (A) y Hanna-Point (HP), respectivamente. La heterocigosidad
esperada (HE) promedio fue de 0,151 variando entre 0,139 en PA y 0,168 en HP. La
diversidad de Shannon promedio fue de 0,231 variando entre 2,11 (PA) y 2,63 (HP). El
porcentaje de loci polimórfico promedio fue de 49,7 variando entre 42,5 y 60,1 entre las
poblaciones de PA y HP. Aunque todos los estimadores de diversidad genética resultaron
ser ligeramente mayores para la población HP, en comparación a las poblaciones PA y A,
dichas diferencias no fueron estadísticamente significativas. Lo anterior permite descartar
la hipótesis de disminución de la diversidad genética con la latitud.
ϭϮϯ
La estructuración poblacional fue significativa. Así lo indicó el análisis de varianza
molecular (AMOVA), el cual muestra que una moderada/alta proporción de la diversidad
genética (41%) corresponde a variación entre poblaciones, mientras que un 59 %
corresponde a diversidad genética intra-poblacional. Este valor puede considerarse
consistente con los valores de diferenciación genética (medida como ST) medidos para
especies perennes de vida corta como Colobanthus quitensis (Nybom 2004). A su vez, los
valores de la proporción de diversidad genética residente entre poblaciones es comparable a
los valores encontrados por van de Wouw et al. (2008).
Además, la distancia genética de Nei entre pares de poblaciones muestra que la distancia
genética entre las poblaciones de la Antártica es mayor entre ellas (0,037), que de ambas
con la población de Punta Arenas (0,256 A y 0,245 HP).
REFERENCIA BIBLIOGRÁFICA
•
•
•
•
•
•
•
•
•
•
•
•
•
HALL KJ, WALTON WH (1992). Rock weathering, soil development and colonization under a
changing climate. Philos Trans R Soc Lond Ser B 338: 269-277.
KENNEDY AD (1996). Antarctic fell®eld response to climate change:
a tripartite synthesis of experimental data. Oecologia 107: 141-150.
MANTOVANI A & RC VIEIRA (2000). Leaf micromorphology of antarctic pearlwort Colobanthus
quitensis (Kunth) Bartl. Polar Biology 23: 531-538.
NYBOM H (2004). Comparison of different nuclear DNA markers for estimating intraspecific
genetic diversity in plants. Molecular Ecology 13: 1143-1155.
PEAKALL R, PE SMOUSE (2006). GENALEX 6: genetic analysis in Excel. Population genetic
software for teaching and research. Molecular Ecology Notes 6: 288-295.
SMITH RIL (2003). The enigma of Colobanthus quitensis and Deschampsia antarctica in
Antarctica. In: Huiskes AHL, WWC Gieskes, J Rozema, RML Schorno, SM van der Vies & WJ
Wolff (eds) Antarctic biology in a global context: 234-239.
Backhuys Publishers, Leiden, The Netherlands.
SMITH RIL (1984). Terrestrial plant biology of the sub-Antarctic and Antarcticg. In: Laws RM (ed)
Antarctic ecology I. Academic Press, London, pp 61-162.
SMITH RIL (1985). Nutrient cycling in relation to biological productivity in Antarctic and subAntarctic terrestrial and freshwater ecosystems. In: Siegfried WR, Condy PR, Laws RM (eds)
Antarctic nutrient cycles and food webs. Springer, Berlin Heidelberg New York, pp 138-155.
SMITH RIL (1993). Dry coastal ecosystems of Antarctica. In: Maael E van der (ed) Ecosystems of
the world, 2A; dry coastal ecosystems, polar regions and Europe. Elsevier, Amsterdam, pp 51-71.
SMITH RIL (1994). Vascular plants as bioindicators of regional warming in Antarctica. Oecologia
99: 322-328.
van de Wouw M, van Dijk P & Huiskes HL (2008) Regional genetic diversity patterns in Antarctic
hairgrass (Deschampsia antarctica Desv.). Journal of Biogeography 35: 365-376.
ϭϮϰ
MEDICIONES ABSOLUTAS DE IRRADIANCIA ESPECTRAL
UV EN LA PENÍNSULA ANTÁRTICA
Gárate F, Sánchez C, Quiroz F, Martínez F, Damiani A & Cordero R.R
1
Departamento de Física, Universidad de Santiago de Chile, Santiago, Chile
RESUMEN
En el marco del proyecto Anillo ACT98: “Surface spectral UV radiation and UV-linked
effects on endemic species” se llevó a cabo a principios de este año (Enero y Febrero de
2011) una campaña de mediciones de radiación UV en superficie. La campaña involucró el
envío a Escudero ("Base Profesor Julio Escudero", 62 º 12 'S, 58 º 57' W) de un sistema de
espectroradiometría desarrollado atendiendo a las especificaciones de la Red para la
Detección de Cambios en la Composición Atmosférica (NDACC). El espectroradiómetro
cuenta con un doble monocromador (para minimizar la influencia de la stray light), un
fotomultiplicador (PMT) como detector (para asegurar la linealidad de las mediciones), y
fue operado bajo condiciones controladas de temperatura (para asegurar su estabilidad). En
nuestro sistema, la radiación es conducida mediante una entrada óptica que emplea un
difusor de bajo error del coseno (<10% para ángulos del cenit menores a 60 grados)
conectada al doble monocromador con fibra óptica. La trazabilidad de las mediciones
absolutas se asegura mediante un set de lámparas que actúan como fuentes de calibración.
Se espera que nuestras mediciones espectrales de la irradiancia UV permitan determinar
algunas de las características de la climatología local UV y por tanto, generar mejores
estimaciones de las dosis de UV que afectan a especies endémicas. Dos nuevas campañas
antárticas están planeadas.
KEYWORDS
UV irradiance; Ozone; Antártica
ϭϮϱ
DIVERSIDAD GENETICA Y ESTRUCTURACIÓN A PEQUEÑA
ESCALA DE ABATUS AGASSIZII (MORTENSEN, 1910), UN
ERIZO ANTÁRTICO INCUBANTE EN LA BAHIA FILDES (ISLA
REY JORGE, SHETLAND DEL SUR)
(Genetic diversity and small scale population structure of Abatus
agassizii (Mortensen, 1910), a brooding Antarctic echinoid from Bahia
Fildes, King Georges Island, South Shetland).
Gérard, K., Maturana, C., Martínez, A., Díaz, A. & Poulin, E.
Laboratorio de Ecología Molecular (LEM), Instituto Ecología y Biodiversidad (IEB), Universidad de Chile, Santiago, Chile.
Con el fin de entender el origen y evolución de las faunas marinas Antárcticas y
Magallánicas, es necesario considerar las capacidades de dispersión las que se encuentran
estrechamente relacionadas con el modo de desarrollo. Los invertebrados marinos
bentónicos de la Antártica se caracterizan por una alta proporción de especies incubantes
(Poulin& Féral 1996). La incubación corresponde a la retención de huevos por la hembra,
limitando la dispersión de las crías. El género de erizo Abatus es endémico de las regiones
antárticas y sub-antárticas e incluye 11 especies nominales, las cuales son todas incubantes.
En estas especies, el desarrollo directo (sin fase larval), junto con la baja dispersión de
gametos masculinos y la limitada movilidad de los adultos deberían limitar drásticamente la
conexión entre parches de individuos y por ende el flujo de genes entre y dentro de las
poblaciones. En A. cordatus, una especie endémica del archipiélago de Kerguelén, se
observo una diferenciación genética entre poblaciones alejadas por algunos kilómetros
(Poulin& Feral 1994).
En el marco de un proyecto científico INACH, se descubrió la única población de A.
agassizii localizada en la Bahía Fildes, isla Rey Jorge, Shetland del Sur. Esta población se
encuentra entre 1.5 y 12 metros de profundidad en la Península Ardley. La primera
caracterización de esta población indicó que se extiende en una zona más amplia.
En este estudio, investigamos los límites geográficos de la población de A. agassizii a lo
largo de la Bahía Fildes (Isla Rey Jorge). Analizamos y comparamos la diversidad genética
de 9 marcadores microsatélites entre 10 sitios de muestreo y relacionamos la existencia de
una estructura genética con la escala geográfica (desde 500 m hasta 5.7 km). Los
microsatélites son marcadores nucleares con alta tasa de mutación.
MATERIALES Y METODOS
Muestreamos 365 individuos de A. agassizii distribuidos en 10 sitios a lo largo de la Bahía
Fildes. El número de individuos por sitio se extiende entre 5 (un sitio), 32 hasta 42 (8
sitios), y 65 individuos (un sitio). Las características de los 9 loci se obtuvieron con
Microcheker (Van Oosterhout et al. 2004) y Freena (Chapuis& Estoup 2007). Los valores
de diversidades fueron obtenidos con los programas Genetix 4.0 (Belkhir 2000) y Genalex
(Peakall& Smouse 2006). La estructura genética se evaluó con Fst pareados, AMOVA
(Excoffier et al. 2005), y análisis de clusters con Genetix 4.0, Arlequin y Structure
(Pritchard et al. 2000).
ϭϮϲ
RESULTADOS
Entre los 9 loci microsatélites disponibles, 6 fueron utilizables, uno de los cuales contenía
alelos nulos. La diversidad genética aparece igualmente repartida entre los sitios. Una
diferenciación genética se observo entre ciertos sitios a partir de 800 metros de distancia.
Se identificaron 3-4 grupos de sitios diferenciados: 1) un sitio al sur de la base China, 2) la
bahía de la base China, 3) la costa norte de la península Ardley, 4) la orilla Norte de la
Caleta Ardley.
DISCUSIÓN
La población de A. agassizii en Bahía Fildes se extiende en varios parches de tamaño
variable, separados y aislados por zonas con condiciones no aptas para esta especie (zona
expuestas, batimetría alta, fondos rocosos sin sedimentos).
A pesar de la reducida capacidad de dispersión de A. agassizzi, detectamos un grado de
diversidad genética mantenido o lo largo de los sitios de la Bahía Fildes. La estructura
genética revelada, aunque significativa, es de muy bajo nivel y ocurre a partir de 800
metros de distancia entre la caleta Ardley, la caleta de la base China y el sitio al Sur de la
base China. En paralelo, se observo dentro de cada grupo una homogenización genética
entre sitios alejados de 1 km, sugiriendo la existencia de varias unidades panmícticas.
CONCLUSIONES
A pesar de sus limitadas capacidades de dispersión, Abatus agassizii en la Bahía Fildes
demuestra un nivel muy bajo de estructura genética y una homogeneidad genética dentro de
parches de más de 1 kilometro de largo.
AGRADECIMIENTOS
Corporación IEB (P05-002ICM, PFB-23), FONDECYT 3100139, INACH (F_01-09).
REFERENCIA BIBLIOGRÁFICA
•
•
•
•
•
•
•
•
Belkhir K (2000) Genetix version 4.01. Belkhir Biosoft, Laboratoire Génome, Populations,
Intéractions - Université Montpellier 2, Montpellier, France.
Chapuis M-P, Estoup A (2007) Microsatellite null alleles and estimation of population
differentiation. Molecular Biology Evolution 24, 621–631.
Excoffier L, Laval G, Schneider S (2005) Arlequin ver. 3.0: An integrated software package for
population genetics data analysis. Evolutionary Bioinformatics Online 1, 47-50.
Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic software
for teaching and research. Molecular Ecology Notes 6, 288-295.
Poulin E, Feral J-P (1994) The fiction and the facts of Antarctic brood protecting: population
genetics and evolution of schizasterid echinoids. In: Echinoderms through time (ed. David G, Féral
& Roux), pp. 837-844. Balkema, Rotterdam.
Poulin E, Féral J-P (1996) Why are there so many species of brooding Antarctic Echinoids?
Evolution 50, 820-830.
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus
genotype data. Genetics 155, 945-959.
Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) MICRO-CHECKER: software for
identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 6, 255–
256.
ϭϮϳ
ϭϮϴ
FLAVOBACTERIUM SP.: EVALUACIÓN DE LA HIDRÓLISIS DE
POLISACÁRIDOS EN UNA CEPA AISLADA DESDE
ANTÁRTICA
(Flavobacterium sp.: Evaluation of the hydrolysis of polysaccharides in
an Antarctic isolated bacterium)
Gimpel, C.1, Lavín, P.1,2, Gonzalez, A.1 & Gonzalez, M.1.
1
Laboratorio de Biorrecursos Antárticos, Instituto Antártico Chileno
2
Fundación Científica y Cultural Biociencia
Antártica presenta una enorme cantidad de ecosistemas que no han sido explorados aún por
la ciencia, y que están en constante exposición a condiciones extremas. La radiación UV,
disecación, bajas temperaturas y aislamiento han jugado un rol fundamental en el desarrollo
de vida única. Particularmente la zona intermarial de la Isla Rey Jorge, Islas Shetland del
Sur, es afectada por las mareas, aguas de deshielo y vientos que generan corrientes
superficiales. En este ecosistema encontramos varias especies de macroalgas, y hemos
basado nuestra investigación en una de ellas, Porphyra columbina. Este nicho ecológico
rico en nutrientes (Bouvy et al. 1986, Armstrong et al. 2001) presenta la oportunidad de
identificar nuevos compuestos bioactivos (Ireland, et al 2000) que sean capaces de
metabolizar polisacáridos a bajas temperaturas, provenientes principalmente de bacterias
colonizadoras (Steinberg et al. 2002). Lo expuesto no sólo posee relevancia científica sino
que es un potencial aporte a la biotecnología implicada en industrias como la alimenticia,
farmacéutica y cosmetológica.
Sabido es que las algas rodófitas conforman su pared celular principalmente de agar, y que
esto presenta una importante fuente de carbono para microorganismos que habitan en sus
frondas (Michel, 2006) Particularmente en etapas de descomposición, aumentan los
microbios que participan en la degradación de esta materia orgánica y generan biopelículas
que se encargan de una importante parte de la producción primaria de este nicho (Bernardet
& Bowman, 2006).
Motivados por la búsqueda de enzimas sicrófilas, es que se aislaron bacterias desde frondas
de algas Porphyra columbina (Rhodophyta) en descomposición. Se obtuvieron 8 cepas con
actividad agarolítica, siendo la denominada AIRJ-11.6, la con mayor actividad al degradar
agar-agar. Esto se determinó tanto cualitativa como cuantitativamente, utilizando método
de cuantificación de azucares reductores por medio de la técnica del DNS (Miller, 1959).
Se realizó la correspondiente caracterización de la cepa y posteriormente del extracto
proteico obtenido. Las enzimas que hidrolizan estos biopolímeros no sólo son atractivas por
dicha actividad en sí, sino por los neoagarooligosacáridos que producen que han sido
reportados como inhibidores del crecimiento bacterial, disminuyen la degradación del
almidón y se utilizan como aditivo de bajas calorías en alimentos para mejorar su calidad
(Fu & Kim, 2010). Mediante la biocatálisis se logran altos niveles de rendimiento y
moléculas limpias de un modo efectivo (Giordano, 2006).
Las agarasas, que actualmente se utilizan comúnmente en biología molecular y para la
obtención de protoplastos limpios, han sido purificadas principalmente desde cepas de
ambientes marinos, tales como Vibrio sp., Alteromonas sp., Bacillus sp., Cytophaga sp.,
Pseudoalteromonas sp. y Pedobacter sp., siendo sólo algunas reportadas para ambientes
fríos, y sin presentar actividad sicrofílica en la catálisis (Fu & Kim, 2010).
ϭϮϵ
MATERIALES Y MÉTODOS
Aislamiento y selección de cepas. Se muestrearon macroalgas rodófitas en descomposición
desde Bahía Fildes. Trozos de fronda se pusieron en contacto con placas de los medios LB,
R2A y agar marino, en condiciones estériles. Se generaron cultivos puros de aquellas cepas
que presentaran notables depresiones alrededor de las colonias. Se seleccionaron ocho
cepas con actividad y se mantuvieron a 10ºC. Se hizo una evaluación cualitativa de la
actividad enzimática a temperatura ambiente, mediante el método de tinción con lugol (Fu,
2008) distinguiéndose la cepa AIRJ-11.6 por el halo formado.
Caracterización e identificación de la cepa AIRJ-11.6. Se mantuvo la cepa en cultivos puros
de caldo y agar marino, y se procedió a la caracterización clásica de la misma, incluyendo
tinción Gram, observación microscópica, curvas de crecimiento para determinar la
temperatura óptima de crecimiento, extracción de ADN y posterior secuenciación del gen
ribosomal 16S, pruebas bioquímicas API 20NE y API ZYM (Biomerieux), test de KOH
para verificar la posible producción de riboflavinas descrito por Reichenbach, resistencia a
aumento en la salinidad y a diferentes rangos de pH. Se realizó un BLAST para la
identificación de la cepa y luego se analizó la relación filogenética con el género resultante.
Extracto proteico. Se cultivó la cepa en 500 ml de agar marino con una concentración de
0.015% de agar, con lo que se consigue un medio semisólido que brinda como principal
fuente de carbono, al polisacárido. Se aplicó agitación y una temperatura de 10ºC. Luego de
36 hrs el medio se mostraba líquido y el cultivo crecido. Una vez obtenido el sobrenadante
libre de células, fue filtrado y liofilizado para luego resuspenderlo en PBS. Con este mix de
proteínas extracelulares se procedió a hacer las pruebas de actividad enzimática.
Actividad enzimática. Se hicieron pruebas en placas de PBS y agar, sometiendo el
resuspendido a 4, 20 y 40ºC. El halo producido se midió cada 6, 12, 24 y 48 hrs. Para
calificar la actividad se tiñeron las placas con lugol. El análisis cuantitativo realizado con el
método de DNS, tuvo como sustratos soluciones de agar agar (polisacáridos compuesto de
agarosa y agaropectina en proporciones variables), agarosa, alginato y tejido de
Macrocystis pyrifera pulverizado y se sometió a distintas temperaturas.
RESULTADOS
Según los análisis realizados, el aislado AIRJ-11.6 es una cepa de la familia
Flavobactericeae, Gram negativa, bacilar, forma colonias amarillas, convexas y circulares
de bordes definidos, con una temperatura óptima de crecimiento a los 10ºC en caldo
marino. Esta Flavobacterium sp. no mostró producción de pigmentos del tipo flexirubinas y
creció en un rango de pH 5-9, siendo su óptimo el pH 6. Resistió una salinidad del 5,5% sin
afectar sus niveles de crecimiento.
El árbol filogenético obtenido luego de la construcción de un contig de 1385 pb mediante la
utilización del software Sequencer, se basó en las cepas cultivables más cercanas reportadas
(Miyashita and others, 2010). A continuación se muestra el resultado. Destaca Fl. algicola
como la más cercana especie, pero que a su vez presenta características fisiológicas
diferentes. Ambas coinciden en haber sido aisladas de ambientes marinos. En el árbol se
aprecian cepas que han sido aisladas también desde ambientes fríos, como lo son Fl.
degerlachei y Fl. frigoris. Además hay reportes de agarasas extraídas desde cepas de este
género (Fl. limicola, Fl.saccharophilum y Fl. flevense) sin relacionarse en el mismo
cluster que la cepa AIRJ-11.6, a pesar de considerarse en el árbol.
ϭϯϬ
Figura 1. Árbol filogenético construido para el contig de 1385 pb de la cepa AIRJ-11.6, utilizando el
método Maximum likelyhood con bootstrap de 100.
Los principales resultados de los test API realizados caracterizan la cepa como reductora de
nitratos en nitrógeno, presenta actividad -Glucosidasa y -Galactosidasa, asimila DGlucosa, D-Manitol, D-Maltosa y en baja medida D-Manosa. Además posee actividad
citocromo oxidasa.
Respecto de la actividad enzimática medida, se presentan a continuación uno de los
gráficos resultantes.
Figura 2. Gráfico resultante de la medición con método DNS de la actividad enzimática. Se hizo tomando
como estándar una curva de glucosa y como sustrato se utilizó agarosa.
DISCUSIÓN Y CONCLUSIONES
Se propone que la cepa AIRJ-11.6 represente una nueva especie de Flavobacterium,
principalmente por las diferencias metabólicas con sus más cercanos pares. Para esto será
ϭϯϭ
necesario concretar análisis de contenido porcentual de GC y determinación de ácidos
grasos celulares.
Respecto del extracto proteico se tiene una actividad hidrolítica importante para los
sustratos presentados, y lo destacable es que la enzima cataliza a temperaturas menores que
las agarasas reportadas hasta ahora, que poseen óptimos entre los 30 y 55ºC (Fu & Kim,
2010). Se determinó la carga total del extracto activo mediante electroforesis en geles de
agarosa, a un pH de 8.8, resultando positiva. En base a esto se realizará la purificación
mediante columnas de afinidad. Además se probará la actividad enzimática en sustrato puro
de alginato.
AGRADECIMIENTOS
A INACH y al proyecto Corfo-INNOVA 07CN13PXT-64.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
Armstrong E, Yan L, Boyd KG, Wright PC and Burgess JG (2001) The symbiotic role of marine
microbes on living surfaces. Hydrobiologia 461:37–40.
Bernardet, J. F. & Bowman, J. P. 2006 The genus Flavobacterium. Prokaryotes 7, 481–531.
Bouvy M, Le Romancer M and Delille D (1986) Significance of microheterotrophs in relation to the
degradation process of subantarctic kelp beds (Macrocystis pyrifera). Polar Biol 5:249–253.
Fu X, Lim H and Kim X (2008). Purification and characterization of a novel -agarase, AgaA34,
from Agarivorans albus. Appl Microbiol Biotechnol 78: 265-273.
Fu, X. and Kim, S. (2010). Agarase: Review of Major Sources, Categories, Purification Method,
Enzyme Characteristics and Applications. Marine Drugs, 8, 200 – 218.
Giordano A, Andreotti G, Tramice A and Trincone A. Review: Marine glycosyl hydrolases in the
hydrolysis and synthesis of oligosaccharides. Biotechnol. J. 2006, 1, 511–530.
Ireland CM, Copp BR, Foster MP, McDonald LA, Radisky DC and Swersey JC. (2000) Bioactive
compounds from the sea. In: Martin RE Carter EP Davis LM, eds. Marine and freshwater products
handbook. Lanceaster. PA: Technomic Publishing, 641–61.
Michael G, Nyval-Collen P, Barbeyron T, Czjzek M and Helbert W (2006). Bioconversion of res
seaweed galactans: a focus on bacterial agarases and carrageenases. Appl Microbiol Biotechnol
71:23-33.
Miller, G.L. (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal.
Chem. 31 (3): 426-428.
Miyashita M, Fujimura S, Nakagawa Y, Nishizawa M, Tomizura N, Nakagawa T and Nakagawa J
(2010). International Journal of Systematic and Evolutionary Microbiology 60: 344-348.
Reichenbach H. (1989). Order I. Cythophagales Leadbetter 1974, 99AL. In Bergey´s Manual of
Systematic Bacteriology, vol. 3, 2011-2013.
Steinberg PD, de Nys R (2002) Chemical mediation of colonization of seaweeds surfaces. J Phycol
38:621–629.
ϭϯϮ
DISTRIBUCIÓN DE COLIFORMES FECALES EN LAS
PROXIMIDADES DE LAS DESCARGAS DE AGUAS
RESIDUALES Y SU RELACIÓN CON LOS SISTEMAS DE
TRATAMIENTO EN BASES ANTÁRTICAS
(Distribution of fecal coliform near the discharge of wastewater and its
relationship to treatment systems in Antarctic Stations).
Gómez-Fuentes C.1, Calisto-Ulloa N.1 & Astorga-España M.2
1
2
Departamento de Ingeniería Química, Facultad de Ingeniería, Universidad de Magallanes, Punta Arenas Chile
Departamento de Ciencias y Recursos Naturales, Facultad de Ciencias Universidad de Magallanes, Punta Arenas Chile, e-mail:
[email protected]
La mayoría de las bases antárticas poseen plantas de tratamiento de aguas servidas las
cuales tienen por objetivo disminuir el impacto de los asentamientos humanos en el
altamente sensible medio antártico. Estas plantas buscan principalmente la disminución de
la materia orgánica y de los microorganismos de origen fecal, los cuales actúan como
indicadores organismos patógenos.
La medición en terreno del efecto de los efluentes tratados es compleja, ya que estos suelen
ser descargados a aguas marinas, las cuales por su alto nivel de sal dificultan medidas de
materia orgánica y compuestos del nitrógeno, lo que sumado a la presencia natural de estos
compuestos en el medio hace difícil la identificación de plumas de contaminación cuando
la contaminación no es severa. Esto no ocurre cuando se utilizan coliformes fecales como
indicadores de la calidad del tratamiento, ya que su medida no es interferida por la salinidad
y su concentración es naturalmente baja incluso cerca de pingüineras donde se han
informado valores entre 4 y 12 UFC/100 ml (Hughes y Thompson, 2004). Esto ha llevado a
que se hayan realizado estudios de las plumas de contaminación utilizando coliformes
fecales en distintas bases antárticas (Bruni et al., 1997; Delille y Delille, 2000; Hughes y
Blenkharm, 2003) estudiando tanto su distribución como los efectos estacionales en su
supervivencia (Hughes, 2003).
Este estudio busca relacionar el funcionamiento de las plantas de tratamiento y el efecto de
sus modificaciones en las plumas de efluentes en Bahía Fildes, Isla Rey Jorge, Territorio
Antártico Chileno utilizando como indicar coliformes fecales. Para esto se realizaron
medidas durante tres veranos consecutivos desde 2009 hasta 2011, considerando la costa
cercana a la Base Rusa Bellingshausen, a la Base Eduardo Frei Montalva y Villa las
Estrellas, Base Profesor Julio Escudero y Capitanía de Puerto Bahía Fildes.
METODOLOGÍA
Área de estudio y muestreo. El área de estudio corresponde a la Bahía Fildes, ubicada en
la Isla Rey Jorge en el archipiélago de las Shetland del Sur. En esta Bahía existen tres Bases
Antárticas, que funcionan de forma permanente, la Base Rusa Bellingshausen y las Bases
Chilenas Presidente Eduardo Frei y Capitanía de Puerto de Bahía Fildes. Durante la
temporada de verano entra en funcionamiento la base científica Profesor Julio Escudero del
Instituto Antártico Chileno y aumenta el tráfico en el aeropuerto que sirve como entrada al
continente antártico de gran cantidad de científicos, turistas y logísticos de todas las
nacionalidades.
Las distintas bases ubicadas en la Bahía Fildes cuentan con distintos tipos de tratamientos
de sus aguas residuales, las cuáles una vez tratadas son descargadas a la Bahía, debido a
ϭϯϯ
esta situación los sitios de muestreo fueron seleccionaron de tal manera que los afluentes a
la Bahía Fildes (identificados como R, FA y CAP) representaran los centros de
semicírculos de radios 10, 25 y 50 metros, las muestras se tomaron en las intersecciones de
estos semicírculos con el borde costero y de forma radial mar adentro. Adicionalmente se
seleccionó un punto en el centro de la Bahía, denominado F, y se tomaron muestras
considerando semicírculos de 150, 350 y 600 metros con el objeto de cubrir un área mayor
de muestreo. Finalmente se consideraron muestras blanco, alejadas de la influencia
antropogénica.
Las muestras fueron recolectadas durante los meses de enero y febrero de los años 2009,
2010 y 2011.
Métodos de análisis. Para el muestreo y la elección de los métodos de análisis se siguieron
las recomendaciones establecidas en el Antarctic Environmental Monitoring Handbook,
Standard Techniques for Monitoring in Antarctica (COMNAP/SCAR 2000)
Los parámetros físicos pH, Temperatura (T) y Oxigeno Disuelto (OD) fueron determinados
utilizando una sonda multiparámetro Hanna HI9828.
La determinación de Coliformes Totales (CT) se realizó utilizando el método de filtración
por membrana ISO 9308-1:2000.
Los parámetros Aceites y Grasas (AyG), Nitrógeno total Kjeldhal (NTK), Nitratos (NO-3)
y Fósforo Total (PT) se utilizó la metodología establecida en el Standard Methodos for the
Examination of Water and Wastewater (APHA, 1999), para la cuantificación de materia
orgánica se utilizó la determinación de la Demanda Química de Oxigeno (DQO) según la
metodología para agua de alta salinidad recomendada por Vyrides and Stuchey (2009).
Los análisis de CT y AyG fueron realizados en el laboratorio de la Base Profesor Julio
Escudero y para los restantes análisis se prepararon las muestras con los conservantes
adecuados para ser analizadas en la ciudad de Punta Arenas.
RESULTADOS Y DISCUSIONES
Los resultados de los parámetros físico químicos medidos no mostraron claras relaciones
entre los efluentes y su dispersión en el ambiente, no observándose a niveles significativos
la influencia de los vertidos en el medio marino. Es así como en el caso de materia orgánica
y nitrógeno fueron más importantes las variaciones en las concentraciones causadas por las
condiciones ambientales naturales, como presencia de algas, bajas profundidades de agua y
mayor temperatura en ciertas zonas de la costa que las debidas a la presencia de efluentes.
En el caso de aceites y grasas, este parámetro mostró relación con un accidente de vertido
de hidrocarburos a la bahía en la campaña inmediatamente posterior a la fecha del
accidente.
El conteo de coliformes fecales de las muestras tomadas en la costa se observan en la figura
1. Las muestras tomadas en el mar ya a los 10 metros de la costa muestran conteos
inferiores a 10 UFC/100 ml en los puntos cercanos a los efluentes siendo inferiores a 2
UFC/100ml para muestras más alejadas. Esta situación se explica porque los vertidos tanto
de la base Eduardo Frei como el vertido combinado de la Base Profesor Julio Escudero con
Capitanía de Puerto son descargados cerca de la orilla superficialmente por lo cual el viento
predominante contra la costa tiende a mantener la pluma de dispersión contra ella. Por otro
lado la Base Rusa vierte al río, el que al ser de agua dulce, tiende a mantenerse sobre la
superficie también sometido a la influencia de los vientos, generando el mismo efecto que
en los demás puntos de vertido.
ϭϯϰ
Figura 1. Coliformes fecales en los puntos de muestreo de la costa.
Figure 1. Fecal coliform in sampling points along the coast.
El primer año de muestreo (2009) indica que la mayor concentración de coliformes fecales
se encuentra en el punto CAP y en los puntos ubicados hacia la derecha del mismo. Este
patrón de dispersión también se observa, aunque con mucha menor intensidad en el punto
FACH, seguramente por efecto de los vientos superficiales. En cambio en el punto R, la
dispersión ocurre aproximadamente en forma pareja hacia ambos costados de la
desembocadura del río, situación explicable por el mayor caudal aportado a la bahía.
Los años siguientes 2010 y 2011, muestran variaciones significativas respecto del primer
año, desapareciendo las coliformes fecales del punto CAP y sus alrededores y aumentando
en el punto identificado como FACH. Los valores observados en la desembocadura no
presentan variaciones significativas en las tres temporadas.
El caso más interesante es el presentado por el punto CAP, el cual eliminó su efecto sobre
la bahía en las temporadas 2010 y 2011, esta situación se explica por la incorporación de
una nueva planta de tratamiento modular basada en lodos activados incorporada al final de
la temporada 2009. La modificación del sistema de tratamiento incluyó una nueva planta
especialmente diseñada para las dos bases que sirve y un nuevo sistema de vertido, el cual
consiste en la infiltración subsuperficial del efluente tratado. Al no ser objetivo de este
proyecto la medida de la calidad de los efluentes, se especula que el efecto combinado del
cambio de tecnología, la desinfección del efluente y el nuevo sistema de descarga son los
responsables de los resultados observados. Debe destacarse que en base a las mediciones en
el medio es imposible diferenciar el efecto del sistema de tratamiento de la filtración natural
que pueda estar ocurriendo debido a la infiltración, sin embargo, de ser este efecto
significativo, los resultados muestran que el medio no se ha saturado en dos años de
operación.
Por otro lado el punto FACH, aumentó el conteo de coliformes fecales significativamente
en las temporadas 2010 y 2011. Esto no se puede justificar por un cambio del sistema de
tratamiento, ya que no se introdujeron modificaciones significativas en esas temporadas, sin
embargo si estaría indicando que el sistema que fue exitoso en la temporada previa perdió
efectividad en la reducción de microorganismos. El sistema de desinfección utilizado en el
vertido en cuestión es desinfección UV, esto da las siguientes hipótesis para la explicación
de los resultados observados: a) la lámpara UV cumplió su vida útil lo que explicaría que
durante dos años el conteo de coliformes aumentó o b) por algún fallo del sistema este
contiene una alta cantidad de sólidos lo que hace ineficiente la desinfección. En cualquiera
ϭϯϱ
de las dos hipótesis las medidas realizadas en el medio estarían dando cuenta de fallas en el
sistema de tratamiento.
El tercer punto de interés, desembocadura del río, no muestra cambios significativos en las
tres temporadas, lo cual es consecuente con que no se han introducido cambios en la
operación de esta base.
En base a los resultados obtenidos se demuestra que las coliformes fecales son excelentes
indicadores de la calidad de tratamiento aplicada a los efluentes permitiendo cuantificar
tanto pluma de contaminación como la efectividad y el grado de mantenimiento de las
plantas de tratamiento. Por otro lado queda por demostrar que no existe en el caso del punto
CAP una acumulación de coliformes en los sedimentos y que los resultados observados son
principalmente resultado del cambio de tecnología y que los valores bajos de coliformes
fecales se mantendrán en el tiempo.
CONCLUSIONES
Las coliformes fecales, al igual que en estudios de otros autores, mostraron ser un excelente
indicador de la contaminación por aguas residuales y la pluma de contaminación generada.
Más aun mostraron ser claros indicadores del funcionamiento de las plantas de tratamiento
y el estado de mantenimiento de las mismas.
Las modificaciones en el sistema de tratamiento y la forma de introducción al medio de los
efluentes tiene efectos significativos en la cantidad de contaminantes detectados. Es así
como los resultados obtenidos parecen indicar que los sistemas de infiltración entregan un
mayor grado de seguridad en la calidad del medio, mientras que fallas en la operación de
las plantas de tratamiento son inmediatamente acusadas en las inmediaciones de los
vertidos.
En todas las campañas de muestreo realizadas, la contaminación de origen antropogénico
detectada, mostró estar acotada a puntos cercanos a los vertidos de las bases antárticas.
AGRADECIMIENTOS
Los autores agradecen al Instituto Antártico Chileno el apoyo logístico y el financiamiento
del proyecto T09-08.
REFERENCIA BIBLIOGRÁFICA
•
•
•
•
•
•
APHA-AWWA-WEF. 1999. Standard Methods for Examination of. Water and Wastewater, 20th
Edition. American Public Health Association (APHA),. American Water Works Association
(AWWA) and Water Environment Federation (WEF). Washington, 1325 pp.
Delille, D. y Delille, E. 2000. Distribution of enteric bacteria in Antarctic seawater surrounding the
Dumont d‘Urville permanent station (Adelie land). Mar. Pollut. Bull., 40: 869–872.
Hughes K.A. 2003. Influence of seasonal Environmental variables on the Distribution of
presumptive fecal coliforms around an antarctic research station. Water Res., 39: 2237-2244.
Hughes, K.A. y N. Blenkharn. 2003. A simple method to reducedischarge of sewage microorganisms
from an Antarctic research station. Mar. Pollut. Bull., 46: 353–357.
Hughes, K.A. y Thompson, A. 2004. Distribution of sewage pollution around a maritime Antarxtic
research station indicated by feacal coliforms, Clostridium perfringens and feacal sterol markers.
Environ. Pollut., 127: 315-321.
COMNAP/SCAR. 2000. Antarctic Environmental Monitoring Handbook, Standard Techniques for
Monitoring in Antarctica. Council of Managers of National Antarctic Programs (COMNAP) and
Scientific Committee on Antarctic Research (SCAR), Australia, 218 pp.
ϭϯϲ
ϭϯϳ
EVOLUCION DE LAS AREAS LIBRES DE HIELO Y
MODELAMIENTO DE LA DISTRIBUCIÓN DE NICHOS DE
Sanionia uncinata EN LAS ISLAS SHETLAND DEL SUR,
ANTARTICA
(Free-ice areas evolution and modeling of Sanionia uncinata niches
distribution at the South Shetlands Islands, Antarctica.)
González, I.1, Hebel, I.2 & Jaña, R.3, 4
1
Programa Magíster en Ciencias Antárticas - mención Glaciología, Dirección de Programas Antárticos, Universidad de Magallanes
2
Laboratorio de Biotecnología & Genética de Plantas, Centro Hortícola “Lothar Blunck”, Universidad de Magallanes
3
Instituto Antártico Chileno; 4. Fundación CEQUA.
El pulsante retroceso de los hielos, tienen una importancia ecológica fundamental, que
radica básicamente en que las nuevas áreas libres de hielo, constituyen zonas susceptibles
de ser colonizadas por especies vegetales. En Antártica y Patagonia, condiciones más
cálidas ocurridas a partir del Ultimo Máximo Glacial han generado nuevos espacios con
rocas y sedimentos expuestos, cuyo sustrato presenta condiciones especiales para que
ciertos organismos colonizadores se radiquen en éstos. Pero ¿cómo ha sido la evolución y
el alcance espacial de las áreas libres de hielo y sus frentes glaciares en éstas áreas?. Una
configuración de suelo desnudo potenciada por un conjunto propicio de factores abióticos y
ambientales concurrentes, generan condiciones potencialmente aptas para que algunas
especies se desarrollen, constituyendo en el tiempo, nichos ecológicos característicos.
Dentro de las especies vegetales colonizadoras que son capaces de enfrentar condiciones
ambientales extremas, se encuentran algunas tales como la Saniona uncinata, hoy con una
amplia distribución a lo largo de la región de las islas Shetland del Sur.. Pero, ¿cuál ha sido
su distribución en épocas pasadas?. Para resolver estas preguntas, se propone que la
descripción temporal de los límites de áreas libres de hielo, considerando la evidencia de
avances y retrocesos glaciares en la Antártica más una serie temporal y espacial de datos
paleoambientales, condicionará la potencial localización de nichos ecológicos, mediante el
uso de herramientas de modelamiento de nichos ecológicos.
Actualmente, las áreas libres de hielo corresponden a un 11% del total de la superficie del
archipiélago de las Shetland del Sur (Serrano & López-Martinez, 1998). Sin embargo, este
porcentaje ha sido variable en el tiempo, modulado en función de la ocurrencia de cambios
climáticos que han afectado los límites de las masas del hielo de Antártica. En el área de
estudio hay evidencia que da cuenta de la cronología en la evolución del relieve hasta su
configuración actual como medio periglacial (Serrano, 2003; Serrano & López-Martinez,
2004, Yoon et al., 2000; Hall, 2007), identificándose al menos 5 fases morfogenéticas
principales que se inician hace unos 17.000 años. Construir una base de datos de áreas
libres de hielo temporal espacialmente georeferenciada sobre una plataforma SIG (ArcGIS
9.3, gvSIG 1.11.0) es un objetivo que permitirá compilar y gestionar a una resolución
adecuada las capas de información necesarias para implementación de las herramientas de
modelamiento de nichos ecológico. Para este fin se utilizará el modelo de máxima entropía
MAXENT (Phillips et al., 2006, Elith et al., 2011), el cual ha sido para reconstruir la
distribución de plantas bajo un escenario del Último Máximo Glaciar (Premoli et al., 2010).
Las series de datos climáticas necesarias para compilar el experimento se obtendrán de la
literatura especializada y las series de datos utilizados en reconstrucciones y otros modelos
bio_climáticos. Por nombrar algunas fuentes de datos con las que se esta trabajando: Data
ϭϯϴ
Distribution Center, IPCC. Paleoclimate Modelling Intercomparison Project Phase II,
Global Climate Data. Con el objeto de validar los resultados se realizará una comparación
entre las posibles áreas nicho resultantes del modelo con aquella evidencia obtenida a
través de las herramientas moleculares que se ocupan en la especie S. uncinata.
Como resultado hasta el momento de esta investigación, se han copilado desde diferentes
fuentes, un número de 8 cambios estadiales e interestadiales en el archipiélago, durante los
últimos 15.000 años B.P. Consecuentemente, se ha iniciado el proceso de compilación de
los límites espaciales de cada una de ellas, describiendo las principales características de
cada una y localizando el limite del frente de hielo, así como, el de las áreas libres de hielo.
Asi, cada uno de estos periodos se transformará en un hito temporal sobre el cual se hará la
corrida del algoritmo de maxima entropía, para determinar la potencial distribución de S.
uncinata.
Este trabajo en progreso se realiza en el marco de la investigación para optar al grado de
Magíster en Ciencias Antárticas, mención en glaciología de la Universidad de Magallanes.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
Elith, J. Phillips, S. Hastie, T. Dudík, En Chee, Y. Yates, C. 2011. A statistical explanation of
MaxEnt for ecologists. Diversity and Distributions, (Diversity Distrib.) 2011. Vol. 17; 43-57.
http://onlinelibrary.wiley.com/doi/10.1111/j.1472-4642.2010.00725.x/pdf
Hall, B. 2007. “Late-Holocene advance of the Collins Ice Cap, King George Island, South Shetland
Islands.” The Holocene 17,8 (2007): 1253-1258.
Phillips, S. Dudik, M. Schapire, R. 2004 “A Maximum Entropy Approach to Species Distribution
Modeling.”. Proceedings of the Twenty-First International Conference on Machine Learning, 2004.
655-662.
http://www.cs.princeton.edu/~schapire/papers/maxent_icml.pdf
Phillips, S. Anderson, R. Schapire, R. 2005. Maximum entropy modeling of species geographic
distribution. Ecological Modelling Vol. 190 (2006); 231-259.
Premoli, A. Mathiasen, P. Kitzberger, T. 2010. “Southern-most Nothofagus trees enduring ice ages:
Genetic evidence and ecological niche retrodiction reveal high latitude (54°S) glacial refugia.”
Palaeogeography, Palaeoclimatology, Palaeoecology Vol. 298 (2010): 247–256.
Serrano, E. Lopez-Martinez, J. 1998. “Caracterización y distribución de las formas y los procesos
periglaciares en las Islas Shetland del Sur (ANTÁRTIDA)”. Procesos Bio-Físicos Actuales en
Medios Fríos. 181-204.
Serrano, E. 2003. “Paisajes naturales y pisos geoecológicos en las áreas libres de hielo de la
Antártida Marítima. (Islas Shetland del Sur).” Boletín de la A.G.E Vol. 35: 5-32.
Serrano, E, Lopez-Martinez, J. 2004 Morfogénesis periglaciar y deglaciación en las penínsulas
Barton y Weaver (islas Shetland del Sur, Antártida). Bol. R. Soc. Esp. Hist. Nat. (Sec. Geol.), 99 (14), 2004: 131-140.
Yoon, H. I., Park, B. K., Kim, I. & Kim, D. 2000. “Glaciomarine sedimentation and
itspalaeoceanographic implications along the fjord margins in the South Shetland Islands, Antarctica,
during the last 6000 years.” Palaeogeography, Plaeoclimatology, Palaeoecology, Vol. 157: 189-211.
ϭϯϵ
PLASTICIDAD FENOTÍPICA EN DOS POBLACIONES
ANTÁRTICAS DE COLOBANTHUS QUITENSIS
(CARYOPHYLLACEAE) BAJO UN ESCENARIO SIMULADO DE
CAMBIO GLOBAL
(Phenotipic plasticity in two antarctic populations of colobanthus
quitensis (caryophyllaceae) under a simulated global change scenario)
González-Silvestre L.A.1, Torres-Díaz, C.2, Carrasco-Urra, F.3, Gianoli E.3, 4, 5 & Molina- Montenegro M.A.1
1
2
Centro de Estudios Avanzados en Zonas Áridas (CEAZA), Facultad de Ciencias del Mar, Universidad Católica del Norte, Coquimbo,
Chile
Laboratorio de Genómica y Biodiversidad (LGB), Departamento de Ciencias Básicas, Facultad de Ciencias, Universidad del Bío-Bío,
Chile
3
Departamento de Botánica, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción, Chile
4
Departamento de Biología, Universidad de La Serena, Chile
5
Center for Advanced Studies in Ecology and Biodiversity (CASEB),P.Universidad Católica de Chile, Santiago, Chile
La Antártica se caracteriza por presentar condiciones ambientales adversas lo cual limita el
establecimiento de las plantas vasculares. Dentro de las características ambientales,
destacan las bajas temperaturas, corta estación de crecimiento y el estrés hídrico y
nutricional a los cuales están sometidas las plantas. La baja disponibilidad hídrica afecta de
manera negativa las respuestas fisiológicas y reproductivas de las plantas, disminuyendo el
éxito de establecimiento. Colobanthus quitensis (Kunth) Bartl. (Caryophyllaceae) es una de
las dos plantas vasculares nativas que habitan la Antártica Marítima y se ha demostrado que
su desempeño fisiológico y reclutamiento es afectado negativamente por el estrés hídrico
del suelo. La plasticidad fenotípica y la adaptación local serían dos de las posibles
estrategias que posee C. quitensis para lidiar con las adversas condiciones ambientales que
predominan en el continente antártico. Se ha documentado que bajo un escenario futuro de
cambio climático, la disponibilidad hídrica en la Antártica aumentaría entre un 30-40%
mejorando las condiciones para el establecimiento.
En el presente trabajo evaluamos la plasticidad morfo-fisiológica y el esfuerzo reproductivo
en individuos de C. quitensis provenientes de dos sitios con condiciones hídricas
contrastantes (“Arctowski”, baja disponibilidad hídrica y “Hannah”, alta disponibilidad
hídrica) mediante un experimento de jardín común realizado en cámaras de crecimiento,.
Para evaluar las diferentes respuestas, se simuló un escenario de cambio climático
(aumento en un 40% de la disponibilidad hídrica) y un escenario bajo la situación normal
(disponibilidad hídrica registrada en los sitios de origen). En general, los individuos de C.
quitensis de ambos sitios presentaron evidencia de plasticidad, aumentando su eficiencia
fotoquímica (Figura 1), largo y ancho foliar (Figura 2) y esfuerzo reproductivo bajo la
condición de aumento en la disponibilidad hídrica.
ϭϰϬ
EVIDENCIA DE RE-COLONIZACIÓN POST-GLACIAL DE
PENÍNSULA ANTÁRTICA POR Nacella (Patinigera) concinna
(STREBEL, 1908)
Evidence of post-glacial re-colonization of Antarctic Peninsula by
Nacella (Patinigera) concinna
González-Wevar, C. A. & Poulin, E.
1
Laboratorio de Ecología Molecular (LEM), Instituto de Ecología y Biodiversidad (IEB), Departamento de Ciencias Ecológicas, Facultad
de Ciencias, Universidad de Chile, Las Palmeras # 3425, Ñuñoa, Santiago, Chile.
El Océano Austral (OA) incluye las masas de agua al Sur del Frente Polar cuya área total
alcanza los 35 millones de km2, de los cuales un 60% se encuentra cubierto por hielo
durante el máximo de invierno. Desde la fragmentación de Gondwana a fines del Jurásico
la deriva de los continentes junto al extremo cambio climático ha tenido profundas
repercusiones sobre la distribución, composición y abundancia de su biota (Crame, 1999).
La apertura de los pasos de Tasmania (∼33.5 Ma) y de Drake (∼ 24 Ma) modelaron
circulación oceanográfica de la región al permitir la formación de la Corriente Circumpolar
Antártica (CCA) la que es delimitada por dos frentes, el Polar y el Subantártico (Orsi et al.,
1995). La posición de ambos frentes tiene marcadas implicancias para la ecología y la
biogeografía de la región ya que actúan como una barrera efectiva para el flujo genético de
algunas especies, mientras que para otras constituyen importantes vectores de transporte
hacía regiones lejanas.
El continente Antártico es uno de los ecosistemas más aislados del planeta debido a sus
distancia geográfica, su batimetría, la posición de la CCA, y sus condiciones climáticas
extremas (Crame, 1999). Las glaciaciones del Cuaternario han afectado a la fauna marina
bentónica somera de Antártica cuando los avances y retrocesos de las capas de hielo glacial
redujeron marcadamente los hábitats sobre la plataforma continental (Brey et al., 1996).
Tres hipótesis permiten explicar como la fauna marina bentónica habría sobrevivido los
ciclos glaciales: i) altos niveles de euribatía en algunos organismos sería una adaptación a
las oscilaciones de la extensión de hielo; 2) algunas especies podrían haber migrado durante
los máximos glaciales hacía zonas más templadas y menos impactadas por los hielos
glaciales, re-colonizando posteriormente altas latitudes durante los periodos inter-glaciales.
3) supervivencia de las especies in situ utilizando refugios glaciales.
El género Nacella (Patellogastropoda: Nacellidae) incluye al menos 15 especies nominales
distribuidas en distintas provincias del OA (Antártica, Kerguelén, Magallanes y Antípodas
al Sur de Nueva Zelanda; Powell, 1973). Sólo una especie (N. clypeater) expande su
distribución fuera del OA, en la Región Central de Chile siguiendo la corriente de
Humboldt. Reconstrucciones filogenéticas recientes basadas en marcadores mitocondriales
detectaron altos niveles de divergencia genética entre linajes de Nacella provenientes de
Antártica, Sudamérica y Kerguelén (González-Wevar et al., 2010). Análisis de tiempos de
divergencia entre dichos linajes sugieren que el origen y diversificación del género (∼14
Ma) sería más reciente que lo esperado bajo la hipótesis de vicarianza por tectónica de
placas (González-Wevar et al., 2010). Este periodo de tiempo se caracteriza por drásticos
cambios climáticos y oceanográficos en el OA como es la intensificación de CCA. La lapa
Antártica Nacella concinna es uno de los macro-invertebrados dominantes y conspicuos
distribuido en zonas libres de hielo de Península Antártica, Islas Antárticas aledañas e islas
ϭϰϭ
sub-Antárticas. A diferencia de otros invertebrados Antárticos, N. concinna posee un rango
batimétrico estrecho (0 – 150 m). Es un organismo dioico con fertilización externa y
liberación de larva de vida libre de duración entre 1 a 2 meses (Bowden et al., 2006).
Estudios moleculares utilizando AFLPs (Hoffman et al., 2010) y COI (González-Wevar et
al., 2011a) detectaron ausencia de estructura genética en poblaciones de la especie a lo
largo de Península Antártica Oeste. Paralelamente, N. concinna muestra bajos niveles de
diversidad genética en comparación a otras especies del género de la Provincia Magallánica
(de Aranzamendi et al., 2009; González-Wevar et al., 2011b). estos resultados podría
reflejar el profundo impacto que habría tenido sobre la especie el avance y retroceso de los
hielos glaciales en Península Antártica. Otra posibilidad incluye la contracción de su rango
de distribución durante el Último Máximo Glacial (UMG) hacía zonas libres de hielo en el
extremo norte de su distribución como Islas Georgias del Sur y Orcadas en el Arco de
Escocia.
Se examinó la historia evolutiva reciente de la lapa Antártica N. concinna a lo largo de su
distribución mediante reconstrucciones filogeográficos considerando el impacto de los
ciclos glaciales del Cuaternario. Para esto se contrastaron los niveles de diversidad genética
entre poblaciones de Península Antártica, Islas Antárticas (Shetlands del Sur y Georgias del
Sur en el Arco de Escocia). La información contenida en sus secuencias de DNA permitió
evaluar el efecto de los ciclos glaciales sobre la diversidad y estructura de la especie. Se
analizaron los patrones genéticos en la especie para establecer si ésta se mantuvo durante el
UMG utilizando refugio/s en Península Antártica o si la lapa Antártica re-colonizo esta
región desde zonas más temperadas al norte.
MATERIALES Y MÉTODOS
Se incluyeron en los análisis genético moleculares 232 ejemplares de N. concinna
provenientes de tres localidades en Península Antártica Oeste (Bahía Covadonga, Bahía
South, Rothera), tres islas Antárticas (Isla Rey Jorge, Isla Elefante e Isla Georgia del Sur), y
de Península Antártica Este (Isla Ross). Se prepararon DNA mediante el método de salting
out (Aljanabi & Martínez, 1997) a partir de tejido del manto y músculo pedal. Se amplifico
un fragmento de 662 pares de bases del gen mitocondrial Citocromo c oxidasa subunidad I
(COI) utilizando partidores específicos para la especie (González-Wevar et al., 2011a). Los
productos de amplificación fueron secuenciados en ambas direcciones y purificados. Las
secuencias fueron editadas con Proseq (Filatov, 2002) y alineadas con Clustal W
(Thompson et al., 1992). Se analizaron al menos 24 individuos por localidad y se
determinaron los niveles de polimorfismo en N. concinna utilizando índices de diversidad
standard como el número de haplotipos (k), número de sitios segregantes (S), diversidad
alélicas (H) para cada localidad con DnaSP 5.00.07 (Librado & Rozas, 2009). Se estimó el
número promedio de diferencias pareadas entre secuencias (Π) y la diversidad nucleotídica
(π) de acuerdo a Nei (1987). Se estimaron los niveles de diferenciación genéticopoblacional a través de las diferencias pareadas entre poblaciones (NST) y a través de las
frecuencias de los haplotipos (GST) en Arlequin v3.11 (Excoffier et al., 2005). Se
reconstruyo las relaciones genealógicas entre las poblaciones de N. concinna mediante
análisis de Network de Median Joining con el programa Network 4.5.1.0 (Röhl, 2002). Se
estimaron los tests de neutralidad de Tajima (D) y Fu (FS) para examinar los cambios
demográficos en la especie y evaluar la presunción de neutralidad selectiva del DNA
mitocondrial y el equilibrio mutación-deriva. Se construyo la distribución de desajuste
ϭϰϮ
(mismatch) de las secuencias de COI para compararla con lo esperado bajo Poisson en
poblaciones de tamaños constantes y variables (Slatkin & Hudson, 1991).
RESULTADOS
La lapa Antártica mostró bajos niveles de diversidad genética a lo largo del muestreo, sólo
20 (3.0%) sitios fueron variables. En la mayoría de las localidades analizadas se detectaron
bajos niveles de diversidad, a excepción de Isla Georgia del Sur que mostró índices
mayores. Los índices k, H y S fueron bajos pero comparables con otros estudios
moleculares en invertebrados marinos Antárticos. Las comparaciones pareadas de GST y
NST no mostraron diferencias significativas, a excepción de Isla Georgia del Sur que mostró
diferencias con las restantes localidades. Similarmente, Isla Ross, mostró diferencias
significativas con aquellas localidades más lejanas geográficamente (Rothera, Bahía South,
Fildes y Almirantasgo). Sin considerar Isla Georgia del Sur e Isla Ross, se detecto una
ausencia de estructura genética en N. concinna a lo largo de Península Antártica Oeste. La
red de haplotipos de Median Joining resulto en una típica genealogía en forma de estrella
con ramas muy cortas. Se registraron 20 haplotipos diferentes. El haplotipo central (H3) fue
el más frecuente (> 60%) y el más ampliamente distribuido en todas las localidades
analizadas. No obstante, dicho haplotipo no fue el más representativo en Isla Georgia del
Sur y en Isla Ross (Península Este). Más aún, en Georgia del Sur se detectaron dos
haplotipos de media frecuencia (H17 y H18) los cuales no son compartidos con otras zonas
Antárticas. Como se espera en Network en forma de estrella, las pruebas de neutralidad de
Tajima (D) y Fu (FS) fueron ambos significativos y negativos para el conjunto de datos lo
que indica que la especie debería haber experimentado una expansión demográfica reciente
bajo un modelo neutral. La distribución de diferencias pareadas entre secuencias tuvo
forma de L debido a que la mayoría de los individuos compartían el mismo haplotipo (H3).
Esta distribución no difiere significativamente de los esperado en el modelo de expansión
poblacional.
DISCUSIÓN
En base a los resultados obtenidos, Nacella concinna representa a lo largo de Península
Antártica Oeste una unidad genética homogénea con niveles muy bajos de diversidad
haplotípica y nucleotídica. En teoría, altos tamaños poblacionales, como los registrados en
N. concinna deberían mantener altos niveles de diversidad genética ya que la deriva génica
es baja y la tasa de acumulación de mutaciones debiera ser alta. La diversidad genética
detectada en la lapa Antártica habría sido generada por un pequeño número efectivo de
individuos lo cual es poco probable considerando las densidades registradas en la especie.
Más aún, la baja diversidad en N. concinna, sumado a la genealogía en forma de estrella y a
la distribución de desajuste con marcada forma de L sugieren la existencia de un evento de
expansión demográfica reciente en la especie. Por lo tanto, los bajos niveles de diversidad
genética detectadas en localidades de N. concinna de Península Antártica podrían ser el
reflejo del dramático efecto de los ciclos glaciales en los tamaños poblacionales de la
especie. Si se considera la estrecha distribución batimétrica de la especie, la extensión de la
capa de hielo sobre la mayor parte de la plataforma continental Antártica durante el UMG
habría reducido drásticamente sus hábitats hacía zonas libres de hielo.
La red de haplotipos sólo detecto 20 haplotipos en un total de 232 individuos analizados. El
haplotipo más común en la especie fue compartido por más de un 60% de los individuos y
distribuido en todas las localidades analizadas. La diversidad genética mitocondrial en N.
concinna no detectó estructura genética en la especie a lo largo de Península Antártica
ϭϰϯ
Oeste y en las Islas Antárticas Rey Jorge y Elefante. Sin embargo, la Isla Georgia del Sur
mostró diferencias significativas con todas las restantes localidades analizadas.
Similarmente, isla Ross (Península Antártica Este) mostró diferencias con localidades
geográficamente distantes del Oeste de la Península lo que indica que estaría operando un
cierto grado de aislamiento por distancia. La estructuración genética detectada entre Isla
Rey Georgia del Sur, además de los mayores niveles de diversidad genética observados en
dicha localidad sugieren que esta Isla del Arco de Escocia, que corresponde a la
distribución más al norte de la especie, podría constituir un refugio glacial para la lapa
Antártica durante los eventos glaciales del Cuaternario. De esta forma, N. concinna podría
haber sobrevivido el UMG en zonas más templadas, como en Isla Georgia del Sur en el
Arco de Escocia y posteriormente podría haber re-colonizado Península Antártica desde
dichos refugios.
AGRADECIMIENTOS
Proyecto de Gabinete INACH: G_04-11. Proyectos de tesis de doctorado INACH B_01_07
& CONICYT 24090009. Instituto de Ecología y Biodiversidad (IEB) ICM-P05-002 y PFB023-CONICYT, Census of Antarctic Marine Life.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
Aljanabi, S.M., Martinez, I. 1997. Universal and rapid salt-extraction of high quality genomic DNA
for PCR-based techniques. Nuc. Acids Res. 25, 4692-4693.
Bandelt, H-J., Forster, P., Röhl, A. 1999. Median-joining networks for inferring intraspecific
phylogenies. Mol. Biol. Evol. 16, 37-48.
Beu, A.G., Griffin, M., Maxwell, R.A. 1997. Opening of Drake Passage gateway and late Miocene to
Pleistocene cooling reflected in Southern Ocean molluscan dispersal: evidence from New Zealand
and Argentina. Tectonophysics. 281, 83-97.
Bowden, D.A., Clarke, A., Peck, L.S., Barnes, D.K.A. 2006. Antarctic sessile marine benthos:
colonization and growth on artificial substrata over three years. Mar. Ecol. Prog. Ser. 316, 1-16.
Brey, T., Dahm, C., Gorny, M, Klage, M., Stiller, M., Arntz, W.E. 1996. Do Antarctic marine
benthic invertebrates show an extended level of eurybathy? Antarc. Sci. 8, 3-6.
Crame, J.A. 1999. An evolutionary perspective on marine faunal connection between southernmost
South America and Antarctica. Sci. Mar. 63, 1-14.
de Aranzamendi, M.C., Gardenal, C., Martin, J.P., Bastidas, R. 2009. Limpets of the genus Nacella
(Patellogatropoda) from the Southwestern Atlantic: species identification based on molecular data. J.
Molluscan. Stud. 75, 241-251.
Excoffier, L., Laval, G., Schneider, S. 2005. Arlequin ver. 3.0: An integrated software package for
population genetics data analysis. Evolution Bioinformatics Online 1: 47–50.
Filatov, D.A. 2002. PROSEQ: A software for preparation and evolutionary analysis of DNA
sequence data sets. Mol. Ecol. Notes. 2, 621-624.
González-Wevar C.A., Nakano, T., Cañete, J.I., Poulin, E. 2010. Molecular phylogeny and historical
biogeography of Nacella (Patellogastropoda: Nacellidae) in the Southern Ocean. Mol. Phylogenet.
Evol. 56, 115-124.
González-Wevar C.A., David, B., Poulin, E. 2011a. Phylogeography and demographic inference in
Nacella (Patinigera) concinna (Strebel, 1908) in the western Antarctic Peninsula. Deep Sea Res. II.
58: 120-129.
González-Wevar, C.A., Nakano, T., Cañete, J.I., Poulin, E. 2011b. Concerted genetic, morphological
and ecological diversification in Nacella limpets in the Magellanic Province. Mol. Ecol. doi:
10.1111/j.1365-294X.2011.05065.x
Griffiths, H.J., Barnes, D.K.A., Linse, K. 2009. Towards a generalizad biogeography of the Southern
Ocean benthos. J Biogeogr. 36: 162-177.
ϭϰϰ
•
•
•
•
•
•
•
•
•
•
Hoffman, J.I., Peck, L.S., Hillyard, G., Zieritz, A., Clark, M.S. 2010. No evidence for genetic
differentiation between Antarctic limpet Nacella concinna morphotypes. Mar. Biol. 157:765–778.
Librado, P., Rozas, J. 2009. DnaSP v5: A software for comprehensive analysis of DNA
polymorphism data. Bioinformatics. 25, 1451-1452.
Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New York.
Orsi, A.H., Whitworth III T., Nowlin Jr., W.D. 1995. On the meridional extent and fronts of the
Antarctic Circumpolar Current. Deep Sea Res. I. 42, 641-673.
Picken, G.B. 1980. The distribution, growth, and reproduction of the Antarctic limpet Nacella
(Patinigera) concinna (Strebel, 1908). J. Exper. Mar. Biol. Ecol. 42, 71-85.
Powell, A.W.R. 1973. The Patellid limpets of the World (Patellidae), in: Abbot R.T (Ed.), IndoPacific-Mollusca. Vol. 3. The Department of Mollusks, Greenville, pp. 75-206.
Rogers, A.R., Harpending, H.C. 1992. Population growth makes waves in the distribution of
pairwise genetic differences. Mol. Biol. Evol. 9, 552-569.
Röhl, A. 2002. NETWORK, netw3111.exe downloaded from the web site:
www.fluxusengineering.com.
Slatkin, M. and Hudson, R.R. 1991. Pairwise comparisons of mitochondrial DNA sequences in
stable and exponentially growing populations. Genetics. 129, 555-562.
Thompson, J.D., Higgins, D.G., Gibson, T.J. 1992. Clustal W: Improving the sensitivity of
progressive multiple sequence alignment through sequence weighting, position specific gap
penalties, and weight matrix choice. Nuc. Acids Res. 22, 4673-4680.
ϭϰϱ
EXPRESIÓN DE METALOTIONEÍNA EN EL ERIZO
ANTÁRTICO (STERECHINUS NEUMAYERI) EN RESPUESTA A
PARÁMETROS DE ESTRÉS (METALLOTHIONEIN
EXPRESSION IN ANTARCTIC SEA URCHIN (STERECHINUS
NEUMAYERI) IN RESPONSE TO STRESS PARAMETERS)
Figueroa, T & González, M.
Laboratorio de Biorrecursos Antárticos, Instituto Antártico Chileno.
Este trabajo aborda por primera vez la expresión de metalotioneína en celomocitos del
erizo antártico Sterechinus neumayeri, estas células están relacionadas con el sistema
inmune, pero además tienen la capacidad de responder a lesiones, invasión de hospedadores
y agentes citotóxicos. Esto es muy relevante ya que existen pocas investigaciones que
registren los efectos de contaminación en invertebrados marinos adultos (e.g
Equinodermos) (Matranga, 2000), de esta manera podríamos utilizar a S. neumayeri como
un indicador biológico o a los celomocitos como indicadores de condición de estrés.
Las metalotioneínas son polipéptidos de bajo peso molecular, con un alto contenido en
cisteínas y sin la presencia de aminoácidos aromáticos ni histidina. El rasgo más destacable
de la secuencia aminoacídica de las MTs de mamífero es la gran proporción de cisteínas
(Cys), en concreto 20 por molécula. Estas cisteína se agrupan en secuencias del tipo Cys-XCys, Cys- Cys y Cys-X-Y- Cys, donde X e Y son aminoácidos diferentes de la cisteína.
En el presente trabajo se confirma la inducción de la MT por Cd, analizando su expresión
por PCR en tiempo real. Además se analiza la expresión de la MT en relación a la presencia
de bacterias y estrés térmico. A partir de la secuencia de aminoácidos de la proteína se
analizan las posibles adaptaciones moleculares de esta proteína a un ambiente de baja
temperatura.
MATERIAL Y MÉTODOS
1. Organismos e inducción de la expresión. Se recolectaron erizos antárticos (S.
neumayeri) desde la península Fildes (Isla Rey Jorge, Antártica). Los erizos se mantuvieron
en acuarios a 1 °C. Se realizaron tres tipos se experimentos: (1) Los erizos fueron
sometidos a una concentración de 100 l/L de cloruro de Cadmio. Se obtuvieron muestras
de celomocitos a 6, 12 y 24 horas. El grupo control se mantuvo a 0.5 ± 0.5 °C. (2) Se
injectó una mezcla de bacterias muertas por calor y se obtuvieron muestras a 24 y 48 h; (3)
finalmente se evaluó el efecto del estrés térmico sometiendo a los erizos a 5 y 10 °C
durante 1, 24 y 48 horas.
2. Extracción de ARN y obtención de ADNc. Se aisló ARN total de celomocitos
proveniente del líquido celómico por medio del método de TRIZOL (Invitrogen). Se
sintetizó el ADNc a partir de 1g de ARN siguiendo el protocolo de la transcriptasa
reversa de Invitrogen. Las reacciones fueron incubadas durante 5 minutos a 65°C, seguido
de 55 minutos a 37°C y calentamiento a 72°C durante 15 minutos.
3. Amplificación de MT en celomocitos. A partir de partidores específicos (Fw:
CACCATGCCTGATGTCAAGT; Rv: TGTCTGGCTTGGAGCATGTTG) que amplifican
todo el marco de lectura de la proteína se evaluó la expresión de MT en los celomocitos a
ϭϰϲ
diferentes tiempos. La expresión de MT fue normalizada con respecto a los genes control
18S/28S y actina de S.neumayeri.
RESULTADOS Y DISCUSIÓN
La secuencia de MT de S. neumayeri presenta diferencias significativas respecto de otras
metalotioneínas a nivel de la presencia y proporción de ciertos aminoácidos generando un
valor de índice alifático (16,88) y de hidrofobicidad (GRAVY) (-0,17) menor al de otras
especies de equinodermos de agua templada y similar para especies polares.
Aunque la secuencia de MT presente en S. neumayeri fue reportada por Scudiero et al.
(1997) en ovocitos, en este trabajo no se analizó la expresión del gen frente a la presencia
de metales pesados. La MT es inductible a las 6 horas después de expuesto los erizos a
concentraciones de 100 g/L (Fig. 1), generando una respuesta clásica para este tipo de
proteínas que unen metales pesados.
6
Expresión relativa
5
4
Control
6 horas
3
12 horas
24 horas
2
1
0
Figura 1. Cinética de expresión de MT por qPCR durante la inducción con Cloruro de
Cadmio.
Por otra parte, la injección con bacterias produce también una inducción de la MT después
de 24 horas (Fig. 2), esta expresión se puede explicar por la inducción de la fagocitosis en
los celomocitos o por el reconocimiento de las bacterias por parte de estos que producen
especies reactivas de oxígeno y que en el caso de la MT pueden ser neutralizados por esta.
Por el contrario, el aumento de la temperatura produce en un principio una depresión de la
expresión del gen para luego aumentar y volver a niveles normales respecto de los animales
control. El aumento rápido de la temperatura puede afectar la trascripción y quizás pueda
dañar el ARNm (Boutet et al, 2009).
9
Figura 2. Análisis de la expresión
8
por qPCR de la MT después de la
injección con bacterias muertas por
calor.
Las barras en blanco
representan el grupo control,
mientras que las barras en negro al
grupo experimental.
Expresión relativa
7
6
5
4
3
2
1
0
24 h
48 h
ϭϰϳ
REFERENCIA BILBIOGRÁFICA
•
•
•
Boutet I, Tanguy A, Le Guen D, Piccino P, Hourdez S, Legendre P, Jollivet D. 2009. Global
depression in gene expression as a response to rapid thermal changes in vent mussels. Proc Biol Sci.
7, 276 :3071-9.
Matranga, V., G. Toia, R. Bonaventura, W. Müller. 2000. Cellular and biochemical responses to
environmental and experimentally induced stress in sea urchin coelomocytes. Cell Stress &
Chaperones; 5:158–65.
Scudiero, R, Capasso, C., Carginale, V., Riggio, M., Capasso, A., Ciaramella, M., Filosa S. and
Parisi, E. 1997. PCR amplification and cloning of metallothionein complementary DNAs in
temperate and Antarctic sea urchin characterized by a large difference in egg metallothionein
content. Cell. mol. life sci. 53: 472–477.
ϭϰϴ
MUSGOS AL LÍMITE: DESCUBRIENDO LA HISTORIA DE
VIDA DE SANIONIA UNCINATA EN ANTÁRTICA
(Moss to the limit: discovering the live history of Sanionia uncinata in
Antarctica)
Galleguillos, C.1 , Alarcón, V.1, Hebel, I.1 & Dacasa, M.C.2
2
1
Universidad de Magallanes (Umag), Chile
Albert-Ludwig Universität Freiburg, Germany.
All species have their limits in the distribution, and margins show which is the limit of the
adaptation to the abiotic conditions (temperature, precipitation, etc.), but also show the
competition with other species. The margins are of particular interest because they
represent limits of survival that can be altered with climate change. The plants are ideal for
the study of the periphery because the static nature which allows his mapping and
relationship can be established among the historic periods of glaciation.
Many disciplines can provide part of the explanation of how these limits occur and the
recognition of margins and the reasons for their existence are interconnected processes. But
what is recognized as a margin depends primarily on the object which is observed and the
limits may be discernible only when examining the species or populations in detail
regarding their morphology, demography or genetics.
This leads to question like: Why do these plants grow, why there are not more species, and
which are their strategies for survival under these conditions?
The most extensive vegetation coverage in Antarctica consists of patches of mosses and
lichens. Mosses play an important ecological role: they contribute to the soil development
accumulating organic matter and releasing organic exudates, colonize ice-free terrain and
provide fauna with food and habitat resources. One of the most widespread moss species of
this tundra is Sanionia uncinata, occurring on peri-Antarctic islands and archipelagoes as
well as in the Antarctic Peninsula. Wet habitats with impeded drainage in the maritime
Antarctic are typically dominated by four carpet-forming pleurocarpous species (Sanionia
georgicouncinata, S.uncinata, Warnstrofia fontinaliopsis, W. sarmentosa) (Ochyra, et al
2008).
Germination and subsequent development and survival are possible by those species
genetically and physiologically pre-adapted to tolerate relatively unstable conditions, severe
dehydration and stress, in particular, minimum nutrient concentrations. So, the success at
this extreme environment is not given only by the resistance or tolerance to the extreme
conditions where they live, but the multiple dispersion methods they have in order to
colonize surfaces free of ice.
Several methods of colonization of new surfaces may exist. The dispersion and
establishment from local sources in Antarctica is largely doing by vegetative gametophytes.
There are numerous modes of vegetative reproduction. Otherwise few species of Antarctic
bryophytes produce sporophytes (Webb, 1973), moreover, for Sanionia the sporophyte
state is described as very rare (Lewis Smith 1984).
With this observation, perhaps the greatest input to the gene pool of the bryophyte
population is derived from exotic spores. This hypothesis is also supported by many authors
like van Zanten (1978), Marshall (1996), Hebel (1999) and these spores will probably have
descended into new areas perpetually over millions of years (Lewis Smith 1984).
ϭϰϵ
In Antarctica, propagules (spores or gametophytes) will be blown or washed to new
habitats developing rhizoids, if the edaphic conditions, moisture, stability of the substrate
and microclimate remain adequate. This allows the establishment into small colonies,
which with other species, may gradually develop a distinctive community characteristic of
the environmental features of the habitat (Smith, 1972).
Some authors discussed the viability of the spores under different environmental conditions
and showed that of many moss species spores are capable of remaining viable after many
years of desiccated storage with or without subsequent wet or dry freezing Van Zanten
(1978). Otherwise, a different drought resistant exists if the brypophytes belongs to
different species.
Thus, it is conceivable that the rain of spores on the Antarctic region creates a bank of
propagules on the soil and, probably, over the ice of glaciers draining into the crevices,
some of which remain viable for many years. If they have success to be redistributed to the
ice free niches where the temperature and humidity are favorable, may be able to
germinate.
Significant migration and survival is expected to occur in response to climate change and
that change habitats for their cause. Thus, progress in molecular techniques in recent
decades has contributed to explain changes in species distribution and movement or
retention of them in cold areas. Ultimately, advances in research occurring in the area of
molecular genetics have given rise to a new approach in charge of the dynamic interactions
between species, their habitat and in particular on its margins.
With this background and considering the little knowledge of the history of the Antarctic
moss the aim of our work is to determine the provenance and migration routes of the moss
Saniona uncinata in populations from the South Shetland Islands, Antarctic Peninsula and
Tierra del Fuego, using heterologous nuclear and chloroplast microsatellites as molecular
markers.
This approach should contribute to evaluate the origin of new migrants over moraines and
ice free areas, contribute to the knowledge on the dispersion of the genes to long distances,
looking for refuges and comparison of moss populations in and between specific localities
of the Antarctic Peninsula and southern South America.
During the Chilean Antarctic Scientific expedition in January 2010 and 2011, organized by
the Chilean Antarctic Institute (INACH), we collected moss samples of Sanionia uncinata
(Hedw.) Loeske from 21 different localities in the South Shetland Islands, James Ross
Island and Tierra del Fuego.
The samples were taken according to Bijlsma et al (2000), Van der Velde & Bijlsma (2000)
and Skotnicki et al (1999) protocols. The individuals were taken from moss pads clearly
separated at least 0.5-2 m, where only a small group of stems (2-3) represent the sample,
like a minimum unit of neighboring stems. The sampling was carried out in zones near
channels, according to the topography, type of soil, availability of nutrients, neighborhood
to glacier boundaries, moraines, roads and stations. Given the predominant vegetative
reproduction and the poor presence of sexual organs of S. unicinata in Antarctica, to
recognize in our samples the presence of Sanionia georgico-uncinata and other moss
species a morpho-statistical characterization of the gametophyt is being analyzed,
registering several leaf and stem traits, following Ochyra’s work.
DNA extraction was done with the modified CTAB method protocol (Doyle & Doyle,
1987). Two heterologous nuclear microsatellites was used to analyze the samples according
ϭϱϬ
to Clarke et al. (2009) and Van der Velde (2001) and two universal cp-microsatellites was
used according to Weising, K. and Gardner, R. (1999)
An agarose gel 2% with ethidium bromide stained was used to reveal the bands.
Due the occasionally sexual organs of the studied species observed in Antarctica a strong
clonality is expected. Until now, all microsatellite loci were low polymorphic among the
localities displaying a narrow size range of PCR products, but it is necessary to analyze the
whole number of samples in the case of the nuclear microsatellites to have a better
approach. As expected, the chloroplast microsatellite loci presented low levels of
polymorphism with 2 or 3 distinct size variants. The number of haplotypes will be obtained
combining these variants to determine the migration routes and to recognize ancestral
refugies.
Isolation could be observed in the case of one locality of King George Island, showing
limited gene dispersal to the other localities, so that distant populations in a series or remote
areas within a population become genetically differentiated.
Due to the low polymorphism of the microsatellites, the level of inter- and intra-population
genetic diversity must be analyzed by using a powerful DNA fingerprinting technology
applicable to any organism without the need of specific marker for the studied specie.
ACKNOWLEDGMENTS
INACH for funding this project and Carla Gimpel for lab support.
REFERENCES
•
•
•
•
•
•
•
•
•
•
Clarke, L., Ayre, D. & Robinson, S. 2009. Genetic Structure of East Antarctic populations of the
moss Ceratodon purpureus. Antarctic Science, 21: 51-58.
Doyle, J. J. & Doyle, J.L.1987. A rapid DNA isolation procedure for small quantities of fresh leaf
tissue. Phytochemical Bulletin, 19: 11-15.
Hebel, I. y G. Rojas. 1999. Estudio preliminar del contenido aerobiológico de la atmósfera de la
Península Antártica y su relación con el ecosistema. In: Reunión Chilena de Investigación
Antártica, Santiago, 12-13 Agosto 1999. Instituto Antártico Chileno, Chile. Serie Científica INACH
1999 Nº 49: 141.
Lewis-Smith, R. 1984. Terrestrial plant biology of the Subantarctic and Antarctic. In: Laws, R.M.
(ed) Antarctic Ecology, 1: 61-162
Marshall, W. 1996. Biological particles over Antarctica. Nature 383: 680.
Ochyra, R., Lewis, R. & Bednarek-Ochira H. 2008. THE ILUSTRADTED MOSS FLORA OF
ANTARCTICA. University Cambridge Press, 685p.
Van Der Velde, M., Van De Zande, L. & Bijlsma, R. 2001. Genetic structure of Polytrichum
formosum in relation to the breeding system as revealed by microsatellites. Journal of Evolutionary
Biology, 14 (2): 288-295.
Van Zanten, B. 1978. Experimental studies on trans-oceanic long range dispersal of moss spores in
the Southern Hemisphere. Journal of Hattori Botanical Laboratory, 44: 455-482.
Webb, R. 1973. Reproductive behavior of mosses on Signy Island, South Orkey Island. Brit.Antar.
Survey Bull., 36: 61-77.
Weising, K. y Gardner, R. 1999. A set of conserved PCR primer for the analysis of simple sequence
repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms. Genome, 42: 9-19.
ϭϱϭ
LA RUTA DE LA EDAD DEL HIELO EN MAGALLANES
Magallanes’ ice age trail
Jaña, R. 1,2, Durbahn, M.3 & Nuñez, P.4
1
Instituto Antártico Chileno
2
Fundación CEQUA
3
Universidad de Chile
4
Universidad Libertador Bernardo O’Higgins
En la Región de Magallanes y Antártica Chilena se encuentran un gran número de
evidencias en el paisaje que dan cuenta de los cambios ambientales producidos por la
acción de las últimas glaciaciones. Estos elementos son de gran valor para el conocimiento
científico, debido a que proporcionan registros útiles para correlacionar eventos climáticos
del pasado; permitiendo estudiar la cronología del fenómeno de la variación climática que
se ha manifestado por el avance y retroceso de los hielos en diferentes épocas. Desde
principios del siglo XX hasta el presente, en el sector sudamericano de la Región de
Magallanes, se ha realizado una importante serie de estudios científicos los cuales
describen una cronología de eventos y procesos geomorfológicos glaciales que conforman
un valioso antecedente para entender las variaciones climáticas en la región. Por otra parte,
estos estudios identifican generalmente elementos geográficos o geoformas, las cuales se
asocian a los procesos que se describen, siendo susceptibles de una localización espacial.
Esta iniciativa científica ha desarrollado la oportunidad que representa para fines de uso
científico y turístico, la recopilación de los antecedentes sobre geoformas vinculadas a las
glaciaciones y a los procesos geomorfológicos asociados, sobre la base de la información
científica existente. Una subsiguiente selección de un número definido de éstos elementos,
en base a su valor estético obtenido de la observación en terreno; y el posterior diseño de un
mapa temático que localiza y describe éstos elementos, ha permitido crear una base inicial
de elementos relevantes. A objeto de permitir la representación de los elementos en línea se
ha creado una plataforma web que facilita la consulta e integración interactiva por parte de
usuarios remotos.
Consecuentemente, esta plataforma de conocimiento, permitirá articular otros objetivos que
se pueden orientar a la formación de capital humano, a la creación de productos orientados
al desarrollo del turismo científico y de intereses especiales, y a la promoción de los valores
naturales sobresalientes de la Región de Magallanes.
Consecuentemente, se postula que la relevancia de este estudio se asocia al hecho de que
proporciona una base de antecedentes necesarios para el desarrollo de las actividades
científicas de la Fundación CEQUA y que adicionalmente, permite contribuir con los
lineamientos de la Agenda de Desarrollo Regional. Adicionalmente, para el CEQUA, este
estudio es relevante pues constituye una aplicación integrada de las líneas de investigación
que el Centro ejecuta, estimándose que el producto contribuirá a la sustentabilidad del
desarrollo productivo de la Región.
Se agradece el financiamiento proporcionado por el Fondo de Innovación para la
Competitividad Regional (FIC-R).
ϭϱϮ
Mapa prototipo con la ubicación de los puntos de interés que contienen rasgos relevantes
que ejemplifican los procesos geomorfológicos acaecidos por la dinámica glacial.
Página de entrada al sitio web del proyecto La Ruta de la Edad del Hielo en Magallanes.
http://www.hielo-magallanes.cl/reh
REFERENCIAS BIBLIOGRÁFICAS
Disponibles en sitio web.
ϭϱϯ
PALEOBIOGEOGRAFÍA DE PATAGONIA AUSTRAL Y
ANTÁRTICA: ESTUDIO DEL CRETÁCICO SUPERIOR
(Palaeobiogeography of upper Cretaceous from southest Patagonia and
Antarctica)
Jujihara, A. 1, Leppe, M. 2, Mihoc, M. 3, Mansilla, H. 2, Cisterna, N. 3, Varela, N. 4 & Bierma4
2
1
Universidad de Magallanes, Chile
Laboratorio de Paleobiología, Instituto Antártico Chileno, Plaza Muñoz Gamero 1055, Punta Arenas, Chile
3
Departamento de Botánica, Universidad de Concepción, Chile
4
Departamento Ciencias de La Tierra, Universidad de Concepción, Chile
El registro paleontológico nos indica que existió un vínculo entre las biotas terrestres del
sector occidental de Sudamérica austral con Península Antártica durante el Cretácico
superior hasta el Eoceno inferior. La unión de estas masas continentales debió provocar una
discontinuidad entre las aguas del Proto-Weddell y el mar de Tetis, suceso que se
transformó en un evento vicariante para las poblaciones de organismos marinos que
habitaban sus aguas, pero un evento que, además, permitió la dispersión de organismos
terrestres a través de ambos continentes
Así, basados en los antecedentes paleogeográficos, el presente estudio busca comprender
las consecuencias que pudieron tener estos cambios geográficos en los patrones de
evolución de la flora y fauna austral del Cretácico superior, y el importante rol en la
dispersión biótica y migración de organismos entre Sudamérica y Antártica durante este
intervalo, que explicarían, en gran medida la distribución de organismos, antes que fueran
intervenidos por las dinámicas glaciales del Neógeno.
MATERIALES Y MÉTODOS
La evolución tectónica de la Península Antártica y la Patagonia durante el Cretácico causó
una serie de eventos de separación y reunión continental que pudieron modificar el flujo
génico de la biota existente en estos continentes. Para comprender mejor este lapso, se
elaborará una matriz de presencia-ausencia de organismos fósiles presentes en los
afloramientos fosilíferos de ambos continentes, basada en la revisión de bibliografía
relacionada con afloramientos de flora y fauna del Cretácico superior en la Patagonia y el
Continente Antártico, además del trabajo de análisis e identificación taxonómica en el
laboratorio y extracción de nuevo material fósil obtenido en el trabajo de campo. Las
localidades antárticas a estudiar son Isla Snow Hill, Isla James Ross, Isla Seymour
(Marambio), Bahía Skua, Half Three Point, Price Point y Zamek Hill pertenecientes a isla
Rey Jorge. Las localidades patagónicas serán Punta Rocallosa (Isla Riesco), Cerro Guido,
Cerro Las Chinas, Cerro Dorotea, Cerro Cazador, La Irene. Doce de las localidades son
conocidas y una es un nuevo afloramiento, todas del Campaniano y Maastrichtiano.
Determinación de la existencia de un evento vicariante en el Cretácico superior,
utilizando herramientas panbiogeográficas
La Panbiogeografía como la Biogeografía Cladística suponen la existencia de una
correlación estrecha entre la historia de la vida y la historia de la Tierra (Espinosa et al.,
2002). Para el análisis biogeográfico de la flora y la fauna se utilizaron dos métodos
biogeográficos:
ϭϱϰ
El análisis de PAE, con base en datos de la matriz generada para todas las localidades del
Cretácico superior con los taxa pertenecientes a sur de América del Sur, Península
Antártica y las Islas Shetland del Sur.
Para este análisis, se utilizó las matrices de distribución de las especies de fauna de
invertebrados marinos, flora terrestre. Siguiendo a Morrone (2004), en este análisis las
matrices resultantes de áreas x especies, fueron codificadas como presencia (1) o ausencia
(0) de cada especie en las distintas cuadrículas. Este método agrupa áreas o localidades,
optimizando la concordancia entre los patrones de distribución de muchos taxones
diferentes, utilizando para ello los taxones compartidos entre áreas de acuerdo con la
solución más parsimoniosa (Morrone 1994, Posadas 1996).
Las matrices de áreas x especies fueron analizadas con los programas NONA 2.0 (Goloboff
1993) y WinClada (Nixon 1999). La estrategia de búsqueda de los cladogramas más
parsimoniosos se realizó mediante búsquedas heurísticas con permutación de ramas tipo
TBR y reconexión múltiple (Múltiple TBR + TBR), permitiéndole al programa retener un
máximo de 10.000 árboles, con 100 réplicas de secuencia de adición al azar y 100 árboles
iniciales en cada repetición (árboles de Wagner). Se consideró solo aquellos caracteres
informativos.
La búsqueda de áreas de endemismo fue realizada siguiendo el análisis de endemicidad
(AE) propuesto por Szumik et al. (2002) y Szumik & Goloboff (2004), implementado en
los programas NDM/VNDM (Goloboff 2005). El procedimiento desarrollado en
NDM/VNDM para la identificación de áreas de endemismo consiste, básicamente, en
evaluar la congruencia del rango de distribución de las especies a un área predefinida
(conjunto de celdas). El ajuste de las especies al área es medido cuantitativamente a través
de un índice de endemicidad (IEe) cuyos valores varían entre 0 y 1; donde IEe = 1
representa una especie cuyo rango de distribución es perfectamente congruente con el área
evaluada (“endemismo perfecto”). Durante el cálculo del IEe se consideran registros de
ocurrencia observados (obtenidos a partir de información empírica concreta, e.g., datos
provenientes de colecciones museológicas, bibliografía, etc.) así como registros
potenciales, calculados según funciones de “llenado” implementadas en NDM/VNDM –o
designados manualmente por el usuario–. Los registros potenciales pueden clasificarse
según el modo en que son modelados en: (a) registros inferidos, calculados de manera
automática por NDM/ VNDM según un criterio de proximidad y homogeneidad
implementado en el programa.
Se realizo un análisis de endemicidad de especies: los datos de distribución se consideraron
de forma independiente, utilizando los datos de macro y microflora, junto con los datos
correspondientes a la fauna de invertebrados marinos encontrados en las localidades
antárticas y patagónicas anteriormente mencionadas, todas las especies consideradas poseen
una edad que se encuentra en un rango de 83,5 a 65,5 millones de años atrás (CampanianoMaastrichtiano).
RESULTADOS
Análisis de parsimonia de endemismo. En el análisis considerando la matriz de
presencia/ausencia de fauna de invertebrados marinos Campaniano-Maastrichtianos de las
localidades patagónicas y antárticas se obtuvo 1 cladograma de máxima parsimonia, cuyos
estadísticos son: largo (L): 145, índice de consistencia (IC): 64, índice de retención (IR): 62
(Fig. 1). El análisis a esta escala produjo un cladograma resuelto, sin la presencia de
ϭϱϱ
politomias y con muchas especies exclusivas (sinapomorfias) que sustentan las
agrupaciones. El cladograma de consenso estricto, no presento nodos colapsados.
La topología del árbol muestra dos clados principales, el clado I constituido por las áreas de
Cerro Dorotea y Cerro Cazador. El clado II por Punta Rocallosa, Cerro Guido, Isla Snow
Hill, Isla Seymour e Isla James Ross. Las áreas de Cerro Dorotea y Cerro Cazador se ven
enlazadas en el clado I solo por una sinaporfía, constituida por la presencia de Hoploparia
antarctica Wilckens. El clado II incluye las áreas de Punta Rocallosa y Cerro Guido con
las localidades de Isla Snow Hill, Isla Seymour, Isla James Ross pertenecientes a la Cuenca
de James Ross, soportado por las sinapomorfias que corresponden a las especies:
Gunnarites bhavaniformis, Gunnarites kalika Stolickzka y Gunnarites sp.
A partir del análisis de parsimonia de endemismos considerando solo los taxa vegetales, se
encontró solo un árbol más parsimonioso de las localidades antárticas y patagónicas, cuyos
estadísticos son: largo (L): 292, índice de consistencia (IC): 51, índice de retención (IR):
54.
La topología del árbol muestra dos clados principales, Clado I formado por las áreas de
Bahía Skua, Zamek Hill, Half Three Point y Price Point. El clado II formado por las áreas
Cerro Dorotea, Cerro Guido, Cerro Cazador, Las Chinas, La Irene, Isla Snow Hill, Isla
Seymour e Isla James Ross.Tanto el clado I como el II, muestran un patrón anidado en
relación a la distribución de las sinapomorfias, en donde, la inclusión de la isla Snow Hill al
primer clado se encuentra soportado por las especies: Microcachrydites antarcticus
Cookson, Peninsulapollis gillii Cookson y géneros Retitriletes sp., Peninsulapollis sp.,
Psilatricolporites sp.
DISCUSIÓN Y CONCLUSIONES
Las localidades del Cretácico superior de la Península Antártica y Sudamérica Austral
presentan una gran afinidad, apoyada por la distribución de fauna marina en su mayoría por
cefalópodos amonoideos, los otros taxa sirven como evidencia, sin embargo, no presentan
mucha congruencia de especies entre ambas áreas. La familia Kossmaticeratidae es la que
presenta una distribución más amplia y con mayor congruencia de especies en ambos
continentes, esto se ve representado por 5 especies pertenecientes a los géneros
Grossouvrites Kilian y Reboul, Gunnarites Kilian y Reboul y Maorites Marshall.
Los resultados indican una estrecha relación entre las localidades patagónicas y las
localidades pertenecientes a la Cuenca de James Ross localizada al lado oriental de la
Península Antártica.
Este trabajo es producto de una tesis en desarrollo del proyecto Fondecyt 11080223
“Palaeophytogeographical and evolutionary relationships between southern Patagonia and
Antarctic Peninsula floras during the Cretaceous” y ha recibido apoyo del proyecto de
cooperación internacional Chile-Alemania BMBF CHL10/A09.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
Espinosa, D., Morrone,J., Llorente, J. y Flores, O. 2002. Introducción al análisis de patrones en
biogeografía histórica. Las Prensas de Ciencias, Facultad de Ciencias, UNAM, D.F. México. 132 pp.
Goloboff, P. 1993. NONA (NO NAME) ver. 2.0. Publisher by the autor, Tucumán.
Goloboff, P. 2005. NDM/VNDM ver. 2.5. Programs for identification of areas of endemism.
Programs and documentation available at www.zmuc.dk/public/phylogeny/endemism.
Morrone, J.J. 1994. On the identificación of areas of endemism. Syst. Biol., 43: 438-441.
Morrone, J.J. 2004. Panbiogeografía, componentes bióticos y zonas de transición. Revista Brasileira
de Entomologia 48: 149-192.
ϭϱϲ
•
•
•
•
•
•
Morrone, JJ & J Márquez (2001) Halffter’s Mexican Transition Zone, beetle generalised
tracks, and geographical homology. Journal of Biogeography 28: 635-650.
Nixon, K.C. 1999. Winclada (BETA) ver. 0.9.9. Publisher by the author, Ithaca.
Posadas, P (1996) Distributional patterns of vascular plants in Tierra del Fuego: a study applying
parsimony analysis of endemicity (PAE). Biogeographica 72: 161-177.
Szumik C., F. Cuezzo, P. Goloboff & A. Chalup. 2002. An optimality criterion to
determine areas of endemism. Syst. Biol. 51: 806-816.
Szumik, C., y Goloboff , P. 2004. Areas of endemism: an improved optimality criterion. Systematic
Biology 53: 968-977.
ϭϱϳ
RESPUESTAS ANTIOXIDANTES DE DESCHAMPSIA
ANTARCTICA DESV. CULTIVADA IN VITRO SOMETIDA A
EXCESO DE NaCl
(Antioxidant responses of Deschampsia antarctica Desv. cultivated in
vitro to NaCl)
Köhler H.W., Pizarro M., Contreras R. A., Barrientos H. & Zúñiga G. E.
Laboratorio de Biotecnología y Fisiología Vegetal Universidad de Santiago de Chile – USACH.
The salinity, water deficit and extreme temperatures are ambient factors that affect naturals
ecosystems and agricultural soils. These conditions are a potentially cause of delay in
growth and development of a plant (Chen and Murata, 2002). The salinity corresponds to a
soil condition due to a high concentration of soluble salts, like sodium chloride, which is
the most abundant soluble salt in soils around the world (Munns and Tester, 2008). Sodium
chloride has two effects on plants, one related with osmotic parameter and the other related
with toxic parameters. In both cases, NaCl alters the cellular homeostasis and induces de
production of oxygen reactive species (ROS) (Zhu, 2001). In a condition of high salinity
exists a dynamic expression of the genome, which could be observed in the expression of
diverse proteins, the activity of some enzymes and in the changes of the metabolites profile
(Parida and Das, 2005). In fact, salinity induces the production of stress proteins or
antioxidant enzymes to minimize damage caused by ROS (Jebara et al, 2005).
D. antarctica Desv. (poaceae) is an antartic hairgrass that has colonized the western shore
of the Antarctic Peninsula and adjacent islands (Parnikoza et al, 2007; van de Weuw et al,
2007). In some places D. antarctica is exposed to high salinity soil concentrations hence it
is a good model to study their responses to salt stress. We have developed an in vitro
culture system that allows us to study the biochemical and molecular responses to different
conditions. In this work we evaluate the responses of in vitro plants of D. antarctica to
NaCl.
D. antárctica in vitro culture plants were exposed to 0, 100, 200 and 300 mM NaCl during
12 months using the MS medium. After this time, the shoots did not present membrane
damage associated to malondialdehyde (MDA) levels (Ederli et al, 2004). The total reactive
oxygen species (ROS) were measure according Ross et al (2008) and showed an increase
only at 300 mM NaCl.
Figure 1. Total ROS and MDA content in platns of D. antarctica cultured in vitro.
ϭϱϴ
Then we measured the antioxidant response of D. antarctica to NaCl. For the analysis of
the non-enzymatic response, active compounds extraction from shoots was made using
85% v/v of hydroethanolic solvent. The antioxidant activity was assayed by two
complementary methods: the DPPH free radical-scavenging assay (Naik et al, 2005) and
the Ferric reducing/antioxidant power (FRAP) assay (Benzie and Strain, 1996). The total
phenol content of the extracts was measured by the Folin-Ciocalteu method and the partial
phenolic composition and obtention of a metabolite profile were performed through HPLCDAD. A decrease in the total phenolic content, FRAP value and consumption of DPPH by
increasing the concentration of NaCl. There are changes in the metabolic profile by
submitting D. antarctica at different NaCl treatments, decreasing metabolite levels at 300
mM NaCl.
12
Total Phenolics
-1
(GAE mg * g FW)
10
8
6
4
2
0
0
100
200
300
NaCl concentration (mM)
Figure 2. Total phenol content in platns of D. antarctica cultured in vitro.
Figure 3. DPPH consumed and FRAP value in platns of D. antarctica cultured in vitro.
Figure 4. Metabolite changes measured by HPLC-DAD in platns of D. antarctica cultured in vitro.
ϭϱϵ
Moreover, the enzymatic activities of superoxide dismutase (SOD) (Beyer and Fridovich,
1987), ascorbate peroxidase (APX) (Chen y Asada 1989), guaiacol peroxidase (GPX)
(Curtis (1971) and catalase (CAT) (Patterson et al, 1984) were measured. Changes in the
proteome profile of D. antarctica were analyzed by two dimensional electrophoresis (2DE) according to Wang et al, 2003 and Carette et al, 2007. The enzymatic mechanisms
increase their activity at higher salt treatments. Also, the analysis of the changes in
proteome profiles showed that are 47 differences and only the 28% of proteins that
presented changes are stress related proteins.
Figure 5. Enzymatic antioxidant measures in plants of D. antarctica cultured in vitro.
Figure 6. Result of the analysis of 2-DE between the 0, 100, 200, 300 NaCl treatments in platns of D.
antarctica cultured in vitro.
ϭϲϬ
The results suggest that shoots of D. antarctica in vitro exposed to NaCl shows a balance
between the enzymatic and the non enzimatic protection mechanisms, that it allows to
tolerate NaCl (200 mM).
ACKNOWLEDGEMENTS
We thank USACH, MECESUP and INACH for support for this work.
REFERENCES
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Benzie I.F.F. and Strain J.J. (1999) Ferric Reducing / Antioxidant Power assay : Direct measure of
total antioxidant activity of biological fluids and modified version for simultaneous measurement of
total antioxidant power and ascorbic acid concentration. Methods in enzymology 299: 15-27.
Beyer W.F. and Fridovitch I. (1987) Assaying for superoxide dismutase activity: some large
consequences of minor changes in conditions. Analytical Biochemistry 161: 559–566.
Carrette O., Burkhard P.R., Sanchez J. and Hochstrasser D.F. (2006) State-of-the-art twodimensional gel electrophoresis: a key tool of proteomics research. Nature Protocols 1: 812-823.
Chen G.X. and Asada K. (1989) Ascorbate peroxidase in tea leaves: occurrence of two isozymes and
their differences in en- zymatic and molecular properties. Plant and Cell Physiology. 30:987–98.
Chen H.H.T. and Murata N. (2002) Enhancement of tolerante of abiotic stress by metabolic
engineering of betaines and other compatible solutes. Curr Opin Plant Biol 5: 250-257.
Curtis C.R. (1971) Disc electrophoretic comparisons of proteins and peroxidase from Phaseolus
vulgaris leaves infected with Agrobacterium tumefaciens. Canadian Journal of Botany. 49: 333-337.
Jebara S, Jebara M, Limam F, Aouani M E (2005) Changes in ascorbate peroxidase, catalase,
guaiacol peroxidase and superoxide dismutasa activities in common bean (Phaseolus vulgaris)
nodules under salt stress. Plant Physiol 162: 929—936
Munns R. and Tester M. (2008) Mechanisms of salinity tolerance. Annu Rev Plant Biol 59: 651-681.
Naik G.H., Priyandarsini K.I. and Mohan H. (2005). Evaluating the antioxidant activity of different
plant extracts and herbal formulations. Research on Chemical Intermediates. 31: 145 – 151.
Parnikoza I Yu, Miryuta N Yu, Maidanyuk D N, Loparev S A, Korsun S G, Budzanivska I G,
Shevchenko T P, Polischuk V P, Kunakh V A, Kozeretska I A (2007) Habitat and leaf cytogenetic
characteristics of Deschampsia antarctica Desv. in the Maritime Antarctica. Polar Science 1: 121128.
Patterson B.D., Payne L.A., Chen Y., Graham D. (1984) An inhibitor of cat- alase induced by cold
chilling-sensitive plants. Plant Physiol 76: 1014–1018.
Ross C., Puglisi M.P. and Paul V.J. (2008). Antifungal defenses of seagrasses from the Indian River
Lagoon, Florida. Aquatic Botany. 88: 134-141.
van de Wouw M, van Dijk P and Huiskes A (2007) Regional genetic diversity patterns in Antarctic
hairgrass (Deschampsia antarctica Desv.) J. Biogeogr. 35: 365 – 376.
Wang W, Vignani R, Scali M, Cresti M. 2006. A universal and rapid protocol for protein extraction
from recalcitrant plant tissues for proteomic análisis. Electrophoresis 27: 2782–2786.
Zhu J.K. (2001) Plant salt tolerance. Trend Plant Sci 6: 66-71.
ϭϲϭ
EVOLUCIÓN DE LA FLORA AUSTRAL-ANTÁRTICA DESDE
EL CRETÁCICO
Evolution of the Austral-Antarctic flora since the Cretaceous
Leppe, M.1, Mihoc, M.2, Varela, N.3, Stinnesbeck, W.4, Mansilla, H.1, Bierma, H.3, Cisterna, K.2, Frei, E.6,
Nishida, H.7, Riveros, P.3, Mansilla, K. 3 & Jujihara A.5
1
Laboratorio de Paleobiología, Instituto Antártico Chileno, Plaza Muñoz Gamero 1055, Punta Arenas, Chile. [email protected]
2
Departamento de Botánica, Universidad de Concepción, Chile
3
Departamento Ciencias de La Tierra, Universidad de Concepción
4
Institute for Earth Sciences, Heidelberg University, Germany
5
Universidad de Magallanes, Chile
6
Karlsruhe Naturkunde Museum, Germany
7
Chuo University, Japan.
Se sabe que al menos desde fines del Paleozoico ambientes boscosos se habrían apropiado
de Antártica (Taylor et al. 1992) y, según la visión tradicional, habrían abandonado esta
solamente a fines del Terciario Cenozoico (Francis y Poole 2002, Cantrill, 2001) gracias al
brusco descenso de temperatura que se comienza a registrar en el límite Oligo-Mioceno. Ya
se había señalado a este hito paleontológico, el hallazgo en la Antártica de fósiles de una
compleja estructura de la vegetación dominada por árboles, como uno de los puntos más
importantes develados por el hombre sobre el Continente Blanco (Axelrod 1984). La
estructura de la vegetación ha evolucionando desde un bosque dominado por coníferas y
pteridófitas durante el Cretácico inferior, en un modelo que recuerda los bosques templados
de Nueva Zelandia (Falcon-Lang et al., 2001), a bosques dominados por angiospermas,
modelo muy similar al de las selvas valdivianas del sur de Chile. Este último modelo se
habría estrenado durante el Cretácico superior, tras la masiva radiación de las angiospermas
a través de los continentes constituyentes del Gondwana. Durante el Turoniano ambas
masas de tierra estuvieron conectadas (después de un periodo de separación por la Cuenca
de Rocas Verdes) gracias a la actividad del arco continental que unía Patagonia con
Antártica (Pankhurst & Smellie 1983, Smellie et al. 1984). Una variedad de ambientes de
sedimentación ha registrado los ecosistemas terrestres de la época, dejando una cronología
de los elencos vegetacionales del Cretácico superior. Durante este lapso destacan la
Cuencas de James Ross y el Grupo Península Fildes en la Antártica y la cuenca de
Magallanes en Patagonia austral. Reconstrucciones paleoecológicas muestran que la flora
habría evolucionado en el marco de ambientes sometidos a intensa perturbación volcánica
(Poole et al. 2001). Climáticamente el área austral estaba sometida durante el fin del
Cretácico a uno de los lapsos más cálidos de la historia natural, con pulsos cálidos durante
el Turoniano y fríos durante el Campaniano y Maastrichtiano (Huber 1998). Los eventos
que siguieron fueron el incremento de la temperatura del Paleoceno y el óptimo climático
del Eoceno (Upchurch et al. 1998), para desde allí disminuir progresivamente la
temperatura hasta el brusco descenso de límite Oligo-Mioceno (Zachos et al. 2001).
HACIA UN NUEVO MODELO DE EVOLUCIÓN FLORÍSTICA
La integración de información proveniente de tres vertientes: una geológica (estratigrafía,
geoquímica, sedimentología, paleoclima, etc.), una paleontológica (estudio de los fósiles) y
una biológica (biogeografía, evolución, biología molecular, etc.) están desempeñando un
rol central en la comprensión de diversidad biológica y la paleoecología de las altas
latitudes durante las últimas etapas de la fragmentación del Gondwana. Hoy se sabe que la
ϭϲϮ
Península Antártica no fue la principal vía de entrada de las angiospermas en Antártica,
evento ocurrido probablemente a principios del Cretácico, puesto que en ese momento la
Cuenca de Rocas Verdes se erigía como una barrera efectiva a la dispersión de los
principales grupos de plantas (Leppe et al. 2011). Otros autores señalan a India y África
como las probables vías de ingreso de las plantas con flores (Cantrill & Poole 2002). Es
probable que del Maastrichtiano al Eoceno, existió un continuo forestal entre Patagonia y
Sudamérica. Poole y colaboradores (2001, 2003) destacan que alrededor del 85% del elenco
florístico que compone la Selva Valdiviana halla representantes fósiles en la Antártica del
Cretácico y Eoceno con elementos típicos como Nothofagaceae (Dettmann, 1989),
Myrtaceae (Askin 1992, Dutra y Batten 2000, Birkenmajer & Zastawniak 1986, Hayes
1999), Eucryphiaceae (Poole et al. 2003), Lophosoriaceae (Dettmann, 1986; Cantrill,
1998), Nothofagaceae, Proteaceae (Dettmann y Jarzen 1991), Cunoniaceae (Poole et al.
2000, Cranwell, 1959), Lauraceae, Monimiaceae, Cupressaceae, Podocarpaceae (Poole et
al., 2001, Dutra y Batten 2000) Araucariaceae (aunque no de la Sectio Columbea),
Podocarpaceae, Cupressaceae, Cyatheaceae y Dicksoniaceae (Askin 1992, Poole et al.
2000, Cesari et al. 2001). El presente trabajo se centra en la explicación de la relación entre
los eventos geológicos de fines del Cretácico entre Patagonia y la Península Antártica y los
patrones de distribución de flora de acuerdo a localidades clave, usando herramientas de
panbiogeografía, análisis de parsimonia de endemismos y de endemicidad de especies. La
Panbiogeografía como la Biogeografía Cladística suponen la existencia de una correlación
estrecha entre la historia de la vida y la historia de la Tierra (Espinosa et al. 2002). Para el
análisis biogeográfico de la flora y la fauna se utilizó Panbiogeografía (Craw, 1988;
Morrone y Crisci 1995, Craw et al. 1999) y Análisis de Parsimonia de Endemismos PAE
(Rosen, 1988; Morrone, 1994; Morrone y Crisci, 1995). El análisis de PAE, con base en
datos de la matriz generada para todas las localidades del Cretácico superior con los taxa
pertenecientes a sur de América del Sur, Península Antártica y las Islas Shetland del Sur se
llevó a cabo con los programas NONA versión 2.0 (Goloboff, 1993) y WinClada versión
0.9.9 beta (Nixon, 1999). En la actualidad, el PAE es considerado como uno de los métodos
para realizar análisis panbiogeográficos, donde los clados obtenidos son considerados como
trazos generalizados (Craw et al. 1999, Morrone & Márquez 2001). La búsqueda de áreas
de endemismo fue realizada mediante análisis de endemicidad (AE) propuesto por Szumik
et al. (2002), implementado en los programas NDM/VNDM (Goloboff 2004). Para la
descripción y comparación de los resultados se utilizaron áreas de consenso (AC, Szumik &
Goloboff datos no publicados). En este trabajo se usaron consensos flexibles, agrupando AI
que compartan como mínimo un 50 % de sus especies endémicas. Se realizo un análisis de
endemicidad de especies: los datos de distribución se consideraron de forma independiente,
utilizando los datos de macro y microflora, junto con los datos correspondientes a la fauna
de invertebrados marinos encontrados en las localidades antárticas y patagónicas
anteriormente mencionadas, todas las especies consideradas poseen una edad que se
encuentra en un rango de 83,5 a 65,5 millones de años atrás (Campaniano-Maastrichtiano).
ϭϲϯ
A partir del análisis de parsimonia de endemismos, se encontró el árbol más parsimonioso
(fig. 1), cuyos estadísticos son: largo (L): 259, índice de consistencia (IC): 54, índice de
retención (IR): 58 (Fig. 6). La topología del árbol muestra dos clados principales, Clado I
formado por las áreas de Isla Snow Hill, La Irene, C° Cazador, Isla Seymour e Isla James
Ross. El clado II formado por las eras C° Dorotea, C° Guido, Bahía Skúa, Zamek Hill, Half
Three Point y Price Point. Tanto el clado I como el II, muestran un patrón anidado en
relación a la distribución de las sinapomorfias, en donde, la inclusión de la isla Snow Hill al
primer clado se encuentra soportado por las especies: Microcachrydites antarcticus
Cookson, Peninsulapollis gillii Cookson y géneros Retitriletes, Peninsulapollis y
Psilatricolporites. Las localidades patagónicas de C° Guido y C° Dorotea, se incluyen en el
clado II sin presentar sinapomorfias en su distribución, dado que el PAE maximiza la
distribución de las especies, este análisis indicaría que estas áreas estarían asociadas al
clado II pero sin constituir un área de endemismo ya que no tienen especies endémicas en
todas sus localidades. El cladograma de consenso estricto, presento una politomía basal,
donde se destaca la localidad patagónica de C° Dorotea, localizada aproximadamente a los
51° de latitud sur, esto puede deberse a que esta localidad posee un esfuerzo de muestreo
considerablemente menor comparado a las otras áreas de estudio. Lo anterior es congruente
con el modelo paleogeográfico más actual, donde claramente se pueden reconocer dos áreas
en Antártica: la cuenca de James Ross, de vertiente oriental y las Shetland del Sur, de
vertiente oriental y de antearco, conectadas diferencialmente con Patagonia. Esta conexión
diferencial puede explicarse en función de la presencia de la cuenca de Magallanes y del
istmo que conectaría ambas masas continentales. La distribución parece soportar la idea de
que fue durante el Cretácico superior de Patagonia y la Península Antártica el lugar y el
momento donde se comienza a ensamblar la que hoy conocemos como Selva Valdiviana.
REFERENCIAS
•
•
•
•
•
•
•
Askin, R.A., 1992. Late Cretaceous^Early Tertiary Antarctic outcrop evidence for past vegetation
and climates. Antarct. Res. Ser. 56, 61-73.
Axelrod, D.J., 1984. An interpretation of Cretaceous and Tertiary biota in polar regions.
Palaeogeogr. Palaeoclimatol. Palaeoecol. 45, 105-147.
Birkenmajer, K., Zastawniak, E., 1986. Plant remains from the Dufayel Island Group (early
Tertiary?), King George Island, South Shetland Islands (West Antarctica). Acta Palaeobot. 26, 33-54.
Cantrill, D.J., 1998. Early Cretaceous fern foliage referable to Lophosoriaceae from President Head,
Snow Island, Antarctica. Alcheringa 22, 241^258.
Cantrill, D.J., 2001. Early Oligocene Nothofagus from CRP-3, Antarctica: Implications for the
vegetation history. Terra Antarct. 8, 401-406.
Cantrill, D.J., Poole, I., 2002. Cretaceous patterns of floristic change in the Antarctic Peninsula.
Geol. Soc. Lond. Spec. Pub. 194, 141-152.
Cesari, S.N., Marenssi, S.A., Santillana, S.N., 2001. Conifers from the Upper Cretaceous of Cape
Lamb, Vega Island, Antarctica. Cretac. Res. 22, 309^319.
ϭϲϰ
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Craw, R.C. 1988. Continuing the synthesis between panbiogeography, phylogenetic systematics and
geology as illustrated by empirical studies on the bio-geography of New Zealand and the Chatham
Islands. Syst. Zool. 37(3): 291-310.
Craw, R.C., J.R. Grehan, y M.J. Heads. 1999. Panbiogeography: Tracking the history of life. Oxford.
Biogeography Series nº11, 229 p.
Cranwell, L.M., 1959. Fossil pollen from Seymour Island, Antarctica. Nature 184, 1782-1785.
Dettmann, M.E., 1986. Signi¢cance of the Cretaceous-Tertiary spore genus Cyatheacidites in tracing
the origin and migration of Lophosoria (Filicopsida). Spec. Pap. Paleontol. 35, 63-94.
Dettmann, M.E., 1989. Antarctica: Cretaceous cradle of austral temperate rainforests? In: Crame,
J.A. (Ed.), Origins and Evolution of the Antarctic Biota. Geol. Soc. Lond. Spec. Pub. 47, pp. 89-105.
Dettmann, M.E., Jarzen, D.M., 1991. Pollen evidence for Late Cretaceous di¡erentiation of
Proteaceae in southern polar forests. Can. J. Bot. 69, 901-906.
Dutra, T.L., Batten, D.J., 2000. Upper Cretaceous floras of King George Island, West Antarctica, and
their phytogeographic implications. Cretac. Res. 21, 181-209.
Espinosa, D., Morrone,J., Llorente, J. y Flores, O. 2002. Introducción al análisis de patrones en
biogeografía histórica. Las Prensas de Ciencias, Facultad de Ciencias, UNAM, D.F. México. 132 pp.
Falcon-Lang, H.J., Cantrill, D.J., Nichols, G.J., 2001. Biodiversity and terrestrial ecology of a midCretaceous, highlatitude £oodplain, Alexander Island, Antarctica. J. Geol. Soc. Lond. 158, 709-724.
Francis, J.E., Poole, I., 2002. Cretaceous and Tertiary climates of Antarctica: evidence from fossil
wood. Palaeogeogr. Palaeoclimatol. Palaeoecol. 182, 47-64.
Francis, J, Ashworth, A, Cantrill, D, Crame, J, Howe, J, Stephens, R, Tosolini, A, Thorn, V. 2008.
100 million years of Antarctic climate evolution: evidence from fossil plants, In: X ISAES (Ed)
Antarctica: a keystone in a changing world, The Natl. Acad. Press, pp.19-27.
Goloboff, P. 1993. NONA (NO NAME) ver. 2.0. Publisher by the autor, Tucumán.
Goloboff, P. 2005. NDM / VNDM ver. 2.5. Programs for identification of areas of endemism.
http://www.zmuc.dk/public/phylogeny/endemism.
Hayes, P.A., 1999. Cretaceous Angiosperm Floras of Antarctica. Unpubl. Ph.D. Thesis, Univ. of
Leeds.
Huber, B.T., 1998. Tropical paradise at the Cretaceous Poles? Science 282, 2199-2200.
Morrone, J.J. 1994. On the identificación of areas of endemism. Syst. Biol., 43: 438-441.
Morrone, J.J. y J.V. Crisci. 1995. Historical biogeography: Introduction to methods. Annu. Rev.
Ecol. Syst., 26:373-401.
Morrone, JJ & J Márquez (2001) Halffter’s Mexican Transition Zone, beetle generalised tracks, and
geographical homology. Journal of Biogeography 28: 635-650.
Nixon, K.C. 1999. Winclada (BETA) ver. 0.9.9. Publisher by the author, Ithaca.
Pankhurst, R.J., Smellie, J.L., 1983. K-Ar geochronology of the South Shetland Islands, Lesser
Antarctica: Apparent lateral migration of Jurassic to Quaternary island arc volcanism. Earth Planet.
Sci. Lett. 66, 214-222.
Poole, I., Cantrill, D.J., Hayes, P., Francis, J.E., 2000. The fossil record of Cunoniaceae: new
evidence from Late Cretaceous wood of Antarctica? Rev. Palaeobot. Palynol. 111,127-144.
Poole, I., Hunt, R.J., Cantrill, D.J., 2001. A fossil wood flora from King George Island: ecological
implications for an Antarctic Eocene vegetation. Ann. Bot. 88, 33-54.
Poole, I., Mennega, A. & Cantrill, D. Valdivian ecosystems in the Late Cretaceous and Early
Tertiary of Antarctica: further evidence from myrtaceous and eucryphiaceous fossil wood. Rev.
Palaeobot. Palynol. 124:9-27.
Rosen, B.R. 1988. From fossil to earth history: Applied historical biogeography, pp. 437-481. In:
Myers, A.A. y P.S. Giller (Edits.). Analytical biogeography: An integrated approach to the study of
animal and plant distribution. Chapman & Hall. London.
Smellie, J.L., Pankhurst, R.J., Thomson, M.R.A., Davies, R.E.S., 1984. The geology of the South
Shetland Islands, VI. Stratigraphy, geochemistry and evolution. Brit. Antarct. Surv. Sci. Rep. 87, 185.
Szumik C., F. Cuezzo, P. Goloboff & A. Chalup. 2002. An optimality criterion to determine areas of
endemism. Syst. Biol. 51: 806-816.
ϭϲϱ
•
•
•
Taylor, E.L., Taylor, T.N., Cuneo, N.R., 1992. The present is not the key to the past: a polar forest
from the Permian of Antarctica. Science 257, 1675-1677.
Upchurch, G.R., Otto-Bliesner, B.L., Scotese, C., 1998. Vegetation atmosphere- interactions and
their role in global warming during the latest Cretaceous. Philos. Trans. R. Soc. Lond. B 353, 97112.
Zachos, J.C., Pagani, M., Sloan, L., Thomas, E., Billups, K., 2001. Trends, rhythms, and aberrations
in global climate 65 Ma to present. Science 292, 686-693.
ϭϲϲ
COMPARACIÓN DE LOS PROCESOS DE REDUCCION
DIRIGIDA DE METALES POR UN PSICRÓFILO ANTÁRTICO Y
UN TERMÓFILO
(Comparison of directed reduction of metals using an antarctic
psychrophile and a thermophile)
Maire M. 1, 2 & Blamey J. M. 2
1
Ingeniería en Biotecnología, Université de Pau et des Pays de l’Adour, Avenue de l’Université, BP 576, 64012 PAU cedex, France
2
Fundación Científica y Cultural Biociencia, José Domingo Cañas 2280, Ñuñoa, Santiago, Chile
La nanotecnología es una ciencia nueva en pleno desarrollo. Inicialmente relacionada con
estudios químicos y físicos, se asoció a la biología para mejorar propiedades de estabilidad,
solubilidad y de control de la forma y del tamaño de las nanopartículas. Esta última
propiedad es esencial para su aplicación en medicina como vector de medicamentos, en
biobalística para transformar células, en química como catalizador de reacciones, en nuevas
tecnologías como elemento base de nuevos materiales, entre otros. La asociación de
nanotecnología a procesos biológicos permite una reducción del costo energético y la
eliminación del uso de solventes tóxicos. Organismos tan variados como plantas, hongos,
bacterias y levaduras han sido utilizados para dirigir la reducción de las sales metálicas y
así sintetizar nanopartículas de una manera más ecológica. Debido a su gran diversidad,
microorganismos provenientes de la Antártica podrían ser productores potenciales de
nanopartículas a temperaturas más bajas que las reportadas hasta ahora. Esto podría ayudar
al control de su formación. En este estudio, se realizó la reducción dirigida de metales y la
síntesis de nano y micropartículas de oro, selenio y telurio por un psicrófilo aislado de una
muestra ambiental proveniente de Antártica y se comparó con un microorganismo
termofilico. Para realizar esta investigación, se utilizó tres métodos distintos para definir las
diferencias y similitudes que existen entre los mecanismos de reducción de metales y de
biosíntesis de nanopartículas de dos microorganismos tan diferentes.
En el primer método, las bacterias fueran cultivadas en un medio sólido en presencia de una
sal de oro, selenio o telurio, toxica a altas concentraciones. En presencia de oro, ningún
cambio característico de las colonias fue identificado. En presencia de selenio y telurio, se
observó el crecimiento de distintas colonias formando nanopartículas coloreadas por el
termófilo y de colonias blancas por el psicrófilo. Para ver la reducción del metal en
solución, se realizó cultivos de bacterias en medio líquido conteniendo concentraciones
conocidas de sal metálica. El cambio de absorbancia característico de cada metal en
solución indica su cambio de estado de oxidación, indicador de la formación de
nanopartículas. En presencia de oro, se observó la aparición de un color marrón en el
cultivo, la reducción de metal y la formación de microcristales de forma triangular y
hexagonal en los medios de cultivo de las dos bacterias. En presencia de selenio, se observó
la aparición de un color rojo, la reducción de metal y la formación de nanopartículas en
ambos microorganismos. En presencia de telurio, no se notó un cambio de color del cultivo
pero si se observó la reducción de metal en las dos bacterias. Sin embargo, la producción de
nanopartículas se ve limitada cuando las concentraciones de las sales metálicas necesarias
inhiben el crecimiento bacteriano. Para evitar esta limitante, se utilizó un tercer método en
el cual se resuspendió un pellet de bacteria directamente en la sal metálica sin medio de
cultivo. En presencia de oro, se observó
ϭϲϳ
exactamente el mismo resultado que con el método anterior. Sin embargo, en presencia de
selenio y de telurio, no se observó ningún cambio de color en los cultivos pero si se observó
la reducción de metal.
Estos tres métodos permitieron la síntesis de nano y micropartículas con un psicrófilo
antártico y un termófilo. Por un lado, estas dos bacterias tan diferentes son capaces de
producir microcristales idénticos de oro, de forma triangular y hexagonal, y nanopartículas
de selenio en medio líquido. Por otro lado, el termófilo produce nanopartículas de selenio y
de telurio en placas, aunque el psicrófilo no lo produce. Estos resultados reflejan la
complejidad de los fenómenos de reducción dirigida de metales y de cristalización, poco
conocido desde un punto de vista químico como biológico. Podemos concluir que para
ambos microorganismos, la biosíntesis de micropartículas de oro son independientes de la
temperatura, a diferencia de la síntesis química. Por otra parte, el mecanismo de biosíntesis
de nanopartículas de selenio y telurio es diferente al del oro. Esto puede ser debido a la
presencia de un biocompuesto similar en ambos microorganismos involucrado en la
reducción del metal y la nucleación de las nanopartículas de oro. En el caso de los semiconductores como selenio y telurio, la nucleación podría estar dirigida por biocompuestos
diferentes dependiendo del tipo de microorganismo. Este trabajo está en curso y falta
algunos resultados para poder entender más allá los fenómenos de reducción de sales de
metales y de biosíntesis de nanopartículas y nanomateriales en general.
AFRADECIMIENTOS
Universidad de Pau et des Pays de l’Adour
Proyecto CORFO Biorecursos-Antártico Innova 07CN13PXT-264
INACH
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
Suresh AK, Pelletier DA et al. Biofabrication of discrete spherical gold nanoparticles using the
metal-reducing bacterium Shewanella oneidensis. Acta Biomater. 2011 May, 7(5):2148-52.
Dhanjal S, Cameotra SS. Aerobic biogenesis of selenium nanospheres by Bacillus cereus isolated
from coalmine soil. Microbial Cell Factories. 2010, 9:52
Baesma, S.M., Bullen T.D. et al. Formation of tellurium nanocrystals during anaerobic growth of
bacteria that use Te oxyanions as respiratory electron acceptors. Applied and Environmental
Microbiology, Apr. 2007, p. 2135–2143 Vol. 73, No. 7
ϭϲϴ
PLUMA FOSIL DE LA ANTARTICA
(Fossil feather from Antarctica).
Mansilla, H.¹, Rubilar, D., Stinnesbeck, W., Leppe. M.
¹Laboratorio de Paleo-Biología, Instituto Antártico Chileno (INACH), Plaza Muñoz Gamero # 1055, Punta
Arenas, Chile, +5661-298128, [email protected]
An isolated fossil feather was found during summer 2010 at the Fossil Hill Formation
which is Eocene in age, and crops out in the Fildes Peninsula, King George Island,
Antarctica.
Feathers may present different appearance: contour feathers (body feathers, remiges and
rectrices), down feathers, semiplumes, filoplumes, and bristles. However, all present a basic
structural feature, with a central shaft separated in two parts, the calamus (basal portion
inserted in the follicle) and the rachis from which emerge barbs , theses incomprensible!
along the rachis form vanes, the most characteristic part of a feather. A barb repeats this
structure, whit a central ramus with closely spaced barbules on either side, the barbs and
their barbules determine the nature of the vane. Barbules may present hooklets which
interlock barbs creating an open or closed portion in the vane, depending of the
characteristics of the hooklets.
Characteristics of the specimen such as the form, symmetry of the vanes, presence of
barbules and hooklets, vanes distally clipped, and curved rachis, are consistent? with a
position of the wing, the length and width of the feather with it obtuse end indicates that it
might be a secondary feather, possibly a “cover feather”.
This feather was probably left by a bird near to a coastline with surrounding Nothofagus
trees (a leaf is also preserved in the slabs), probably during molting process.
This finding increases the fossil assemblage of this Formation, which belongs to a Special
Antarctic Protected Area Nº 125a (ASPA Nº 125a) due to the richness and exclusivity of its
paleontological records.
This specimen is under study and final results will be published soon.
ACKNOWLEDGMENTS
FONDECYT Project 11080223.
ϭϲϵ
ESTACIONALIDAD REPRODUCTIVA DEL ERIZO
INCUBANTE ANTÁRTICO: Abatus agassizii
(Reproductive seasonality in the Antarctic brooding sea urchin: Abatus
agassizii)
Maturana, C. S. & Poulin, E.
Instituto de Ecología y Biodiversidad. Facultad de Ciencias Ecológicas, Universidad de Chile, Casilla 653, Santiago, Chile
Si bien el Océano Austral se ha descrito como uno de los ambientes más estacionales del
mundo (Clarke 1988, Pearse y Cameron 1991, Tyler et al. 2003), caracterizado por un corto
y marcado patrón de estacionalidad en la productividad primaria (Picken 1980, Rivkin
1990, Pearse et al. 1991, Grange 2004); en algunas regiones presenta largos periodos de
cobertura de hielos (Permanent Ice Zone), produciendo ausencia de variaciones en la
temperatura superficial del agua, salinidad y fotoperiodo (Galley et al. 2005, Tréguer y
Jacques 1992)
Abatus agassizii, presenta una distribución Antártica y Subantártica. En particular, la
población de estudio se encuentra en las Islas Shetlands del Sur. Esta zona, a pesar de estar
dentro del círculo antártico, es una región cuyas condiciones ambientales son bastante
similares a las regiones subantárticas, es decir, una marcada variación de temperatura
durante el año (Branch et al. 1993, Gil 2009), cambios en el fotoperiodo, importantes
fluctuaciones en la productividad primaria (Hernando 2006, Pérez et al. 2010) y una baja
perturbación por hielo (Palma 2006). Este peculiar escenario permite evaluar la
estacionalidad de los ciclos reproductivos y compararla con los descritos en especies
hermanas en regiones antárticas y subantárticas.
Los muestreos en terreno entre los años 2008 y 2011 fueron realizados en nuestro sitio de
estudio, localizado en Bahía Fildes (62° 12’ 30,31 S; 58° 55’ 34,79 W), al suroeste de la
Isla Rey Jorge, Islas Shetlands del Sur. Todos los individuos fueron recolectados al azar
mediante buceo, durante los meses de enero y febrero.
Se tomó como referencia el ciclo de desarrollo y reproductivo de A. cordatus (Shatt y Féral
1996, Magniez 1983), ya que ha sido la única especie de este género que tiene estudios
descriptivos. Bajo la hipótesis de una reproducción continua (i.e sin ciclo reproductivo)
observaríamos una proporción de 0,25 para cada uno de los estadíos de desarrollo. Se
realizaron pruebas de 2 en hembras incubantes utilizando las proporciones de cada uno de
los estadíos observadas y aquellas que esperaríamos bajo un sistema de reproducción
continua. Para comprobar si las madres se encontraban en fase con su ciclo reproductivo, se
estudiaron las posibles diferencias en las proporciones de los estadíos del desarrollo
incubados.
Para evidenciar presencia de sincronía, se realizó un ANOVA de una vía en STADISTICA
7.0, utilizando las proporciones de los distintos estadíos por madre y por año. Para
determinar si existen diferencias entre cada uno de los años analizados e identificar cuales
generan las mayores diferencias, se realizó un ANOVA multifactorial y test de Tukey
desigual N HSD, respectivamente.
A partir del modelo de desarrollo propuesto para A. cordatus, se construyó un esquema para
calendarizar los eventos reproductivos de A. agassizii. Se calculó el día en el que se
ϭϳϬ
encontraría cada uno, mediante las proporciones y el día promedio de de cada estadío por
madre.
Para cada hembra analizada, existieron diferencias significativas entre las proporciones de
estadios observadas y esperadas. Todos los valores de 2 fueron altamente significativos
(<0.000001), por lo que sugieren la existencia de ciclo reproductivo en todas las madres
evaluadas. Además, existieron diferencias significativas entre las proporciones de los
distintos estadíos en cada unos de los años estudiados (2008: F(3,68) = 60.868; p=0.0000;
2009: F(3,52) = 67.656; p = 0.000; 2010: F(3,36) = 85.153; p = 0.000; 2011: F(3,68) = 51.456 p =
0.000). Estos resultados, corroboran la existencia de un ciclo reproductivo a nivel
poblacional, con la existencia de sincronía entre las hembras. Se encontraron diferencias
significativas en las proporciones de los distintos estadíos del desarrollo entre los años
estudiados (F(9,224): 10,322, p = 0,0001), siendo los estadios de gástrula-blástula y juveniles
tardíos los que presentaron mayores proporciones en todos los años estudiados.
Finalmente, con respecto a la calendarización, los ciclos reproductivos arrojaron una
estacionalidad de carácter anual, con dos pulsos reproductivos concentrados durante Julio
(invierno) y Diciembre (verano).
Estos resultados se asemejan a lo observado en las especies hermanas subantárticas A.
cordatus (Islas Kerguelen; Magniez 1983, Schatt y Féral 1991, 1996) y A. cavernosus
(Patagonia argentina; Gil 2009). En contraste con lo observado en las especies hermanas
antárticas A. shackletoni y A. nimrodi (McMurdo; Pearse y McClintock 1990).
Esto se ha explicado, fundamentalmente por factores ecológicos. En las regiones
subantárticas, existe una fuerte variación de los factores exógenos (i.e la temperatura,
fotoperiodo, ciclo lunar y disponibilidad de alimento). En este contexto, las dos especies
subantárticas mostrarían un ciclo anual en el cual la mayor cantidad de crías incubadas son
liberadas durante verano, posiblemente para aprovechar el aumento de la productividad
primaria y proveer nutrición y crecimiento a los juveniles (Magniez 1983, Pearse et al.
1986, Schatt y Féral 1991, Poulin y Féral 1995). En contraste, estas variaciones ambientales
no estarían presentes en la Antártica continental. En particular, la Bahía de McMurdo
muestra una temperatura superficial del agua que oscila solamente entre -2.0 y -1.7°C, con
una cantidad de material orgánico en el sedimento relativamente estable a lo largo del año
(Pearse et al. 1986). En este caso, las especies antárticas tendrían liberación constante de
los juveniles, debido a una menor estacionalidad ambiental.
Sin embargo, nuestros resultados estarían mostrando que a pesar de encontrarse en la región
de la Península Antártica, la especie A. agassizii presenta un ciclo anual con evidencia de
sincronía poblacional y dos pulsos de reproducción.
Una posible explicación para este fenómeno, se debería a la importante variación en las
Islas Shetlands, de los principales factores ambientales, como la temperatura superficial del
agua y la concentración total de clorofila (Kang 2009). Por lo tanto, esta zona, tendría
características más similares a lo observado en regiones subantárticas, que lo observado en
el Mar de Ross. Por lo que, la especie A. agassizii de Islas Shetlands, estaría
experimentando mayor variación ambiental, que aquellas especies congenéricas de
McMurdo. Esto podría indicar que las variaciones anuales de estos factores exógenos
estarían generando una fuerte ciclicidad en la reproducción de A. agassizii.
Alternativamente, una segunda explicación se refiere a la similitud genética de A. agassizii
con las especies hermanas de la región Subantártica. La filogenia de máxima parsimonia
ϭϳϭ
realizada en la familia Schizasteridae utilizando el gen COI, posiciona a A. agassizii en un
clado conformado por las dos especies subantárticas. Las especies antárticas - por el
contrario - quedan en dos clados distintos y separados entre sí, lo que podría indicar una
inercia filogenética en el determinismo de los ciclos reproductivos.
En adición a esto, A. agazzisii tiene una distribución bastante restringida en la Península
Antártica, ya que sólo se ha encontrado una población en Bahía Fildes, a pesar del esfuerzo
de muestreo que se ha realizado en numerosas expediciones entre 2004 y 2011. Asimismo,
esta especie tiene registro de haberse encontrado en las Islas Georgia del Sur, lo cual
permite pensar que esta especie habría colonizado las Islas Shetlands desde zonas
subantárticas durante el proceso de transición entre el último periodo glacial y el actual
interglacial. El éxito de sobrevivencia que habría tenido esta especie, se debería
principalmente, a las características actuales del medio ambiente de la zona, similares en
varios aspectos con las regiones subantárticas.
AGRADECIMIENTOS
Instituto Antártico Chileno, Instituto de Ecología y Biodiversidad PFB-23 y ICM
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
Branch GM, CG Attwood, D Gianakouras y ML Branch. 1993. Patterns in the benthic communities
on the shelf of the sub-Antarctic Prince Edward Islands. Polar Biology I 13:23 - 34
Clarke A. 1988. Seasonality in the antarctic marine environment. Comparative Biochemistry and
Physiology Part B: Comparative Biochemistry 90(3): 462-473
Galley EA, PA Tyler, A Clarke y CR Smith. 2005. Reproductive biology and biochemical
composition of the brooding echinoid Amphipneustes lorioli on the Antarctic continental shelf.
Marine Biology 148: 59-71
Gil DG, HE Zaixo y JA Tolosano. 2009. Brooding of the sub-Antarctic heart urchin, Abatus
cavernosus (Spatangoida: Schizasteridae), in southern Patagonia. Marine Biology 156: 1647-1657.
Grange LJ, PA Tyler, LS Peck y N Cornelius. 2004. Long-term interannual cycles of the
gametogenic ecology of the Antarctic brittle star Ophionotus victoriae. Marine Ecology Progress
Series 278, 141–155.
Hernando MP. 2006. Efectos de la radiación solar sobre el Wtoplancton de aguas Antárticas y subAntárticas. PhD Thesis, Universidad de Buenos Aires, Facultad de Ciencias Exactas y Naturales,
Buenos Aires, Argentina
Kang CK, MS Park, PY Lee, WJ Choi, WC Choi. 2000. Seasonal variations in condition,
reproductive activity, and biochemical composition of the Pacific oyster, Crassostrea gigas
(Thunberg), in suspended culture in two coastal bays of Korea. Journal Shellfish Research 19:771–
778
Magniez P. 1983. Reproductive cycle of the brooding echinoid Abatus cordatus (Echinodermata) in
Kerguelen (Antarctic Ocean): changes in the organ indices, biochemical composition and caloric
content of the gonads. Marine Biology 74: 55-64
Tréguer P y G Jacques. 1992. Dynamics of nutrients and phytoplankton, and fluxes of carbon,
nitrogen and silicon in the Antarctic Ocean. Polar Biology, 12: 149-162
Tyler PA, S Reeves, L Peck, A Clarke y D Powell. 2003. Seasonal variation in the gametogenic
ecology of the Antarctic scallop Adamussium colbecki. Polar Biology 26: 727–733
Palma AT, E Poulin, MG Silva, RB San Martín, CA Muñoz y AD Díaz. 2006. Antarctic shallow
subtidal echinoderms: is the ecological success of broadcasters related to ice disturbance? Polar
Biology 30: 343-350
Pearse JS, JD Eernisse, VB Pearse y KA Beauchamp.1986. Photoperiodic Regulation of
Gametogenesis in Sea Stars, with evidence for an Annual Calendar Independent of Fixed Daylength.
American Zoologist 26: 417-431
ϭϳϮ
•
•
•
•
•
•
•
•
•
•
Pearse JS y JB McClintock. 1990. A comparison of reproduction by the brooding spatangoid
echinoids Abatus shackletoni and A. nimrodi in McMurdo Sound, Antarctica. Invertebrate
Reproduction and Development 17(3): 181-191
Pearse JS y RA Cameron. 1991. Echinodermata: Echinoidea. En: “Reproduction of Marine
Invertebrates Vol. VI”. (AC Giese, JS Pearse y VB Pearse, eds.), pp. 513-662. Boxwood Press,
California, USA.
Pearse JS, JB McClintock, I Bosch. 1991. Reproduction of Antarctic benthic marine invertebrates:
tempos, modes, and timing. American Zoologist 31: 65-80
Pérez AF, C Boy, E Morriconi y J Calvo. 2010. Reproductive cycle and reproductive output of the
sea urchin Loxechinus albus (Echinodermata: Echinoidea) from Beagle Channel, Tierra del Fuego,
Argentina. Polar Biology 33: 271-280.
Picken LS. 1980. Reproductive adaptation of Antarctic benthic invertebrates. Biological Journal of
the Linnean Society. 14: 67-75
Poulin E y JP Féral. 1995. Pattern of spatial distribution of a brood-protecting schizasterid echinoid,
Abatus cordatus, endemic to the Kerguelen Islands. Marine Ecology Progress Series 118: 179-186
Rivkin RB. 1990. Seasonal patterns of planktonic production in McMurdo Sound Antarctica.
American Zoologist 30:5-16
Schatt P y JP Féral. 1991. The brooding cycle of Abatus cordatus (Echinodermata: Spatangoida) at
Kerguelen Islands. Polar Biology 11:283-292
Schatt P y JP Féral. 1996. Completely direct development of Abatus cordatus, a brooding
Schizasterid (Echinodermata: Echinoidea) from Kerguelen, with description of Perigastrulation, a
hypothetical new mode of gastrulation. The Biological Bulletin 190: 24-44
Webber HH y AC Giese. 1969. Reproductive cycle and gametogenesis in the black abalone Haliotis
cracheroidii (Gastropoda: Prosobranchiata). Marine Biology 4: 152-159
ϭϳϯ
MICROORGANISMOS ANTÁRTICOS COMO MODELO PARA
LA PRODUCCIÓN DE NANOPARTÍCULAS
SEMICONDUCTORAS FLUORESCENTES (QUANTUM DOTS)
[Antarctic microorganisms as a model for the production of fluorescent
semiconductor nanoparticles (quantum dots)].
Monrás J.P., Bravo D., Díaz. V., Vásquez C.C. & Pérez-Donoso J. M.
Facultad de Química y Biología, Universidad de Santiago de Chile
Las nanopartículas (NPs) semiconductores fluorescentes o "puntos cuánticos" (QDs) son
muy codiciados y tienen diversas aplicaciones biotecnológicas. Los QDs son NPs altamente
fluorescentes que presentan un estrecho espectro de emisión, el cual es proporcional al
tamaño de las partículas. Los QDs están compuestos por elementos como Cd, Te, Se, Pb,
Zn, As y Hg, entre otros. Estas nanopartículas se han utilizado como sondas fluorescentes
(Resch-Genger y cols., 2008) en biomedicina por su capacidad de unirse a moléculas
“enlazantes” como anticuerpos, aptámeros y proteínas (Goldman y cols., 2002; Chu y cols.,
2006), para el diagnóstico de una variedad de enfermedades y hasta en terapias para
enfermedades como cáncer (Vashist y cols., 2006). Dadas sus propiedades
semiconductoras, su uso se ha visto reflejado en el desarrollo de nuevas celdas solares más
eficientes (Bang y Kamat, 2009) y en el diseño de “nano-chips”, entre otros (Faraon y cols.,
2007).
Las aplicaciones de las nanopartículas crecen día a día, sin embargo, su preparación sigue
siendo problemática. Las técnicas actuales de síntesis utilizan procesos químicos, altas
temperaturas, sustratos tóxicos y condiciones anaeróbicas. Sin considerar el impacto
ambiental que causan, muchas de estas metodologías son peligrosas, costosas e ineficientes.
Por otra parte, las aplicaciones de los nanomateriales obtenidos mediante estas
metodologías se han visto limitadas como consecuencia de la alta toxicidad que presentan.
En este contexto, el uso de microorganismos para la biosíntesis de nanopartículas (NPs)
representa una alternativa simple, segura y económica de síntesis, que permite la
generación de NPs con propiedades especiales, principalmente mayor biocompatibilidad, lo
cual favorece sus potenciales aplicaciones. A la fecha, la síntesis intracelular de QDs
utilizando microorganismos ha sido poco descrita y sólo se han reportado recientemente
algunos ejemplos de microorganismos productores de QDs de CdS y CdSe.
Algunos microorganismos son capaces de generar diversos arreglos metálicos a nanoescala.
La biosíntesis de NPs metálicas no semiconductoras (como Ag o Au) es un fenómeno que
implica la reducción de estos metales al interior o exterior de la célula mediante el proceso
de biomineralización (Ahmad y cols., 2003; Samadi y cols., 2009; Narayanan y Sakthivel,
2010).
Durante los últimos años, nuestro grupo se ha interesado en la producción de QDs por
microorganismos. Con este fin, hemos desarrollado un protocolo de síntesis química que
simula condiciones que se encuentran en las células bacterianas (“biomimético”), y que
requiere sólo sustratos metálicos y el tiol biológico glutatión. Con este nuevo protocolo, la
síntesis de QDs de CdTe se logra a temperaturas y pHs de 50°- 90 °C y 8.5-13.8,
respectivamente. Los QDs así producidos, presentan propiedades espectroscópicas y
niveles de biocompatibilidad que favorecen sus aplicaciones en sistemas biológicos (Pérez
Donoso et al., N ° solicitud de patente 01.596).
ϭϳϰ
Basándonos en las condiciones descritas en este método, hemos logrado biosintetizar QDs
fluorescentes al interior de distintos microorganismos como Pseudomonas aeruginosa PAO
I, Saccharomyces cerevisiae y Aeromonas caviae ST. En base a los estudios en estos
microorganismos hemos podido determinar que el estado redox intracelular es fundamental
para el proceso de biosíntesis de QDs. Un claro ejemplo en el cuál un ambiente reductor
intracelular puede promover la síntesis de estas estructuras corresponde a células de
Escherichia coli que sobreexpresan el gen involucrado en la biosíntesis de glutatión (GSH),
gshA. Estas células presentan niveles altos de GSH y tioles reducidos intracelulares, y al
tratar con CdCl2 o una mezcla CdCl2/K2TeO3 logramos formar estructuras fluorescentes.
Una caracterización espectroscópica de las estructuras fluorescentes purificadas evidencio
que poseen los perfiles de absorción y emisión característicos de NPs de CdS y CdTe
(Kang y cols. 2008; Qian y cols. 2006; Bao y cols. 2010 a, b). Análisis de tamaño evidencio
que presentan tamaños nanométricos idénticos a los descritos para QDs de CdS y CdTe, 5.8
y 4.8 nm respectivamente. Por último, un análisis elemental por ICP-MS reveló que las
nanopartículas purificadas están compuestas por Cd y Te, confirmando a presencia de QDs
de CdS y CdTe.
Para determinar si ciertos parámetros podrían afectar las propiedades fluorescentes de las
NPs biosintetizadas en células de E. coli, se desarrolló biosíntesis bajo condiciones que
logran favorecer la síntesis química de NPs de CdTe (Pérez-Donoso et al., manuscrito en
revisión) como; elevadas temperaturas, ambientes microaerofílicos y uso de soluciones
reductoras como citrato. Un pequeño incremento en la temperatura (42°C) aumentó la
fluorescencia de las células al ser expuestas a luz UV. Las condiciones microaerofílicas
parecen no afectar la biosíntesis de estas estructuras, pero el uso de una solución de citrato
cambia el color de la fluorescencia de las células.
Estos resultados han permitido determinar algunos parámetros que favorecen la biosíntesis
de QDs como la temperatura, pero principalmente han demostrado que el estado redox y las
defensas antioxidantes intracelulares son los principales factores que favorecen el proceso
de biosíntesis de QDs.
En este contexto, nuestro grupo ha planteado que el continente Antártico presenta
condiciones ambientales únicas que favorecerían el desarrollo de microorganismos con
potencial para biosintetizar QDs. En la Antártica encontramos ambientes con temperaturas
extremas (mayormente bajas pero con lugares como isla Decepción que presenta zonas de
altas temperaturas), y sobre todo una constante exposición a altos niveles de radiación UV.
En este contexto, creemos que las características particulares del ambiente Antártico han
favorecido el desarrollo de microorganismos con potentes sistemas antioxidantes, un
favorable estado redox intracelular y altos niveles de tolerancia a condiciones adversas
(temperaturas y estrés por metales), entre otros, que favorecen su potencial uso en la
biosíntesis de nanopartículas semiconductoras fluorescentes.
De este modo y basados en los antecedentes previamente señalados, recientemente nos
adjudicamos un proyecto INACH que considera el siguiente objetivo general; "Aislar
microorganismos Antárticos capaces de biosintetizar NPs semiconductoras fluorescentes
con propiedades que favorezcan posibles aplicaciones biotecnológicas".
ϭϳϱ
LOS OBJETIVOS ESPECÍFICOS DEL PROYECTO
1.- Aislar cepas bacterianas desde la Antártica con la capacidad de sintetizar QDs.
2.- Evaluar la producción de QDs en las cepas Antárticas aisladas.
3.- Purificar y caracterizar los QDs biosintetizados por microorganismos Antárticos.
4.- Evaluar potenciales aplicaciones biotecnológicas de los QDs biosintetizados por
microorganismos Antárticos.
Las metodologías a utilizar en esta propuesta involucrarán el aislamiento y caracterización
de microorganismos a partir de distintos ambientes Antárticos, principalmente aquellos
presentes en las distintas islas del sector I. La síntesis de QDs será ensayada in vivo
determinando la fluorescencia de las células en un lector de fluorescencia en microplacas o
por microscopia de fluorescencia. Los QDs serán caracterizadas espectroscópicamente
(fluorescencia, absorción y rendimiento cuántico), estructuralmente (forma y tamaño) y
químicamente (composición elemental) mediante Dynamic light scattering (DLS),
microscopía electrónica de alta resolución (HR-TEM) e Inductive Coupled Plasma (ICP).
Finalmente, las ventajas de los QDs biosintetizadas en potenciales aplicaciones como la
detección de células y moléculas, immunofluorescencia, y en biomedicina como agentes
antimicrobianos o anticancerígenos, también serán evaluadas.
Los resultados de este proyecto ayudaran en el desarrollo de métodos simples, económicos,
seguros y ambientalmente amistosos de biosíntesis de QDs con propiedades especiales.
Además, el estudio de las características de los microorganismos Antárticos capaces de
sintetizar QDs permitirá descifrar los mecanismos moleculares involucrados en biosíntesis
de QDs y de este modo permitirá manejar las propiedades de estas moléculas al interior de
la célula. Finalmente, los QDs biosintetizados serán utilizados en diferentes aplicaciones
biomédicas derivadas de las particulares propiedades químicas, espectroscópicas y de
biocompatibilidad que presenten.
REFERENCIA BIBLIOGRÁFICA
•
•
•
•
•
•
•
•
Resch-Genger, U., Grabolle, M., Cavaliere-Jaricot, S., Nitschke, R., Nann, T. 2008. Quantum dots
versus organic dyes as fluorescent labels. Nature Meth. 5(9):763-775.
Goldman, E., Balighian, E., Mattoussi, H., Kuno, M., Mauro, J., Tran, P., Anderson, G. 2002.
Avidin: a natural bridge for quantum dot-antibody conjugates. J. Am. Chem. Soc. 124(22):63786382.
Chu, T., Shieh, F., Lavery, L., Levy, M., Richards-Kortum, R., Korgel, B., Ellington, A. 2006.
Labeling tumor cells with fluorescent nanocrystal-aptamer bioconjugates. Biosens. Bioelectron.
21(10):1859-1866.
Faraon, A., Englund, D., Fushman, I., Vukovi, J., Stoltz, N., Petroff, P. 2007. Local quantum dot
tuning on photonic crystal chips. Appl. Phys. Lett. 90(21):213110.
Bang, J., Kamat, P. 2009. Quantum dot sensitized solar cells. A tale of two semiconductor
nanocrystals: CdSe and CdTe. ACS Nano 3(6):1467-1476.
Ahmad, A., Senapati, S., Khan, M., Kumar, R., Ramani, R., Srinivas, V., Sastry, M. 2003.
Intracellular synthesis of gold nanoparticles by a novel alkalotolerant actinomycete, Rhodococcus
species. Nanotechnology 14(7):824-828.
Narayanan, K., Sakthivel, N. 2010. Biological synthesis of metal nanoparticles by microbes. Adv.
Colloid Inter. Sci. 156(1-2):1-13.
Samadi, N., Golkaran, D., Eslamifar, A., Jamalifar, H., Fazeli, M., Mohseni, F. 2009.
Intra/extracellular biosynthesis of silver nanoparticles by an autochthonous strain of Proteus
mirabilis isolated from photographic waste. J. Biomed. Nanotechnol. 5(3):247-253.
ϭϳϲ
•
•
•
Bao, H., Hao, N., Yang, Y., Zhao, D. 2010a. Biosynthesis of biocompatible cadmium telluride
quantum dots using yeast cells. Nano Res. 3(7):481-489.
Bao, H., Lu, Z., Cui, X., Qiao, Y., Guo, J., Anderson J., Li C. 2010b. Extracellular microbial
synthesis of biocompatible CdTe quantum dots. Acta Biomater. 6(9):3534-3541.
Kang, S., Bozhilov, K., Myung, N., Mulchandani, A., Chen, W. 2008. Microbial synthesis of CdS
nanocrystals in genetically engineered E. coli. Angewan. Chem. Int. Ed. Eng. 47(28):5186-5189.
ϭϳϳ
EFECTO DE LA RADIACIÓN ULTRAVIOLETA EN LA
ACTIVIDAD ANTIOXIDANTE DE LA ENZIMA SUPERÓXIDO
DISMUTASA PROVENIENTE DE UN MICROORGANISMO
ANTÁRTICO
(Effect of ultraviolet radiation in antioxidant activity of superoxide
dismutase enzyme from an Antarctic microorganism)
Monsalves, M.T. 1, 2, Ollivet-Besson, G.2, Pereira, J.2, Peralta, R 3, 2 & Blamey, J. M. 2
1
Ingeniería en Biotecnología, Universidad Tecnológica de Chile INACAP
2
Fundación Científica y Cultural Biociencia
3
Doctorado en Biotecnología. Universidad de Santiago de Chile
La capa de ozono estratosférica luce un enorme “agujero” en el hemisferio sur sobre la
Antártica, que cubre alrededor de 29 millones de kilómetros cuadrados, casi la superficie de
toda América del Norte. El "agujero" no es en realidad un agujero, sino una región que
contiene una concentración muy baja de ozono, al parecer la acción de los
clorofuorocarbonos (CFC) es favorecida por las condiciones climáticas exclusivas de la
zona, que crean una masa aislada de aire frío alrededor del polo sur. El sol emite radiación
de diferente longitud de onda. La parte del espectro radiante que se encuentra comprendida
entre los 100 nm y los 390 nm aproximadamente es a la que llamamos radiación
ultravioleta. Existen tres tipos de esta radiación: UV-A de mayor longitud de onda, UVB de longitud de onda intermedia y UV-C de menor longitud de onda. La radiación UV-C
es la más penetrante y letal para la vida de la biosfera.
La exposición prolongada de organismos aeróbicos a la radiación ultravioleta origina la
formación de radicales libres. Los radicales libres están implicados en el daño celular, se
pueden formar en el interior de la célula como producto de su actividad fisiológica o
también pueden generarse de fuentes exógenas. En el proceso de respiración celular, los
microorganismos aeróbicos generan especies reactivas de oxigeno (ROS) tales como el
anión superóxido (O2-), peróxido de hidrogeno (H2O2) y radicales hidroxilos (OH-). Cuando
existe un desequilibrio entre la producción de ROS y la capacidad del sistema biológico
para eliminar estos compuestos tóxicos, se habla de estrés oxidativo. Este estrés puede
generar modificaciones de los constituyentes celulares como ácidos nucleicos, proteínas y
lípidos, lo que puede provocar mutagénesis e incluso muerte celular. Afortunadamente, la
mayoría de los microorganismos aeróbicos cuentan con mecanismos de defensa que pueden
ser de origen enzimático como la enzima superóxido dismutasa (SOD), encargada de
contrarrestar la acción de dichos radicales libres transformando el anión superóxido (O2-) en
peróxido de hidrógeno y oxígeno molecular (O2).
Los microorganismos antárticos como bacterias o arqueas, son tolerantes a altas dosis de
radiación ultravioleta de los tres tipos (A, B y C), por lo que se espera que posean una
actividad antioxidante SOD elevada. Por esta razón, en este trabajo se presenta el estudio
realizado a la enzima SOD proveniente de una bacteria psicrófila halotolerante llamada I1P,
altamente resistente a la radiación ultravioleta, aislada del continente Antártico.
La bacteria I1P, crece en un medio suplementado con NaCl en agitación constante a 4ºC
por 120 horas.
La actividad superóxido dismutasa fue definida como la capacidad de la enzima de inhibir
en un 50% la reducción de azul de tetrazolio (NBT) por el anión superóxido. La máxima
actividad específica de la enzima SOD obtenida de I1P, fue de 120 U/mg.
ϭϳϴ
La enzima fue purificada y parcialmente caracterizada. Esta tiene un pH óptimo igual a 7 y
presenta actividad en un amplio rango de temperatura que va de los -20 a los 70ºC. Esta
enzima fue almacenada por 3 meses a 10ºC manteniendo un 75% de su actividad total.
Además, en los extractos crudos, se estudió el efecto de los tres tipos de radiación
ultravioleta (A, B y C) sobre la actividad antioxidante de la enzima SOD de la bacteria I1P,
resultando que con la radiación tipo UV-A, se obtuvieron los valores más bajos de
actividad SOD y con radiación tipo UV-B y UV-C, los valores de actividad SOD fueron
similares.
Sin duda, el estudio de la enzima superóxido dismutasa de la bacteria I1P, es importante
pues presenta propiedades catalíticas peculiares.
AGRADECIMIENTOS
Nuestros agradecimientos al Instituto Antártico Chileno (INACH), a la oficina de
investigación científica estadounidense AFOSR y al proyecto INNOVA-CORFO:
07CN13PXT-264.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
Aydemir, T. y Tarhan, L. (2000) Purification and partial characterization of Superoxide Dismutase
from Chicken Erythocytes. Turkish Journal Chemistry. 25: 451-459.
Seatovic, S. Et al. (2004) Purification and Partial Characterization of Superoxide Dismiutase from
the thermophilic Bacteria Thermothrix sp. Journal of the Serbian Chemical Society. 69: 9-16.
Stroupe, E., DiDonato, M., and Tainer, J. (2001) Manganese superoxide dismutase. Handbook of
Metalloproteins ¤ John Wiley & Sons. pp: 940-951.
ϭϳϵ
COMPOSICIÓN FAUNÍSTICA Y DISTRIBUCIÓN TEMPORAL
DE ZOOPLANCTON EN BAHÍA FILDES, ANTÁRTICA
(VERANO 2011)
(Faunal composition and temporal distribution of zooplankton in Fildes
Bay, Antarctica (Summer 2011)).
Mora, G. & Palma S.
Escuela de Ciencias del Mar, Pontificia Universidad Católica de Valparaíso, Valparaíso, Chile. [email protected]
El ecosistema antártico presenta especial interés científico no solo por sus características
oceanográficas extremas, sino también por su alto porcentaje de especies endémicas, que
tiene escasa interacción con sistemas ecológicos adyacentes, constituyendo un ecosistema
típico (Mujica & Torres, 1982). Los estudios cooperativos efectuados durante el desarrollo
del programa BIOMASS (Investigaciones Biológicas de Sistemas y Stock Marinos
Antárticos) y los Experimentos Biológicos Internacionales (FIBEX y SIBEX-Fases I y II),
realizados en los veranos 1981 y 1984-85 respectivamente, junto a investigaciones
realizadas por Mujica & Ortega (1991) y Mujica & Alarcón (1991-1994), han permitido
conocer la estructura, distribución y dinámica de algunos taxa zooplanctónicos en el
estrecho Bransfield y áreas adyacentes.
El conocimiento del zooplancton en el océano Austral ha estado focalizado esencialmente
en el estudio de organismos quitinosos, como copépodos y eufáusidos, debido a su
importante rol en las redes tróficas antárticas (Pagès, 1997). Sin embargo, el zooplancton
gelatinoso ha recibido escasa atención y la información existente contrasta con la presencia
frecuente de enormes agregaciones de salpas y medusas observadas en la región antártica
(Huntley et al., 1989; Nishikawa et al., 1995; Pagès et al., 1994). Los resultados obtenidos
en las dos últimas décadas indican que el plancton gelatinoso desempeña un papel
relevante, no solo en el ecosistema antártico (Smith & Schnack-Schiel, 1990; SchnackSchiel & Mujica, 1994; Marchant & Murphy, 1994), sino también en varios mares y
océanos, particularmente en ambientes semicerrados, como mares Negro y Caspio, donde
son comunes las proliferaciones de organismos gelatinosos, principalmente de ctenóforos y
medusas (Mills, 2001; Brodeur et al., 2002).
En vista que las investigaciones mencionadas corresponden a estudios ocasionales
realizados generalmente en aguas abiertas, los resultados obtenidos durante un ciclo de
pescas planctónicas en bahía Fildes, permitirán aportar información relevante sobre
biodiversidad y fluctuación temporal de zooplancton a microescala.
MATERIALES Y MÉTODOS
Entre el 5 diciembre 2010 y el 15 enero 2011, se realizó un estudio oceanográfico con un
bote zodiac para efectuar muestreos intensivos en tres estaciones oceanográficas,
localizadas al interior de Bahía Fildes, Isla Rey Jorge-Shetland del Sur, Antártica (Fig.1),
además se realizaron muestreos ocasionales en distintos puntos al interior de la bahía. Cada
punto de muestreo fue posicionado geográficamente con un GPS. Los muestreos se
efectuaron semanalmente mediante pescas verticales (0-40 m) con una red Norpac de 45
cm de diámetro de boca y 350 µ de abertura de malla. Simultáneamente, se realizaron
lances de CTD para obtener perfiles verticales de temperatura, salinidad y densidad de la
columna de agua (0-40 m).
ϭϴϬ
Las muestras recolectadas se fijaron y preservación con formalina al 5% en agua de mar,
tamponada con tetraborato de sodio y se almacenaron en frascos plásticos para su análisis
en laboratorio. De las muestras obtenidas, se efectuó la separación, identificación y
cuantificación de los organismos pertenecientes a los siguientes taxa: copépodos,
apendiculares y larvas de eufáusidos. En cuanto a los datos de CTD, éstos fueron extraídos
y almacenados en un computador al final de cada salida.
RESULTADOS
Los resultados mostraron la presencia escasa de zooplancton gelatinoso en las estaciones
analizadas, a excepción de las salpas. Los organismos gelatinosos no superaron el 1% del
zooplancton recolectado. A pesar de la ausencia de salpas en las muestras de plancton, se
observaron en la orilla de playa (zona submareal e intermareal), varazones de 21 a 116
ind/m2 (Salpa thompsoni en su forma blastozoide) que permanecieron aproximadamente
durante dos días en la bahía.
La composición faunística de zooplancton estuvo constituida principalmente por copépodos
(76%), seguida de larvas de eufáusidos (7,1%) y apendicularias (7,0%) (Tabla 1). Mientras
que la frecuencia de ocurrencia, indicó en orden decreciente, a copépodos (97%), larvas de
eufáusidos (67%) e isópodos (39%) (Tabla 1 ).
Al comparar la abundancia de zooplancton total entre diciembre (2010) y enero (2011) se
determinó un fuerte incremento en la abundancia de zooplancton, que fue aproximadamente
cinco veces mayor, pasando de 4063 a 20143 ind/100 m3 (Tabla 2). Si bien las
apendicularias constituyen uno de los taxa dominantes (7,0%), estas al igual que los
anélidos y quetognatos solo se capturaron en enero (Tabla 2), los ctenóforos por su parte
mostraron un comportamiento totalmente inverso y fueron capturados solo en diciembre
(Tabla 2). El fuerte incremento en la abundancia de zooplancton en enero 2011 además de
estar representada por los taxa pertenecientes a: apendicularias, anélidos y quetognatos es
complementado por la aparición de copépodos, eufáusidos, larvas de eufáusidos,
ostrácodos, pterópodos y anfípodos. Los que aumentaron en más de un 60% respecto a su
abundancia total (Tabla 2). En cambio medusas y larvas de equinodermos fueron más
abundantes en diciembre.
La composición específica de los grupos más abundantes estuvo representada por cinco
especies de copépodos (Oithona simillis, O. frígida, Calanoides acutus, Calanus
propinquus y Sapphirina. spp), una de apendicularias (Fritillaria. spp) y una de eufáusidos
en sus estadios larvales de calyptopis (C) y furcillia (F) (Thysanoessa macrura).
Los copépoditos fueron ampliamente dominantes durante todo el periodo de muestreo (55.5
%), mientras que a nivel de especie y en orden decreciente la abundancia estuvo constituida
por Oithona simillis (13.3%), Fritillaria .spp (9.9%), Calanoides acutus (7.2%),
thysanoessa macrura (C) (6.4%), Sapphirina. spp (3.7%), thysanoessa macrura (F) (2.0%),
Calanus propinquus (1.6%) y Oithona frígida (0.4%) (Tabla 3). La frecuencia de
ocurrencia por su parte coincide en los grupos/especies dominantes, copepoditos y Oithona
simillis son los más frecuentes, ambos con un 75%, seguidos de Calanoides acutus
(63.9%), thysanoessa macrura (C) (55.6%), Sapphirina. spp (55.6%), Fritillaria.spp
(36.1%), Calanus propinquus (30.6%), thysanoessa macrura (F) (27.8%) y Oithona frígida
(13,9%) (Tabla 3).
Las condiciones oceanográficas de la bahía mostraron un fuerte incremento de la
temperatura en enero, variando de 0,2-0,9°C en diciembre a 1,0-2,5°C en enero (Figs.2aϭϴϭ
2b). En cambio, la salinidad mostró una escasa variación, fluctuando entre 34 y 34,3 psu,
durante todo el periodo de muestreo (Figs. 2c- 2d).
Finalmente el análisis de correlación de pearson (p<0.05) entre las variables oceanográficas
(temperatura y salinidad) y la abundancia de zooplancton (ind/100m3) indicó que las
apendicularias (Fritillaria. spp) y larvas de eufáusidos en sus estadios de calyptopis
(thysanoessa macrura) poseen una correlación negativa con la salinidad (-0.73 y -0.89
respectivamente), mientras que Fritillaria. spp posee una correlación positiva con la
temperatura (0.93) (Tabla 4).
DISCUSION Y CONCLUSIONES
Se encontró un total de 13 taxa de zooplancton (Copépodos, eufáusidos, ctenóforos,
medusas, quetognatos, larvas de equinodermos, ostrácodos, larvas de eufáusidos,
apendiculares, pterópodos, isópodos, anfípodos y anélidos). Mientras que la composición
específica de los taxa dominantes estuvo representada por cinco especies de copépodos
(Oithona simillis, O. frígida, Calanoides acutus, Calanus propinquus y Sapphirina. spp),
una de apendicularias (Fritillaria. spp) y una de eufáusidos, en sus estadios larvales de
calyptopis y furcilia (Thysanoessa macrura), siendo los copépodos ampliamente
dominantes y frecuentes durante todo el periodo de muestreo. Por otra parte se encontró
una correlación positiva entre Fritillaria spp. y la temperatura debido a su incremento en
enero 2011, y una correlación negativa entre su abundancia y la salinidad en el mismo
periodo.
AGRADECIMIENTOS
Instituto Antártico Chileno (INACH), la empresa Correos de Chile y la Fuerza Aérea de
Chile (FACH).
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
Brodeur, R., H. Sugisaki & G. Hunt Jr. 2002. Increases in jellyfish biomass in the Bering Sea:
implications for the ecosystem. Mar. Ecol. Prog. Ser., 233: 89-103.
Marchant, H. & E. Murphy. 1994. Interactions at the base of the Antarctic food web. En: S.Z. ElSayed (ed.). Southern Ocean ecology: the BIOMASS perspective. Cambridge University Press,
London, pp. 267-285.
Mills, C. 2001. Jellyfish blooms: are populations increasing globally in response to changing ocean
conditions? Hydrobiology, 451: 55-68.
Mujica, A. & E. Alarcón. 1999. Crecimiento del krill juvenil (Euphausia superba Dana, 1852) en
torno a islas Shetland del Sur, durante el verano austral (1991-1994). Ser. Cient. INACH, 49: 73-78.
Mujica, A. & R. Ortega. 1999. Zooplancton en la ruta alimentaria de Arctocephalus gazella. Ser.
Cient. INACH, 49: 51-71.
Mujica, A. & A. Torres, 1982. Análisis cualitativo y cuantitativo del zooplancton antártico. Ser.
Cient. INACH, 28: 181-191.
Pagès, F. 1997. The gelatinous zooplankton in the pelagic system of the Southern Ocean: a review.
Ann. Inst. Océanogr. Paris, 73(2): 139-158.
Schnack-Schiel, S. & A. Mujica. 1994. The zooplankton of the Antarctic Peninsula region. En: S.Z.
El-Sayed (ed.). Southern Ocean ecology: the BIOMASS perspective. Cambridge University Press,
London, pp. 79-92.
Smith, S. & S, Schnack-Schiel. 1990. Polar Zooplankton. En: W.O. Smith Jr. (ed.). Polar
Oceanography, Part B: Chemistry, biology and geology. Academic Press, London, pp. 527-598.
ϭϴϮ
Tabla 1. Dominancia (%) y frecuencia (%) del zooplancton colectado en diciembre de 2010 y enero de
2011 en bahía Fildes. NI: No identificados
Table 1. Dominance (%) and frequency (%) of zooplankton collected in December 2010 and January 2011
at Fildes bay.
NI: Unidentified
Organismos
Copépodos
Eufáusidos
Ctenóforos
Medusas
Quetognatos
Larvas de equinodermos
NI
Ostracodos
Larvas de Eufáusidos
Appendiculares
Pterópodos
Isópodos
Anfípodos
Anélidos
Dominancia (%)
76.3
1.2
0.4
0.2
0.1
0.6
0.8
0.7
7.1
7.0
1.7
2.1
1.6
0.2
Frecuencia (%)
97.2
25.0
5.6
8.3
5.6
16.7
22.2
19.4
66.7
36.1
22.2
38.9
33.3
8.3
Tabla 2. Abundancia (ind./100 m3), dominancia (%) y frecuencia (%) del zooplancton colectado en las
diferentes estaciones de muestreo en bahía Fildes, durante diciembre de 2010 y enero de 2011. MO:
muestreos ocasionales.
Table 2. Abundance (ind./100 m3), dominance (%) and frequency (%) of zooplankton collected in the
different sampling stations in FildesBay, during December 2010 and January 2011.
MO: occasional sampling.
DICIEMBRE 2010
Estaciones
E1
E2
E3
ENERO 2011
MO
Total
(%)
Dom.
(%)
Frec.
E1
E2
Abundancia
E3
MO
Total
(%)
Dom.
(%)
Frec.
Total
(ind./100m3)
Copépodos
865
637
452
925
2879
15.6
94.4
3749
4504
2464
4878
15595
84.4
100.0
18474
Eufáusidos
0
0
24
47
72
25.1
11.1
93
16
16
89
214
74.9
38.9
285
Ctenóforos
0
17
73
0
91
100.0
11.1
0
0
0
0
0
0.0
0.0
91
Medusas
17
19
0
0
36
63.1
11.1
21
0
0
0
21
36.9
5.6
57
Quetognatos
0
0
0
0
0
0.0
0.0
21
0
0
16
36
100.0
11.1
36
Larvas
de
equinodermos
0
48
0
48
96
64.6
16.7
37
0
0
16
53
35.4
27.8
149
NI
0
17
24
31
73
36.5
16.7
16
64
16
32
128
63.5
33.3
201
Ostracodos
35
0
0
27
63
36.3
16.7
0
16
0
95
110
63.7
22.2
173
Larvas
de
Eufáusidos
121
72
66
95
353
20.7
55.6
200
283
56
816
1355
79.3
77.8
1708
Apendicularias
0
0
0
0
0
0.0
0.0
367
617
63
642
1689
100.0
72.2
1689
Pterópodos
19
0
0
0
19
4.7
5.6
105
196
16
68
385
95.3
38.9
404
Isópodos
0
37
98
143
277
54.5
33.3
37
79
83
32
231
45.5
44.4
508
Anfípodos
33
0
17
55
105
27.7
16.7
125
51
41
57
273
72.3
50.0
378
Anélidos
0
0
0
0
0
0.0
0.0
16
35
0
0
51
100.0
16.7
51
ϭϴϯ
Total*estación
1090
847
755
1371
4063
4787
5860
2755
6740
20143
24206
Tabla 3. Dominancia (%) y frecuencia (%) de las especies pertenecientes a los taxas más abundantes
colectados durante durante diciembre de 2010 y enero de 2011 todo el periodo de muestreo.
(C): Calyptopis.
(F): Furcilia.
Table 3. Dominance (%) and frequency (%) of species belonging to the most abundant taxa collected
during during
December 2010 and
January
2011 throughout
the sampling
period.
(C): Calyptopis.
(F): Furcilia
Dominancia
(%)
13.3
0.4
7.2
1.6
3.7
55.5
9.9
Especies
Oithona similis
Oithona frigida
Calanoides acutus
Calanus propinquus
Sapphirina. spp
Copepoditos
Fritillaria. spp
Thysanoessa macrura
6.4
(C)
Thysanoessa macrura
2.0
(F)
Frecuencia
(%)
75.0
13.9
63.9
30.6
55.6
75.0
36.1
55.6
27.8
Tabla 4. Análisis de correlación de pearson entre la abundancia (ind./100m3) de las especies dominantes
(>5%) y las variables oceanográficas de temperatura y salinidad.
SAL: Salinidad; TEMP: Temperatura; OS: Ohitona similis; CA: Calanoides acutus; CPP: Copepoditos; FT:
Fritillaria. spp; TMC: Thysanoessa macrura (C).
Table 4. Pearson correlation analysis between abundance(ind./100m3) of the dominant species (> 5%)
and oceanographic
variables of
temperature
and salinity.
SAL:Salinity; TEMP:Temperature; OS: Ohitona similis, CA: calanoidacutus; CPP: copepodites; FT: Fritillari
a. spp
TMC: Thysanoessa macrura (C).
SAL
TEMP
OS
CA
CPP
FT
TMC
SAL
TEMP OS
1.00
-0.64
0.10
1.00
0.54
1.00
CA
0.41
0.57
0.44
1.00
CPP FT
TMC
0.21 -0.73 -0.89
0.38
0.93
0.19
1.00
0.93
0.55
0.52
0.43
1.00
0.44
-0.02
0.38
-0.05
0.61
1.00
ϭϴϰ
E
Figura 1. Área de muestreo y zonas adyacentes
Figure 1. Study area
ĂͿ
ďͿ
ĐͿ
ĚͿ
ĞͿ
ĨͿ
Figura 2. a), b) Temperatura (C°), c), d) Salinidad (psu), e), f) Abundancia de zooplancton (ind./100 m3),
en diciembre de 2010 y enero de 2011en bahía Fildes.
Figure 2. a), b) Temperature (° C), c), d) Salinity (psu), e), f) Abundance of zooplankton (ind./100 m3) in
December 2010 and January 2011 at Fildes bay.
ϭϴϱ
VARIACIÓN TEMPORAL Y ESTACIONAL EN LA
COMPOSICIÓN ISOTÓPICA DE AVES MARINAS
ANTÁRTICAS DE MIGRACIÓN DE CORTA (FAMILIA:
SPHENISCIDAE) Y LARGA DISTANCIA (HYDROBATIIDAE) EN
ISLA ARDLEY, SHETLAND DEL SUR. ANTÁRTICA:
INFERENCIAS DEL CAMBIO CLIMÁTICO SOBRE LOS
HÁBITOS ALIMENTARIOS
Temporal and seasonal variation in isotopic composition of Antarctic
Seabirds of short (Spheniscidae) and long-distance (Hydrobatiidae)
migration at Ardley Island, Antarctic
Negrete P.1, Perona F.1, Sabat P.1, Sallaberry M.1& Quillfeldt P.2
1
Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile, Casilla 653, Santiago, Chile
Max Planck Institute for Ornithology, Vogelwarte Radolfzell, 78315 Radolfzell, Germany, E-mail: [email protected]
2
Drásticas variaciones en la concentración de los hielos marinos y poblaciones de krill
Antártico (especie clave) han afectado la composición de los ecosistemas de la región más
boreal de la Península Antártica en las últimas décadas. Documentándose puntualizadas
variaciones inter-específicas en la migración, distribución y hábitos alimentarios de las aves
marinas, de acuerdo a su mayor dependencia al clima Antártico. Sin embargo, los estudios
de estos parámetros han sido realizados en temporada estival, desconociéndose lo que
ocurre en periodo migratorio.
Por ello, utilizamos el análisis de isótopos estables en los tres pingüinos Pigoscélidos
(migración de corta distancia) y en dos Hidrobátidos (migración de larga distancia) de Isla
Ardley, para determinar las características de la dieta en periodo migratorio (plumas) y
reproductivo (sangre). Además, mediante muestras históricas y las firmas isotópicas de las
principales presas, realizamos un estudio comparativo, analizando el efecto que ha tenido la
reducción del krill sobre las estrategias de forrajeo y la composición alimentaria de las aves
de migración de larga y corta distancia.
En términos generales, se encontraron mayores valores de 13C en la temporada migratoria
histórica, manteniéndose constante o variando levemente la proporción de 15N, tanto en
aves de migración local, como de larga distancia. Mientras que, se observó un
enriquecimiento en los valores isotópicos de la temporada reproductiva.
La disminución de 13C en la temporada migratoria, indica un desplazamiento de los sitios
de forrajeo y por ende de la migración invernal, desde regiones boreales hacia zonas de
mayor dominio Antártico, especialmente en las aves de migración de larga distancia.
Mientras que en la temporada reproductiva, el análisis de composición alimentaria reveló
un menor consumo de krill Antártico. Los resultados de este estudio sugieren que ha
existido una drástica respuesta ecológica en las aves marinas ante las variaciones
ambientales de las últimas décadas.
PALABRAS CLAVES
Aves marinas migratorias, hábitos alimentarios, isótopos estables.
AGRADECIMIENTOS
INACH, FACH, Correos de Chile, Dra. Petra Quillfeldt y Dr. Ronna McGill
ϭϴϲ
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Ainley D., Ballard G., Emslie S., Fraser W.,Wilson P.,Woehler E. 2003. Adelie penguins and
environmental change. Science. 300: 429 - 430
Alonzo S., Switzer P., Mangel M. 2003. Ecological games in space and time: The distribution and
abundance of Antarctic krill and penguins. Ecology. 84 (6): 1598- 1607.
Atkinson A., Siegel V., Pakhomov E., Rothery P. 2004. Long-term decline in krill stock and increase
in salps within the Southern Ocean. Nature. 432: 100 - 103.
Berón M., Coria N., Favero M. 2002. Monitoreo de la dieta post- reproductiva del Pingüino Papua
(Pygoscelis papua) en Isla Laurie (Orcadas del Sur, Antártida): Periodo 1997–1999. Ornitologia
Neotropical. 13: 413 - 422.
Carlini A., Coria N., Santos M., Negrete J., Juares M., Daneri G. 2009. Responses of Pygoscelis
adeliae and P. papua populations to environmental changes at Isla 25 de Mayo (King George
Island). Polar Biol. 32: 1427 - 1433.
Corbisier T., Petti M., Skowronski R., Brito T. 2004. Trophic relationships in the nearshore zone of
Martel Inlet (King George Island, Antarctica): 13C stable-isotope analysis. Polar Biol, 27: 75 - 82.
Emslie S., Patterson W. 2007. Abrupt recent shift in 13C and 15N values in Adélie penguin eggshell
in Antarctica. Proc Nat Acad Sci USA 104:11666 - 11669.
Ferron F., Simões J., Aquino F., Setzer A. 2004. Air temperature time series for King George Island,
Antarctica. Pesquisa Antártica Brasileira 4: 155 - 169.
Harangozo SA, Colwell SR and King JC. 1994. Interannual and long-term air temperature variability
in the Southern Antarctic Peninsula from a reconstructed record for eastern Alexander Island. In:
Sixth Conference on Climate Variations, Nashville. Preprints volume Boston: American
Meteorological Society. 250 - 251.
Hobson K., Clark R. 1992. Assessing avian diets using stable isotopes: I. Turnover of 13C in tissues.
Condor 94: 181 - 188.
Inger R., Bearhop S. 2008. Applications of stable isotope analyses to avian ecology.
Ibis 150: 447 - 461.
IPCC (Intergovernmental Panel Climate Change). 2001a. Climate Change 2001: Impacts, Adaptation
and Vulnerability, Contribution of Working Group II to the Intergovernmental Panel on Climate
Change Third Assessment Report, ed. McCarthy J., Canziani O., Leary N., Dokken D., White K.
Cambridge, UK: Cambridge Univ. Press.
Kejnar M. 2003. Trends of air temperature of the Antarctic during the period 1958 – 2000. Polish
Polar Research. 24 (2): 99 - 126.
King J., Harangozo S. 1998. Climate change in the western Antarctic Peninsula since 1945:
observations and possible causes. Ann Glaciol 27: 571 - 575.
Knox G. 1984. The key role of krill in the ecosystem of the Southern Ocean with special reference to
the Convention on the Conservation of Antarctic Marine Living Resources. Ocean Manag. 9: 113 156.
Loeb V., Siegel V., Holm-Hansen O., Hewitt R., Fraser W. 1997. Effects of sea-ice extent and krill
or salp dominance on the Antarctic food web. Nature 387: 897 - 900
Martínez del Río C., Wolf N., Carleton S., Gannes L. 2009. Isotopic ecology ten years after a call for
more laboratory experiments. Biological Reviews. 84 (1): 91 - 111.
Mayewski P., Meredith M., Summerhayes C., Turner T., Worby A., Barrett P., Casassa G., Bertler
N., Bracegirdle T., Naveira Garabato A., Bromwich D., Campbell H., Hamilton G., Lyons W.,
Maasch K., Aoki S., Xiao C., Van Ommen, T. 2009. State of the Antarctic and Southern Ocean
climate system. Reviews of Geophysics. 47: 1003 - 1029.
McClintock J., Ducklow H., Fraser W. 2008. Ecological Responses to Climate Change on the
Antarctic Peninsula. American Scientist. 96: 302 - 310.
Plan de Gestión de la Zona Antártica Especialmente Protegida Nº 150. Isla Ardley, Bahía Maxwell,
isla Rey Jorge (Isla 25 de Mayo). 2009. Informe Final de la RCTA XXXII. p. 1 – 14.
Quetin L., Robin M., Ross M., Fritsen C., Vernet M. 2007. Ecological responses of Antarctic krill to
environmental variability: can we predict the future?. Antarctic Science. 19 (2), 253 - 266.
ϭϴϳ
•
•
•
•
•
•
Rombolá E., Marschoff E., Coria N. 2003. Comparative study of the effects of the late breaking of
pack ice on Chinstrap and Adelia penguin´s diet and reproductive success at Laurie Island, South
Orkneys Island, Antarctica. Polar Biology. 26: 41 - 48.
Smith R., Ainley D., Baker K., Domack E., Emslie S., Fraser B., Kennet J., Leventer A., MosleyThompson E., Stammerjohn S., Vernet M. 1999. Marine Ecosystem Sensitivity to Climate Change.
Bioscience. 49 (5): 393 - 404.
Valencia J., Sallaberry M. 1983. Censos de pingüinos en isla Ardley (Shetland del Sur). Serie
Científica INACH. 30: 93 - 96.
Vaughan D., Doake C. 1996. Recent atmospheric warming and the retreat of ice shelves on the
Antarctic Peninsula. Nature. 379: 328 - 330.
Volkman N., Presler P., Trivelpiece W. 1980. Diets of Pygoscelid Penguins at King George Island,
Antarctica. Condor 82: 373 - 378.
Woehler E., Croxall, J. 1997. The status and trends of Antarctic and sub-Antarctic seabirds. Marine
Ornithology. 25: 43 - 66.
ϭϴϴ
COMPARACIÓN DEL CONTENIDO DE POLIFENOLES
TOTALES, ACTIVIDAD ANTIOXIDANTE Y AZUCARES DEL
EXTRACTO ACUOSO DE DESCHAMPSIA ANTARCTICA
OBTENIDA IN SITU E IN VITRO
(Comparison of total polyphenol content, antioxidant activity and sugars
of aqueous extract of Deschampsia Antarctica obtained in vitro and in
situ).
Osorio J.1, Bernardo Y.1, Cabrera G.1, Gutiérrez A. 1, 2 & Gidekel M.1
2
1
[email protected] Business School, Faculty of Engineering and Sciences, University Adolfo Ibanez, Santiago, Chile
Faculty of Agricultural and Forestry Sciences, Department of Agricultural Production, Universidad de La Frontera, Temuco, Chile.
The Antarctic continent is considered one of the most primitive ecosystems in the world
with extreme environmental conditions. It is permanently covered by ice and snow,
allowing only 2% of land used for plants (Alberdi et al., 2002). Deschampsia antarctica
Desv. Angiosperm is a vascular plant belonging to the family Poaceae and has naturally
colonized the Maritime Antarctic (Lewis Smith, 2003). This species is adapted to
physiological and biochemical action of various abiotic factors such as radiation, drought,
flooding, salinity and extreme cold at times accompanied by frost and snow (Alberdi et al.,
2002; Barcikowski A et al., 1999; Bravo et al., 2001; Bravo y Griffith, 2005;
Bystrzejewska, 2001; Day et al., 2001; Lewis Smith, 2003; Zuñiga et al., 1996).
Based on these characteristics, the objective of this study was to compare the total
polyphenol content, antioxidant activity and sugars in the aqueous extract obtained from
Deschampsia antarctica conditions in situ and in vitro. The total polyphenol content was
determined using the Folin-Ciocalteu colorimetric method (Singleton et al., 1999) based on
a colorimetric reaction of oxidation-reduction. The antioxidant activity was evaluated by
the DPPH method (Blois, 1958), which measures the ability of antioxidant compounds
present in a sample to catch the stable radical 2,2-diphenyl-1-picrilhidracilo. Finally, the
sugar content was measured using HPLC techniques using equipment DIONEX ICS-3000.
As a result it was found that the highest content of total polyphenols was present in samples
in situ with a 4.28 ± 0.22%, there is a significant difference (p <0.01) compared to samples
in vitro. Similarly, we found that the highest antioxidant capacity of the extract is present in
those samples obtained from plants in situ. In the case of sugar content of the
chromatograms showed differences between the two extracts, both in the chromatographic
profile as observed for concentrations higher sugars content. Studies have shown that the
antioxidant ability of D. antarctica increased by the combination of high light and low
temperature (Perez et al., 2004). On the other hand, during the days of summer this plant
can accumulate a high content of sugars in their leaves (Zuniga et al., 2005), mainly
sucrose and fructans (Bravo et al., 2001). According to the results we can conclude that the
aqueous extract of D. antarctica in vitro has low total polyphenol content, antioxidant
capacity and sugars in their tissues, possibly by the difference in environmental and
nutritional conditions found in both growth conditions.
ACKNOWLEDGEMENTS
INACH, UXMAL S.A., and CTI-Salud (PBCT CTE-06).
ϭϴϵ
REFERENCES
•
•
•
•
•
•
•
•
•
•
Alberdi, M., Bravo, L.A., Gutierrez, A., Gidekel, M., and Corcuera, L.J. 2002. Ecophysiology of
Antarctic vascular plants. Physiol Plant, 115:479-486.
Barcikowski, A., Lyzwtnska, R., and Zarzycki, K. 1999. Growth rate and biomass production of
Deschampsia antarctica Desv. in the Admirality Bay region. South Shetland Islands Antarctica.
Polish Polar Research, 20:(3)301–311.Blois, M.S. 1958. Antioxidant Determinations by the Use of a
Stable Free Radical. Nature, 181: 1199-1200.Bravo, L.A., Ulloa, N., Zuñiga, G.E, Casanova, A.,
Corcuera, L.J. 2001. Cold resistance in Antarctic angiosperms. Physiologia Plantarum, 111: 55-66
Bravo, L.A., and Griffith, M. 2005. Characterization of antifreeze activity in Antarctic plants.
Journal Experimental Botany 56: 1189-1196.
Bystrzejewska, G. 2001. Photosynthetic temperature response of antarctic plant Deschampsia
antarctica and of temperate region plant Deschampsia coespitosa. Polish Journal of Ecology 49:(3)
215 - 219.
Day,T., Ruhland, C., and Xiong, F. 2001. Influence of solar ultraviolet-B radiation on Antarctic
terrestrial plants: results from a 4-year field study. Journal of Photochemistry and Photobiology B:
Biology, 62:78-87.
Lewis Smith, A.R. 2003. The enigma of Colobanthus quitensis and Deschampsia antarcica in
Antarctica. In: Huickes AHI, Gieskes WWC, Schorno RLM, van der Vies SM, Volff WI. Antarctic
biology in a global context, eds. Antarctic biology in a global context. Leiden: Backham Publishers,
234–239.
Perez, E., Garcia, A., Dinamarca, J., Alberdi , M., Gutierrez, A., Gidekel, M., Ivanov, A., Ner, N.,
Corcuera, L.J, and Bravo, L.A. 2004. The role of photochemical quenching and antioxidants in
photoprotection of Deschampsia antarctica. Functional Plant Biology, 31:731-741.
Singleton, V.L., Orthofer, R., and Lamuela-Raventós, R.M. 1999. Analysis of total phenols and
other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. Methods in
Enzymology,152-178.
Zuniga, A., Ort, D., Gutierrez, A., Gidekel, M., Bravo, L.A., and Corcuera, L.J. 2005. Light
regulation of sucrose-phosphate synthase activity in the freezing-tolerant grass Deschampsia
antarctica. Photosynthesis Research, 83:75-86.
Zuñiga, G., Alberdi, M., and Corcuera, L.J. 1996. Non-structural carbohydrates in Deschampsia
antarctica Desv. from South Shetland Islands, Maritime Antarctic. Environmental and Experimental
Botany, 36: 393–398.
ϭϵϬ
EFECTO DE LA BAJA TEMPERATURA Y LUMINOSIDAD EN
LA ACUMULACIÓN DE FRUCTANOS Y EN LA EXPRESIÓN
DE LOS GENES INVOLUCRADOS EN SU BIOSÍNTESIS EN
DESCHAMPSIA ANTARCTICA DESV. IN VITRO
(Effect of low temperature and luminosity on the accumulation of
fructans and in the expression of genes involved in their biosynthesis in
Deschampsia antarctica Desv. in vitro)
Pardo, A1., Zamora, P1., Prieto, H2., Fierro, A3., Pizarro, M1. & Zúñiga, G E1
1
Lab. de Fisiología y Biotecnología Vegetal, Facultad de Química y Biología, Universidad de Santiago de Chile
2
Lab. de Biotecnología INIA CRI-La Platina
3
Departamento de Ciencias del Ambiente, Universidad de Santiago de Chile
Deschampsia antarctica (Poaceae) es la única gramínea que ha colonizado naturalmente el
territorio antártico marítimo1, lugar en donde se encuentra expuesta a una serie de
condiciones ambientales adversas como altos niveles de radiación UV, alta salinidad de los
suelos y bajas temperaturas, condiciones que pueden generar estrés2. Por lo que resulta
evidente que ha tenido que desarrollar mecanismos eficientes de adaptación para hacer
frente a estas condiciones ambientales. Entre los mecanismos de respuesta a bajas
temperaturas se encuentra la acumulación de lípidos y modificación de la composición de
la membrana lipídica; síntesis y acumulación de osmolitos compatibles y azúcares, los que
estarían relacionados con la adquisición de tolerancia a la condición de estrés3.
Se ha descrito que durante el verano antártico, D. antarctica acumula altos niveles de
azúcares como sacarosa y fructanos3. Estos azúcares están relacionados con la capacidad de
la célula para regular su condición osmótica, también pueden tener un efecto protector
frente a radicales libres. Diversos trabajos han mostrado que, la acumulación de fructanos
está asociada al desarrollo de tolerancia a condiciones de bajas temperaturas,
congelamiento y estrés hídrico4,5.
Los fructanos son oligo y polisacaridos constituidos a base de fructosa, se clasifican según
el tipo de enlace glicosídico que presentan en cinco grandes grupos: (a) levan neoseries, (b)
inulinas neoseries, (c) levanes, (d) inulinas y (e) levanes mezclados5.
Las enzimas encargadas de la formación de fructanos son las fructosiltransferasas,
presentes en bacterias, hongos y plantas. En plantas se han identificado 4 tipos de
fructosiltransferasas: sacarosa:sacarosa 1-fructosiltransferasa (1-SST, EC 2.4.1.99),
fructano:fructano 1-fructosiltransferasa (1-FFT, EC 2.4.1.100), sacarosa:fructano 6fructosiltransferasa (6-SFT, EC 2.4.1.10) y fructano:fructano 6G-fructosiltransferasa (6GFFT, EC 2.4.1.243)5.
La acumulación de fructanos en plantas presenta diversas funciones como ser una reserva
alternativa de hidratos de carbono; prevenir la inhibición por feedback negativo de la
fotosíntesis, al controlar la concentración de sacarosa en la célula; ayudar a la protección de
la membrana celular, ya que los fructanos son capaces de insertarse e interactuar con
monocapas y bicapas lipídicas7.
Los fructanos presentan además diversas aplicaciones biotecnológicas como: presentar
propiedades nutraceuticas, prebióticas y no cariogenicas; se pueden utilizar como
endulzantes para personas diabéticas y en reemplazo de grasas8. Por estas razones, existe un
gran interés en identificar especies que sinteticen y acumulen de manera natural altos
niveles de fructanos, además de identificar y caracterizar sus genes y la regulación de éstos.
ϭϵϭ
Se ha descrito que D. antarctica acumula altas cantidades altas de fructanos totales en el
tejido foliar3. El contenido de fructanos totales en D. antarctica puede alcanzar niveles de
hasta 600mg/g de peso seco hacia el final de la temporada estival. En la familia de las
Poaceas, la formación de fructanos ramificados es catalizada por las enzimas 1-SST, 6-SFT
y 1-FFT, mientras que en casos particulares como Lolium perenne utiliza 6G-FFT en vez de
1-FFT5,9. Sin embargo, en D. antarctica las enzimas que participan en la biosíntesis de
estas moléculas son completamente desconocidas, así como la secuencia de los genes y el
grado de activación específica de la ruta de síntesis de fructanos.
MATERIALES Y METODOS
Se utilizaron plantas de D. antarctica cultivadas in vitro en cámaras de cultivo a 14 ºC y
fotoperíodo de 16/8 luz/oscuridad. Para determinar el efecto de las bajas temperaturas y
luminosidad, las plantas fueron sometidas a distintas condiciones de tratamiento. Los
tratamientos aplicados fueron 14 °C con fotoperíodo de 16/8 luz/oscuridad, 14 °C
oscuridad, 4 °C con fotoperíodo 16/8 luz/oscuridad, 4 °C oscuridad y 0 °C oscuridad, los
tratamientos se aplicaron durante un periodo de 96 h.
Se determinación de los perfiles de azucares se mediante técnicas de HPLC-RID utilizando
estándares puros como fructosa, sacarosa, glucosa y 1-kestosa.
Obtención del largo completo del ADNc: se extrajo RNA total de 0,1g tejido foliar con
RNeasy Plant Mini Kit de Qiagen, posteriormente se sintetizo ADNc con M-MLV. Se
diseñaron partidores en zonas conservadas obtenidas a través de alineamientos múltiples de
secuencias de utilizando el programa ClustalW2. Para la amplificación de los genes se
utilizaron diferentes aproximaciones de PCR.
Para los análisis computacionales se utilizaron diferentes bases de datos como ExPASy,
NCBI y CAZY. Para la determinación de las estructuras tridimensionales se utilizaron
programas como MODELLER9v6, VMD y PROCHEK.
La cuantificación de los mRNA fue llevado a cabo mediante un PCR semicuantitativo,
como normalizador se utilizo el gen 18S ribosomal de D. antarctica.
RESULTADOS Y DISCUSIÓN
Para aislar el ADNc de los genes en cuestión se utilizaron técnicas basadas en la PCR y
RACE-PCR, con lo que se obtuvieron fragmentos de distinto tamaño los cuales fueron
unidos in silico, obteniéndose así un largo completo de 1992 pb en el caso de la 1-SST. El
análisis de la secuencia reveló un ORF de 1.890 pb que codifica para un polipéptido de 630
aminoácidos.
La secuencia de aminoácidos deducida del ORF muestra una alta identidad con sacarosa:
sacarosa 1-fructosiltransferasas de plantas pertenecientes a los órdenes de las Asterales (5054%), Asparagales (55-58%) y Poales (70-80%), orden al cual pertenece D. antarctica. La
similitud con el orden de las Poales se incrementa hasta valores entre 80-87 %.
ϭϵϮ
Figura 1. Se muestran los segmentos obtenidos mediante diferentes aproximaciones de PCR. El marco de
lectura abierto (ORF) obtenido consta de 1.890 pares de bases (pb), las que codifican para un polipéptido de
630 aminoácidos.
Para el caso de la 6-SFT se obtuvo un producto de amplificación que corresponde a un
fragmento de 620 pb. Este mostró un 84 % de identidad a nivel nucleotídico con otras
fructosiltransferasas e invertasas de plantas pertenecientes al orden de las Poales. En cuanto
a la fructano: fructano 6G-fructosiltransferasa se obtuvo un producto de amplificación que
corresponde a un fragmento de 385 pb que presenta un 79% de identidad a nivel
nucleotídico con otras fructosiltransferasas e invertasas de plantas pertenecientes al orden
de las Poales.
El análisis del perfil de azucares obtenido mediante HPLC-RID, muestra que hay
diferencias entre los tratamientos. En las plantas control se pudo identificar fructosa,
glucosa, sacarosa, 1-Kestosa (El fructano de menor tamaño, cuyo grado de polimerización
es 3, DP3) y Nystosa (DP4). En las plantas tratamiento se pudo observar una disminución
del contenido de 1-kestosa y nystosa, mientras que se observa un aumento en los
contenidos de sacarosa al ser las plantas tratadas a 4 ºC. El pick de mayor tamaño podría
corresponder a polímeros de hidratos de carbono de mayor tamaño, como por ejemplo
polímeros de fructanos de un mayor grado de polimerización.
Figura 2. Determinación del perfil de azucares mediante HPLC. Se muestra la variación de los diferentes
azucares acumulados por D. antarctica con sus correspondientes tiempos de elusión. La identificación se
realizó mediante la utilización de estándares calidad HPLC.
ϭϵϯ
Para obtener la estructura tridimensional de la 1-SST usando modelamiento molecular se
utilizó una invertasa de pared celular de Arabidopsis thaliana a 2.15 Å de resolución como
templado (código PDB: 2AC1). La evaluación del modelo de la 1-SST involucro análisis de
geometría, estereoquímica y distribución de energía.
Se realizó un docking molecular de la sacarosa utilizando el programa AutoDock 4.0,
estudiando las principales interacciones entre la sacarosa y la 1-SST. Observándose la
formación de puentes de hidrogeno con los residuos Asp19, Asp143 and Glu201
Figura 3. Analisis de modelamiento y docking molecular de la 1-SST. En (A) se muestra el modelo
generado. En (B) se observan las principales interacciones de la enzima con el sustrato.
NIVELES DE TRANSCRITO DE DA_1-SST Y 18S EN TEJIDO FOLIAR DE D.
ANTÁRCTICA.
Plantas de D. antarctica crecidas en condiciones in vitro fueron sometidas a 96h de
tratamiento con fotoperíodo 16h luz / 8h oscuridad. La expresión fue determinada mediante
la técnica de retrotranscripción semicuantitativa con el objeto de evaluar la respuesta de la
planta frente a tratamientos de baja temperatura (Fig. 8).
Figura 3. Se observa la inducción de la expresión del gen 1-SST a medida que disminuye la temperatura.
Se utilizó el gen 18 S como control.
CONCLUSIÓN
A partir de los resultados obtenidos se tiene una mejor comprensión acerca de los genes
involucrados en la síntesis de fructanos en D. antárctica, ya que al obtener el full-lenght
ADNc de la 1-SST y segmentos de los ADNc de 6-SFT y 6G-FFT se puede deducir como
se estructura la ruta biosintetica y que tipo de fructanos generara D. antarctica. Las bajas
temperaturas y luminosidad son factores que modulan tanto la expresión de los genes
involucrados en la síntesis de fructanos como en el tipo de azucares acumulados por la
ϭϵϰ
planta. La información obtenida podría ser utilizada en la transformación de especie de
interés a fin de mejorar su tolerancia a algunos tipos de estrés.
AGRADECIMIENTOS
Proyecto de apoyo de tesis doctoral del Instituto Antártico Chileno, Proyecto D_04-10.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
Komarkova, V. 1990. Additional and revisited sites localities of vascular plants Deschampsia
antarctica Desv. and Colobanthus quitensis (Kunth) Bartl. in the Antarctic Peninsula area. Arctic Alp
Res, 22: 108-113.
Alberdi, M., Bravo, L. A., Gutiérrez, A., Gidekel, M. y Corcuera, L. 2002. Ecophysiology of
Antarctic vascular plants. Physiol Plant, 115: 479-486.
Zúñiga, G., Alberdi, M. y Corcuera, L. 1996. Non-structural carbohydrates in Deschampsia
antarctica desv. From South Shetland Islands, Maritime Antarctic. Environ Exp Bot, 36: 393-399.
Vereyken, I. J., Chupin, V., Demel, R. A., Smeekens, S. C. y Kruijff, B. 2001. Fructans insert
between the headgroups of phospholipids. Biochim Biophys Acta, 1510: 307–320.
Vijn, I. y Smeekens, S. 1999. Fructan: more than a reserve carbohydrate? Plant Physiol, 120: 351–
359.
Henrissat, B. y Davies G. 1997. Structural and sequence-based classification of glycoside hydrolases.
Curr Opin Struct Biol, 7: 637-644.
Vereyken, I.J., Chupin, V., Demel, R.A., Smeekens, S.C.M. y De Kruijff, B. 2001. Fructans insert
between the headgroups of phospholipids. Biochimica Et Biophysica Acta-Biomembranes, 1510:
307-320.
Chappell, J. 1996. Plant biotechnology comes of age - Again. Molecular Breeding, 2: 1-6.
Sprenger, N., Bortlik, K., Brandt, A., Boller, T. y Wiemken, A. 1995 Purification, cloning, and
functional expression of sucrose:fructan 6-fructosyltransferase, a key enzyme of fructan synthesis in
barley. Proc Natl Acad Sci U S A, 92: 11652-11656.
ϭϵϱ
EFECTOS DEL CAMBIO CLIMÁTICO SOBRE EL TAMAÑO
POBLACIONAL DE Pygoscelis adeliae Y Pygoscelis papua: UNA
APROXIMACIÓN MOLECULAR
(Climate change effect over population size of Pygoscelis adeliae and
Pygoscelis papua: a molecular approach)
Peña F1, A. Vianna J2 & Poulin E1
1
Instituto de Ecología y Biodiversidad, Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile
2
Departamentode Ecosistemas y Medio Ambiente, Facultad de Agronomía e Ingeniería Forestal, Universidad Católica
La región Oeste de la Península Antártica (WAP) se ha descrito como una de las tres zonas
que se han visto afectadas, en mayor intensidad, por el rápido calentamiento atmosférico
(Nicholls et al, 1995), experimentado un incremento de su temperatura media en invierno
entre unos 5°C- 6°C en los últimos 50 años (Vaughan et al, 2003; Meredith & King 2005).
Este particular ecosistema se encuentra principalmente regulado por la periodicidad de la
extensión y retroceso del hielo y sus variaciones interanuales, (Vaughan et al, 2003), sin
embargo debido a los cambios en la circulación atmosférica y el aumento del flujo de calor
oceánico durante los períodos estivales, la extensión de la capa de hielo, así como su
concentración y espesor, se han visto significativamente afectados (Meredith & King
2005). Esto ha demostrado presentar consecuencias sobre las interacciones biológicas y
cadenas tróficas, es así como diversos estudios señalan el efecto del calentamiento de la
región sobre depredadores topes, Krill, fitoplancton y bacterias (Clarke et al, 2007).
Diversos autores han planteado al Clima como el principal factor que ha afectado los
patrones de evolución en especies de pingüinos tanto vivos como extintos (Croxall et al,
2002; Forcada et al, 2006; Forcada & Trathan 2009). Se estima que los primeros ancestros
de los taxas modernos habrían aparecido hace alrededor de unos 50 a 70 millones de años, a
fines del Cretácico, comienzo del Eoceno, durante el proceso de separación de Gondwana
(Kooyman, 2002). Estos ancestros, se habrían expandido posteriormente hacia el océano a
través de la corriente circumpolar (Baker et al, 2006) asociados al proceso de enfriamiento
observado durante el Eoceno-Oligoceno. Dos episodios subsecuentes de enfriamiento
habrían generado la formación de plataformas de hielo en la región Antártica, y habrían
permitido la mayor diversificación de pingüinos; un primer evento ocurrido alrededor de 35
Ma y un evento posterior durante el Mioceno medio (aproximadamente 14 Ma), que
habrían dado origen a los grupos más recientes (Baker et al, 2006).
Debido a que la distribución de las diferentes taxas de pingüinos antárticos, están
estrechamente relacionada con la presencia de la capa de hielo, estas especies podrían no
ser capaces de responder rápidamente a los cambios climáticos, afectando su distribución y
fenología (Smith et al, 1999; McCarty, 2001). Dentro de las especies de pingüinos que
habitan el continente antártico, los pingüinos emperador (Apdenodytes forsteri) y Adelia
(Pygoscelis adeliae) son considerados como verdaderas especies antárticas debido a que
presentan historias de vida asociadas a la presencia de hielo (Fraser et al, 1992; Barbraud &
Weimerskirch 2001; Ainley et al, 2010). Mientras que el pingüino Papúa (Pygoscelis
papua), el pingüino Barbijo (Pygoscelis antartica) y el pingüino Macaroni (Eudyptes
chrysolophus) se definen como especies sub antárticas, presentando historias de vida no
asociadas al hielo (Fraser et al,.1992; Ainley et al, 2010).
ϭϵϲ
En las últimas tres décadas se han observado cambios en la composición de la comunidad,
encontrando que las poblaciones de pingüinos dependientes del hielo (Pygoscelis adeliae)
han disminuido, sufriendo un aumento en la mortalidad de sus huevos debido a la nieve y la
pérdida de plataforma de hielo que permite la migración a zonas ricas en Krill (Wilson et
al, 2001; Ducklow et al, 2007, McClintock et al, 2008), mientras que aquellas cuya historia
de vida no es sincrónica con el hielo habrían aumentado (Pygoscelis papua y Pygoscelis
antartica) (Ainley et al, 2010, Carlini et al, 2009).
Este estudio propone, mediante la amplificación de la región hipervariable del ADN
mitocondrial (HVRI), determinar de qué manera se ha visto afectada la diversidad genética
de las poblaciones de P. adeliae y P. papua, debido a los eventos de cambio climático
pasados y de esta manera poder proponer un escenario frente al cambio actual. Se amplifico
la región Hipervariable I (HVRI) del ADN mitocondrial, empleando los partidores LtRNAGlu y H-Dbox descritos por Roeder et al, 2002. Se analizaron las relaciones
genealógicas entre haplotipos. Finalmente se calcularon los tamaños efectivos y se buscó la
señal de cambios poblacionales pasados a través de análisis de inferencia demográfica.
A pesar de mostrar una disminución rápida de sus poblaciones en la Península antártica,
nuestros primeros resultados muestran que P. adeliae presenta una alta diversidad genética,
reflejando la existencia de grandes poblaciones en el pasado. Además, se detectó una señal
de una expansión poblacional después del Último Máximo Glacial.
Agradecimientos: Instituto Antártico Chileno (INACH), Instituto Ecología y Biodiversidad
(IEB)
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
Ainley, D., Russell, J., Jenouvrier, S., Woehler, E., Lyver, P., Fraser, W. & Kooyman, G. 2010.
Antarctic penguin response to habitat change as Earth’s troposphere reaches 28C above preindustrial
levels. Ecological Monographs. 80:49-66.
Baker, A., Pereira, S., Haddrath, O. & Edge, K. 2006. Multiple gene evidence for expansion of
extant penguins out of Antarctica due to global cooling. Proceedings of The Royal Society. 273:1117.
Barbraud, C. & Weimerskirch, H. 2001. Emperor penguins and climate change. Nature. 411:183186.
Carlini, A., Coria, N., Santos, M., Negrete, J., Juares, M. & Daneri, G. 2009.Responses of
Pygoscelis adeliae and P. papua populations to environmental changes at Isla 25 de Mayo (King
George Island). Polar Biology. 32:1427-1433.
Clarke, J., Ksepka, D., Stucchi, M., Urbina, M., Giannini, N., Bertelli, S., Narváez, Y. & Boyd, C.
2007. Proceedings of the National Academy of Sciences. 104:11545-11550.
Croxall, J., Trathan, P. & Murphy, E. 2002. Environmental Change and Antarctic Seabirds
populations. Science. 297:1510-1514.
Ducklow, H., Baker, K., Martinson, D., Quetin, B., Ross, R., Smith, R., Stammerjohn, S., Vernet, M.
& Fraser, W. 2007. Marine pelagic ecosystems: the West Antarctic Peninsula. Philosophical
Transactions of the Royal Society. 362:67-94.
Forcada, J., Trathan, P., Reid, K., Murphy, E. & Croxall, P. 2006. Contrasting population changes in
sympatric penguin species in association with climate warming. Global Change Biology. 12:411423.
Forcada, J. & Trathan, P. 2009. Penguin responses to climate change in the Southern Ocean. Global
Change Biology. 15:1618-1630.
Fraser, W., Trivelpiece, W., Ainley, D. & Trivelpiece, S. 1992. Increases in Antarctic penguin
populations: reduced competition with whales or a loss of sea ice due to environmental
warming?.Polar Biology. 11:525-531.
Kooyman, G. 2002. Evolutionary and ecological aspects of some Antarctic and sub-Antarctic
penguin distributions. Oecologia. 130:485-495.
ϭϵϳ
•
•
•
•
•
•
•
•
McCarty, J. 2001. Ecological consequences of recent climate change. Conservation Biology.15:320331.
McClintock, J., Ducklow, H. & Fraser, W. 2008. Ecological responses to climate change on the
Antarctic Peninsula. American Scientist. 96:302–310.
Meredith, M. & King, J. 2005. Rapid climate change in the ocean west of the Antarctic Peninsula
during the second half of the 20th century. Geophysical Research Letters. 32:1-5.
Nicholls, N., Gruza, G., Jouzel, J., Karl, T., Ogallo, L. & Parker, D. 1995. Observed climate
variability and change. In: Climate Change 1995. The Science of Climate Change. Contributions of
Working Group I to the Second Assessment Report of the Intergovernemental Panel on Cliamte
change. [Houghton, J.T., L.G. Meira Filho, B.A. Callander, N. Harris, A. Kattenberg & K. Maskell
(eds)]. Cambridge University Press, Cambridge, U.K, and New York, USA.
Smith, R., Ainley, D., Baker, K., Domack, E., Emslie, S., Fraser, B., Kennett, J., Leventer, A.,
Mosley, E., Stammerjohn, S. & Vernet, M. 1999. Marine Ecosystem Sensitivity to Climate Change.
BioScience. 49:393-404.
Vaughan, D., Marshall, G., Connolley, W., Parkinson, C., Mulvaney, R., Hodgson, D., King, J.,
Pudsey, C. & Turner, J. 2003. Recent rapid regional climate warming on the Antarctic Peninsula.
Climate Change.60:243-274.
Wilson, P., Ainley, D., Nur, N., Jacobs, S., Barton, G. Ballard, G. & Comiso, J. 2001. Adélie
penguin population change in the pacific sector of Antarctica: relation to sea-ice extent and the
Antarctic Circumpolar Current. Marine Ecology progress series. 213:301-309.
ϭϵϴ
FLAVOBACTERIAS CULTIVABLES ASOCIADAS A
SUPERFICIES DE MACROALGAS PRESENTES EN
ANTÁRTICA Y SU POTENCIAL BIOTECNOLÓGICO
(Culturable Flavobacteria associated to seaweed surfaces in Antarctica
and their biotechnological potential).
Pérez, J.1, Gimpel, C.1, Lavín, P.1, 2 & Gonzalez, M.1
1
Instituto Antártico Chileno (INACH), 2 Fundacion Ciencia y Cultura Biociencia
La bioincrustación es ubicua en el medio marino y las bacterias se encuentran entre los
primeros organismos en ocupar las superficies disponibles, formando biofilms que sirven
como un foco para la fijación y crecimiento de otros organismos. Las macroalgas son
extremamente susceptibles a la epibiosis debido a que su superficie provee un hábitat rico
en nutrientes (Bouvy et al. 1986, Armstrong et al. 2001). La mayoría de los metabolitos
primarios como carbohidratos, amino acidos, péptidos y proteínas son inductores para la
colonización microbial (Steinberg et al. 2002) proporcionando un micronicho protegido y
favorable para el crecimiento y reproducción bacterial (Beleneva & Zhukova 2006,
Mahmud et al. 2007). Debido a que las presiones ecológicas, incluyendo la competencia
por el espacio durante el “biofouling” de la superficie, la predación, y la reproducción
exitosa permiten la evolución de compuestos metabolitos secundarios únicos con diferentes
actividades biológicas (Ireland, et al 2000), los microorganismos marinos han recibido cada
vez mas la atención como una fuente de nuevos compuestos y enzimas que son
relativamente más estables y activas que las correspondientes derivadas de plantas o
animales (Donia y Hamann, 2003; Stach, 2010; Kin, 2006; Bull, et al 2000). Basado en
estas consideraciones, el aislamiento del continente antártico y los factores físicos
“extremos”, tales como alta radiación UV y baja temperatura pueden haber funcionado
como presión selectiva responsable por el surgimiento de bacterias que presenten rutas
metabólicas únicas con enzimas y compuestos de interés biotecnológico. Las proteínas y las
enzimas de organismos marinos pueden no solo contribuir significativamente a la
biotecnología industrial, sino que también apoyar el desarrollo de nuevos procesos en la
industria alimentaria. Proteasas, amidasas, lipasas y enzimas de degradación de
polisacáridos (quitinasas, alginatoliasas, agarasas, carrageenasas y hidrolasas de celulosa)
han sido el principal foco de investigación de enzimas marinas (Zhang y Kim, 2010). Sin
embargo sólo un número limitado de estos biocatalizadores se han aislado y caracterizado
bioquímicamente. En algunos casos, su actividad solo se ha optimizado vía ingeniería de
proteínas (Sarkar et al., 2010).
El objetivo del presente estudio fue evaluar la disponibilidad de bacterias epibiontes, con
actividad antimicrobiana o capaces de degradar ficocoloides, presentes en la superficie de
las macroalgas Porphyra columbina (Rhodophyta) y Adenocystis utricularis (Pheophyta)
del intermareal de la Bahía Fildes (Isla Rey Jorge, Shetland del Sur - Antártica).
Los muestreos fueron realizados en dos sitios escogidos en función de su aislamiento,
colectando 4 muestras de algas (replicas) por sitio. Se aislaron cepas bacterianas mediante
cultivo en medio mínimo selectivo R2A sólido (diluido al 10% donde la principal fuente de
carbono es el agar), las cuales fueron caracterizadas morfológicamente para generar un
índice de diversidad de bacterias cultivable. La determinación de actividad antimicrobiana
se realizó por medio de la técnica Agar Spot Test (Fleming et al, 1975) utilizando como
ϭϵϵ
target Staphylococcus aureus y E. Coli, mientras que la actividad agarolitica se evidenció
por la formación de una depresión alrededor de las colonias. Para aquellas cepas que
presentaron actividad agarolitica también se realizaron ensayos de degradación enzimática
utilizando el método de cuantificación de azucares reductores por medio de la técnica del
DNS (Miller, 1959) usando como substratos agarosa, alginato y tejido de Macrocystis
pyrifera pulverizado. Las cepas que presentaron actividad de interés fueron analizadas por
medio de la técnica de RFLP y posteriormente identificadas vía secuenciación del gen
ribosomal 16S.
Un total de 120 cepas fueron aisladas a partir de P. columbina y A. Utricularis, donde la
única actividad detectada correspondió a la hidrólisis sobre el agar del medio de cultivo por
parte del 15,8% de las cepas. La diversidad de bacterias cultivables total no presento
diferencias significativas entre P. Columbina y A. utricularis, solo tendencias numéricas
más altas para P. Columbina. Solo se observaron diferencias significativas entre los sitios
de muestreo (Fig.1).
Figura 1. Diversidad de bacterias cultivables observada por alga y sitio de muestreo.
El análisis de ANOSIM indicó que las similitudes entre la composición de bacterias cultivadas está
determinada principalmente por la especie de alga epifitada (R=0,503, p=0,002) que por el sitio de
muestreo (R=0,417, p=0,007). Estos resultados concuerdan con los descritos en literatura (Goecke,
et al 2010) y probablemente esté ligado a las diferencias relacionadas con los ficocoloides
constituyentes de cada especie de macroalga, así como a sus estrategias “antifouling”. El análisis
filogenético a partir de la secuenciación parcial del gen ribosomal 16S, indicó que el 100% de las
cepas que presentaron actividad agarolítica pertenecen al género Flavobacterium y formarían un
grupo específico relacionado al grupo de las F. Frigidarium (Figura 2). A pesar de que los
métodos de cultivo dependiente posean grandes cesgos para realizar estudios ecológicos, nuestros
resultados concuerdan con estudios moleculares y de cultivo previos donde sugieren que las
Flavobacterias al estar estrechamente asociadas con el fitoplancton pueden, por ejemplo, colonizar
macroalgas aprovechando los nutrientes exudados durante la fotosíntesis (Glockner et al, 1999;.
Grossart, 1999; Brown & Bowman, 2001). Además, a pesar de haber sido secuenciado apenas
representantes del 15,8% de las cepas, las abundancias encontradas se aproximan a las esperadas
para el continente antárctico donde se encuentran haciendo parte del 19-70% del bacterio-plancton
total (Glockner et al, 1999).
ϮϬϬ
Figura 2. Analisis filogenetico construido mediante el método de Maximum likelyhood con bootstrap de
100, utilizando un alineamiento de 862 posiciones de pares de bases.
El hecho de haber encontrado bacterias con actividad agarolíticas pertenecientes
exclusivamente al género de Flavobacteria llama la atención dado que en trabajos
anteriores, realizados por el laboratorio, donde se aislaron bacterias con actividad
agarolitica a partir de Porphyra sp. en descomposición se observó también la presencia de
otros taxa como Bacillus sp, Pedobacter sp., Psychrobacter sp., Sporosarcina sp.
Del total de las 15 cepas que fueron secuenciadas se escogieron las dos más activas,
provenientes de cada alga, para ser caracterizadas fisiológicamente así como también la
actividad del sobrenadante del cultivo contra distintos sustratos. Ambas cepas presentan
característica de crecimiento psicrofilo con tasa de crecimiento máximo cercano a los 15°C.
El análisis de actividad de degradación de polisacáridos resultó positivo al detectar azucares
reductores cuando se utilizó como sustrato la agarosa, alginato y la Macrocystis pyrifera
pulverizada. Además, también se observó una correlación positiva entre la actividad y el
aumento de esta en función de la temperatura. En particular, Cytophaga-Flavobacterias son
organismos quimio-organotróficos y son especialmente competentes en la degradación de
varios biopolímeros tales como celulosa, quitina y pectina (Kirchman, 2002). Del punto de
vista ecológico las Flavobacteria son reconocidas por su importante papel en los procesos
de remineralización en el océano dada su capacidad de descomposición de complejos
disueltos y materia orgánica particulada (Cottrell y Kirchman, 2000;. Davey et al, 2001),
por lo tanto los resultados encontrados concuerdan con la versatilidad y capacidad de este
grupo en colonizar sustratos con distintas fuentes de polisacáridos. Sin embargo, surgen
pregunta acerca de cómo están realmente están constituidas las comunidades bacterianas
presentes en Porphyra columbina y Adenocystis utricularis y que posibles implicancias
ϮϬϭ
podrían tener las Flavobacterias en un ensenario de calentamiento global con enzimas que
pueden aumentar su actividad a mediada que sube la temperatura de los océanos.
Desde el punto de vista biotecnológico, debido que la mayoría de las enzimas agarolíticas
han sido obtenidas principalmente a partir de géneros tales como Pseudomonas, Vibrio,
Microbulbifer sp. y Thalassomonas entre otras (Fu & Kim, 2010) y teniendo en cuenta la
enorme biodiversidad de los microorganismos marinos asi como la brecha en nuestro
conocimiento, se torna importante realizar estudios comparativos con nuevas enzimas
extraidas a partir de Flavobacterias. Por otro lado la capacidad de hidrolizar distintos
ficocoloides observada en el sobrenadante estudiado resulta interesante para el pais cuando
se considerara la gran disponibilidad de biomasa algal existente en Chile, principalmente en
la region de Magallanes con respecto a Macrocystis pyrifera, que podrían, entre tantas
otras, ser aplicada en la producción desde alcoholes para uso en biocombustible, hasta la
producción de moléculas antioxidantes a partir de ficocoloides (Sulfahri, et al 2011, Wu, et
al 2005).
AGRADECIMIENTOS
Al proyecto INNOVA-Corfo “Antártica: Fuente de recursos biotecnológicos para chile”, a
la Fundación Biociencia y al Instituto Antártico Chileno, Correos de Chile, y la Fuerza
Aérea de Chile.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
Armstrong E, Yan L, Boyd KG, Wright PC and Burgess JG (2001) The symbiotic role of marine
microbes on living surfaces. Hydrobiologia 461:37–40
Beleneva IA and Zhukova NV (2006) Bacterial communities of some brown and red algae from
Peter the Great Bay, the Sea of Japan. Microbiology (NY) 75:410–419
Bouvy M, Le Romancer M and Delille D (1986) Significance of microheterotrophs in relation to the
degradation process of subantarctic kelp beds (Macrocystis pyrifera). Polar Biol 5:249–253
Brown, M. V. and Bowman, J. P. (2001). A molecular phylogenetic survey of sea-ice microbial
communities (SIMCO). FEMS Microbiol Ecol 35, 267-275.
Bull, A.T.; Ward, A.C. and Goodfellow, M. (2000) Search and discovery strategies for
biotechnology: The paradigm shift. Microbiol. Mol. Biol. Rev., 64, 573–606.
Cottrell, M. T. and Kirchman, D. L. (2000). Natural assemblages of marine proteobacteria and
members of the Cytophaga-Flavobacter cluster consuming low- and high-molecular-weight
dissolved organic matter. Appl Environ Microbiol 66, 1692-1697.
Davey, K. E., Kirby, R. R., Turley, C. M., Weightman, A. J. and Fry, J. C. (2001). Depth variation of
bacterial extracellular enzyme activity and population diversity in the northeastern North Atlantic
Ocean. Deep-sea Res Part II 48, 1003-1017.
Donia, M. and Hamann, M.T. (2003) Marine natural products and their potential applications as antiinfective agents, Lancet Infect Dis 3 , pp. 338–348
Fleming, H. Etchells, J. and Costilow, R. 1975. Microbial inhibition by an isolate of Pediococcus
from cucumber brines. Applied Microbiology, 30(6):1040-1042.
Fu, X. and Kim, S. (2010). Agarase: Review of Major Sources, Categories, Purification Method,
Enzyme Characteristics and Applications. Marine Drugs, 8, 200 – 218.
Glocckner, F. O., Fuchs, B. M. and Amann, R. (1999). Bacterioplankton compositions of lakes and
oceans: a first comparison based on Fluorescence in situ hybridization. Appl Environ Microbiol 65,
3721-3726.
Goecke Franz, Antje Labes, Jutta Wiese and Johannes F. Imhoff (2010) Chemical interactions
between marine macroalgae and bacteria. Marine Ecology Progress Series Vol. 409: 267–300
Grossart, H. P. (1999). Interactions between marine bacteria and axenic diatoms (Cylindrotheca
fusiformis, Nitzschia laevis, and Thalassiosira weissflogii) incubated under various conditions in the
lab. Aquat Microb Ecol 19, 1-11.
ϮϬϮ
•
•
•
•
•
•
•
•
•
•
•
Ireland CM, Copp BR, Foster MP, McDonald LA, Radisky DC and Swersey JC. (2000) Bioactive
compounds from the sea. In: Martin RE Carter EP Davis LM, eds. Marine and freshwater products
handbook. Lanceaster. PA: Technomic Publishing, 641–61.
Kin, S.L. (2006) Discovery of novel metabolites from marine actinomycetes. Curr. Opin. Microbiol.
, 9, 245–251.
Kirchman, DL. (2002). The ecology of Cytophaga–Flavobacteria in aquatic environments.
FEMS Microbiology Ecology , 39: 91–100.
Mahmud ZH, Neogi SB, Kassu A, Wada T, Islam MS, Nair GB and Ota F (2007) Seaweeds as a
reservoir for diverse Vibrio parahaemolyticus populations in Japan. Int J Food Microbiol 118:92–96
Miller, G.L. (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal.
Chem. 31 (3): 426-428
S. Sarkar, A. Pramanik, A. Mitra and J. Mukherjee (2010) Bioprocessing data for the production of
marine enzymes, Mar Drugs 19 , 1323–1327.
Stach, J.E. Antimicrobials: treasures from the ocean, Microb Today (2010), pp. 104–109
Steinberg PD, de Nys R (2002) Chemical mediation of colonization of seaweeds surfaces. J Phycol
38:621–629
Sulfahri, Siti Mushlihah, Eko Sunarto, M.Yusuf Irvansyah, Renia Setyo Utami and Sarwoko
Mangkoedihardjo (2011) Ethanol Production from Algae Spirogyra with Fermentation by
Zymomonas mobilis and Saccharomyces cerevisiae J. Basic Appl. Sci. Res. 1(7): 589-593
Wu, S.C. T.-N. Wen, and C. L. Pan, 2005, Algal-oligosaccharide-lysates Prepared by Two Bacterial
Agarases Stepwise Hydrolyzed and their Anti-oxidative Properties. Fisheries Science, 71: 1147–
1157
Zhang C. and S.K. Kim (2010) Research and application of marine microbial enzymes: status and
prospects, Mar Drugs 8 , pp. 1920–1934.
ϮϬϯ
CONCENTRACIÓN DE LAS ESPECIES QUÍMICAS MÁS
ABUNDANTES EN LOS AEROSOLES TROPOSFÉRICOS FINOS
COLECTADOS EN EL EXTREMO NORTE DE LA PENÍNSULA
ANTÁRTICA
(Concentration of the Most Abundant Chemical Species in Tropospheric
Fine Aerosols Collected in the Northern Tip of the Antarctic Peninsula).
Préndez, M.1, Wachter, J.2, Correa, R.4, Donoso, N.2, Martínez, J.1, Flocchini, R.5, Wakabayachi, P.5 &
Morales, J.R.3
1Universidad de Chile: 1Facultad de Ciencias Químicas y Farmacéuticas
2
Facultad de Ciencias Físicas y Matemáticas
3
Facultad de Ciencias
4
Universidad Tecnológica Metropolitana, Departamento de Física
5
Universidad de California, Davis.
Fine airborne particulate matter of 3µm or less, were collected in two sites in the Northern
tip of the Antarctic peninsula in the summer periods of years 2006, 2007 and 2008. Total
mass concentrations were in the range from 1,61 to 8,39 µ g/m3, about 4,6-25% of typical
concentration measured in Santiago, and within the same order of magnitude found in fine
aerosols from Alaska. Non destructive physical methods allowed the identification of six
elements with major concentrations (Si, S, Cl, K, Ca, Fe) and 37 other chemical species
(elements, ions and cations).
INTRODUCCIÓN
Hasta hace unos años la Antártica se consideraba el último lugar prístino de la Tierra y el
más remoto aunque no aislado ya que la dinámica atmosférica facilita el movimiento de
masas de aire desde diferentes continentes hacia la Antártica. Investigaciones recientes han
mostrado claros indicios de contaminación antropogénica (WMO, 1991; Tin et al. 2009)
Por lo tanto, es de gran interés la información que se genere acerca de la intervención
humana sobre los aerosoles atmosféricos troposféricos finos del extremo norte de la
península antártica, dado que dichos aerosoles se vinculan fuertemente al transporte de
larga distancia, así como a las fuentes locales antropogénicas. Dicha información es aún
escasa y en algunos casos bastante antigua (Rojas et al., 1992; Artaxo et al., 1992).
Investigaciones más recientes se refieren a partículas totales (Mishra et al., 2004), las cuales
suelen tener un comportamiento diferente al del aerosol fino. En este trabajo se presentan
algunos resultados relevantes obtenidos en los últimos años para aerosoles finos por el
grupo multidisciplinario de investigadores de diferentes universidades de Chile y el
extranjero.
MATERIALES Y MÉTODO
Los aerosoles atmosféricos se colectaron en dos áreas de estudio: la península Fildes, isla
Rey Jorge (área más “contaminada”, 62º07'-62º14'30” S y 58º50'-59º00' O) y la península
Antártica, en las cercanías de la Base chilena B. O´Higgins (área “prístina”, 63º19'26" S y
57º51'15" O) sobre diferentes sustratos de acuerdo al requerimiento del equipo de muestreo
y de su posterior análisis de elementos químicos y especies iónicas.
En Rey Jorge se utilizaron dos muestreadores diferentes: un impactador de cascada que
fracciona el material particulado fino PM3 en 6 fracciones y un equipo TEOM MP2,5 que
integra todo el material 2,5 µ m y entrega información en línea de la concentración de
ϮϬϰ
aerosol. En la península Antártica el muestreador IMPROVE PM 2,5 se ubicó a unos 2,5
km de la Base O´Higgins. A falta de suministro energético convencional el equipo se
energizó con paneles solares y baterías, a fin de evitar posibles contaminaciones por el uso
de un generador de electricidad accionado con combustible fósil.
El material colectado en los veranos de los años 2006, 2007, 2008 y 2010 se caracterizó por
masa total de material particulado, concentraciones de los elementos mayores, menores y
traza y de aniones y cationes; esto permitió avanzar en el conocimiento de la importancia
relativa de las fuentes naturales y antropogénicas de las distintas especies químicas
estudiadas, sobre la calidad del aire.
Para las cuantificaciones se utilizaron técnicas analíticas multielementales químicas, físicas
y nucleares: espectroscopía de masa con plasma acoplado inductivamente (ICP-MS),
cromatografía iónica (CI), microscopía electrónica de barrido (SEM), fluorescencia de
rayos X (FRX), emisión de rayos X inducidos por partículas cargadas (PIXE), emisión de
rayos gama inducidos por partículas cargadas (PIGE). Con el objeto de determinar las
concentraciones elementales en espectros PIXE se diseñaron sistemas neuronales
artificiales (SNA) obtenidos desde muestras de aerosoles antárticos. Los SNA operan en
línea y tiempo real en los experimentos PIXE para aerosoles (Correa et al., 2006, 2008).
RESULTADOS
Los resultados del análisis gravimétrico (cuadro 1) muestran diferencias entre las
concentraciones de la península antártica y las de la península Fildes en la isla Rey Jorge en
la época actual. Sin embargo, las concentraciones determinadas en la isla por los dos
muestreadores están dentro del mismo rango, aunque diferenciadas de las concentraciones
en la isla, separadas por más de una década. La diferencia entre las concentraciones en
península Fildes y Bahía Almirantazgo también podría atribuirse al tiempo transcurrido,
dando cuenta en ambos casos de un incremento en las concentraciones del aerosol fino que
alcanza al extremo norte de la Antártica en un proceso incipiente de contaminación del aire
de la península Fildes.
Cuadro 1. Concentración del material particulado fino de la isla Rey Jorge y del extremo norte de la
península antártica en la época de verano (Fine Airborne Particulate Matter Concentration of King George
Island and Northern Tip of the Antarctic Peninsula, Summer Period).
Alimentación
Concentración
aerosol, µ g/m3
Península Antártica
MP2,5
Baterías recarga solar
1,608 ± 0,792*
Isla Rey Jorge
MP2,5
Tradicional
(en línea)
5,3 ± 3,1**
Isla Rey Jorge
MP3 fraccionado
Tradicional
8,39 ± 2,82***
4,28 ± 0,41****
Isla Rey Jorge
MP <2 µ m
Tradicional
2,21*****
* Promedio veranos 2006-2007 (Préndez et al, 2009)
**Promedio verano 2010
***Promedio verano 2007 (J.Martinez, 2011)
**** Promedio verano 1995 (V.Muñoz, 1996)
***** Verano 1985 Base brasilera (Artaxo et al, 1992)
ϮϬϱ
El cuadro 2 muestra las cuantificaciones de especies químicas efectuadas: 25 elementos
mediante FRX en la Universidad de California (Davis), 7 elementos por PIXE en la
Universidad de Chile y 20 elementos mediante ICP-MS en los laboratorios de Sernageomin
en Santiago. Los 13 iones (5 cationes y 8 aniones) se cuantificaron en el Centro Nacional
del Medio Ambiente. También se señala la contribución relativa al aerosol de las diferentes
especies estudiadas. Es importante destacar que las distintas técnicas físicas
multielementales utilizadas son no destructivas de modo que permiten los diferentes
análisis sobre las mismas muestras. Los elementos identificados por PIXE se cuantificaron
además mediante la metodología de las SNA.
El cuadro 3 muestra una comparación de las concentraciones elementales en los aerosoles
antárticos y de Alaska.
Cuadro 2. Equipos muestreadores y especies químicas cuantificadas en el extremo norte de Antártica
(Sampler Equipment and Chemical Species Quantify in the Northern Tip of the Antarctic Peninsula).
Alimentación
Técnica
cuantificación
Elementos/iones
mayoritarios
(µ g/m3decenas
ng/m3)
Elementos/iones
minoritarios
(ng/m3- centésimas
ng/m3)
Península Antártica
PM2,5, IMPROVE
Baterías recarga solar
FRX
Península Antártica
PM2,5, TEOM
Baterías recarga solar
PIXE
Isla Rey Jorge
PM3, Impactador inercial
Tradicional
ICP, CI
Na, Mg, S, Cl, K, Ca,
Fe, Zn
S, Cl, K, Ca, Fe,
Si, Ti, V, Cr, Mn, Ni,
Cu, Pb, Se, Br, Rb, Sr
Si, Zn
Na, Mg, P, Mn, Fe, Zn, Br,
Sr, Cr, Ni, Cu, Mo, Sn, Ba,
Pb,/ Cl-, SO4=, NO3-, K+,
Ca+2
V, Co, Rb, Y, La, Hf, Ce,/
NO2-, F-, Br-, MSA, HCOO-
Cuadro 3. Concentraciones de algunos elementos en aerosoles antárticos y de Alaska (Elemental
Concentrations of Antarctic and Alaska Aerosols).
WĞŶşŶƐƵůĂ
^ŝŵĞŶŽĨΎdƵdžĞĚŶŝΎΎ
ŶƚĄƌƚŝĐĂ
ůĂƐŬĂ
>ƵŐĂƌ
WƌŽŵĞĚŝŽƐ
ͲͲͲͲͲͲͲͲͲͲͲͲͲͲŶŐͬŵϯͲͲͲͲͲͲͲͲͲͲͲͲͲ
njƵĨƌĞ
ϭϮϮ͕Ϯ
ϮϬϬ͕ϯ
ϭϬϴ͕Ϭ
ĂůĐŝŽ
ϭϴ͕ϭ
ϭϵ͕ϵ
ϵ͕ϭ
,ŝĞƌƌŽ
ϭϮ͕ϯ
ϯ͕ϲ
ϰ͕ϲ
Las concentraciones elementales en los aerosoles antárticos se encuentran en el orden de
WŽƚĂƐŝŽ
ϭϱ͕Ϯ
ϮϬ͕ϯ
ϭϯ͕ϲ
magnitud de las observadas en Alaska con un equipo muestreador IMPROVE de similares
características y una
cuantificaciónϵ͕ϲ
mediante FRX.
^ŝůŝĐŝŽ
ϭϯ͕ϱDe las muestras
ϭϵ͕ϲ obtenidas en la Base
O'Higgins en el verano del año 2007, el espectro de rayos X característicos del método de
análisis PIXE de laůŽƌŽ
0714 se presenta
en la figura ϱϯϭ͕ϱ
1.
ϱϮϮ͕ϲ
ϭϭϵ͕Ϭ
ϮϬϲ
Coordenadas:*55,34' N, 160,48' W y ** 59,99' N, 152,63' W
En el gráfico se destacan los elementos mayoritarios. El ajuste del espectro fue realizado
con el software GUPIX (Campbell et al., 2000). Tomando en cuenta los valores de los
parámetros experimentales de irradiación y características del blanco, GUPIX determina las
concentra-ciones.
Las concentraciones calculadas con la metodología de las SNA mostraron también una
buena coincidencia con aquellas obtenidas por la metodología experimental PIXE. Se
efectuó una intercomparación de las concentraciones de los elementos es S, Cl, K, Ca, Fe y
Zn, presentes en todas las muestras analizadas, para los cuales la sensibilidad de ambas
técnicas es adecuada, encontrándose un buen acuerdo en los resultados obtenidos. Los SNA
representan una metodología no tradicional de tratamiento de datos con alta no linealidad
que permiten avanzar en un proceso de automatización del cálculo de las concentraciones
elementales.
DISCUSIÓN Y CONCLUSIONES
La cuantificación de las concentraciones elementales mediante PIXE es comparable con la
efectuada mediante el sistema con FRX implementado en la U. de California. La
implementación en Chile de los SNA es un avance importante en la automatización para la
obtención de resultados del análisis espectral de PIXE. Este avance reviste especial
importancia para la cuantificación elemental de los aerosoles colectados a lo largo de todo
el año mediante el muestreador en línea, TEOM, instalado en la isla Rey Jorge.
El material colectado en los años 2010 y 2011, está en proceso de análisis por estos y otros
métodos, tales como: retrodispersión elástica de Rutherford (RBS) y PIGE, para estas
ϮϬϳ
últimas técnicas con la colaboración del Centro de Micro-Análisis de Materiales (CEMAM)
de la Universidad Autónoma de Madrid y microscopía electrónica de transmisión (TEM) de
la Universidad de Chile.
AGRADECIMIENTOS
Proyectos INACH 04/03 y T_0207, al Centro Nacional del Medio Ambiente (CENMA), al
Sr, Carlos Saul de la empresa Ambiente y Tecnología.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
Artaxo, P., Rabello, M., Maenhaut, W., Grieken, R. 1992. “Trace metals and individual particle
analysis of atmospheric aerosol from the Antarctic Peninsula”, Tellus 44B, 318-334.
Campbell, J. L., Hopman, T. L., Maxwell, J. A., Nejedly, Z. 2000. “The Guelph PIXE software
package III: Alternative proton database”, Nuclear Instruments and Methods in Physics Research B
170, 193-204.
Correa, R., Chesta, M. A., Morales, J. R., Dinator, M. I.,. Requena, I,. Vila, I. 2006. ¨Artificial neural
networks applied to quantitative elemental analysis of organic material using PIXE¨. Nuclear
Instruments and Methods in Physics Research B 248/2, 324-328
Correa, R., Dinator, M. I., Morales, J. R., Miranda, P. A., Cancino, S. A., Vila, I., Requena, I. 2008
“Improvement in the determination of elemental concentrations in PIXE analyses using artificial
neural system”. International Journal of PIXE (IJPIXE) Vol 18, 147-155
Martínez, J., 2011. “Aerosoles antárticos finos fraccionados: Composición iónica y su vinculación
con la extensión de hielo marino”. Memoria de título de Químico, Carrera de Química, Facultad de
Ciencias Químicas y Farmacéuticas, U. de Chile.
Mishra, V.K., Ki-Hyun Kim, Sungmin Hong, Khanghyun Lee 2004. “Aerosol composition and its
sources at the King Sejong Station, Antarctic Peninsula”, Atmospheric Environment, 38, 4069–4084.
Muñoz, V. P. 1996. “Interrelaciones estratósfera-tropósfera-superficie de los aerosoles atmosféricos
de la isla Rey Jorge, Peninsula Antártica”. Memoria de título de Químico, Carrera de Química,
Facultad de Ciencias Químicas y Farmacéuticas, U. de Chile
Préndez, M., Wachter, J. Vega, C., Flochini, R., Wakayabashi, P., Morales, J.R. 2009. “PM 2.5
Aerosols Collected in the Antarctic Peninsula with a Solar Powered Sampler during Austral Summer
Periods”. Atmospheric Environment 43, 5575–5578.
Rojas, C.M., Van Grieken, R.E.., and Cantillano, M.E. 1992. “Study of Antarctic Aerosol using Xray Fluorescence and Single Particle Analysis”. Serie Científica INACH 42:37-45.
TIn, T., Fleming, Z., Hughes,K., Ainley, D., Convey, P., Moreno, C., S. Pfeiffer, S., Scott, J., and
Snape, I. 2009. “Review Impacts of local human activities on the Antarctic environment. Antarctic
Science (21) 1: 3–33.
WMO 1991. Scientific Assessment of Ozone Depletion. Scientific Report Nº 25.
ϮϬϴ
ESPECTROS DE BIOMASA DEL MACROBENTOS
ANTARCTICO: UNA APROXIMACION ALOMETRICA PARA
ESTUDIAR LAS PERTURBACIONES POR ICEBERGS
(Biomass spectrum of Antarctic macrobenthos: anallometric approach to
study disturbances caused by icebergs)
Quiroga E.1, Gerdes D.2, Montiel A.3,4 & Knust R.2
1
Pontificia Universidad Católica de Valparaíso (PUCV), Escuela de Ciencias del Mar, Casilla 1020, Valparaíso,
[email protected]
2
Alfred Wegener Institute for Polar and Marine Research, Columbusstrasse, D-27568 Bremerhaven, Germany
3
Instituto de la Patagonia, Universidad de Magallanes, Av.Bulnes #01855, Casilla113-D, Punta Arenas, Chile
4
Centro de Estudio del Cuaternario Fuego-Patagónico y Antártica (CEQUA), Punta Arenas, Chile.
INTRODUCCION
Las perturbaciones por icebergs sobre los fondos marinos tienen un importante impacto
sobre el ecosistema Antárctico, controlando la estructura y diversidad de las comunidades
bentónicas marinas (e.g. Gerdes et al., 2003;Gutt&Piepienburg, 2003). Este tipo de
perturbación natural de gran escala también puede afectar el funcionamiento de estos
ecosistemas, en particular en el escenario del cambio climático (Coyle et al., 2007). En este
contexto, el estudio de la estructura de tamaños del bentos representa actualmente una
aproximación científicamente valiosa en diferentes áreas de la ecología acuática y permite
realizar un enfoque más dinámicopara entender cómo funcionan las comunidades marinas
(ver Kerr&Dickie, 2001).El presente trabajo de investigación, tiene como objetivo principal
describir la estructura de tamaños del macrobentos antárctico mediante una aproximación
alométrica basada en espectros normalizados de tamaño – biomasa, y evaluar el grado de
perturbación de las comunidades bentónicas marinas Antárcticas en el Mar de Weddell a
través de un experimento de simulación artificial de perturbación sobre el fondo.
MATERIALES Y METODOS
Durante diciembre del 2003, se llevó a cabo un experimento de recolonización de largo
termino denominado BENDEX (BenthicDisturbanceExperiment) en la costa este del Mar
del Weddell, Antárctica (Expedición ANT XXI-2, Arntz& Brey, 2005; Gerdes et al., 2008).
En esa oportunidad, se simuló el efecto de perturbación del arrastre de fondo de los
icebergs sobre el piso marino a través de redes de arrastre en un área aproximada de 100 x
1000 m (sitio BENDEX). El fondo marino fue posteriormente estudiado después de 11 días
con el fin de evaluar los efectos sobre las características de los sedimentos y las
comunidades bentónicas. En el 2011 se visitó esta región para evaluar el grado de
recuperación de las comunidades bentónicas durante la expedición CAMBIO (Expedición
ANT XXVII-3, Change in Antarctic Marine Biota) a bordo del Buque científico
rompehielos R/V Polarstern. Las muestras de sedimentos fueron recolectadas mediante un
multiple saca-testigos guiado mediante un sistema de video de alta resolución (Gerdes et
al., 1990, 2008). Las muestras fueron separadas del sedimento mediante tamices geológicos
(> 500µm), etiquetada y almacenada en formalina neutralizada al 4%. Los modelos de
espectros de tamaños se construyeron siguiendo la metodología propuesta por Quiroga et
al. (2005, 2011) y las comparacionesentre las pendientes se realizaron de acuerdo a Zar
(1984).
ϮϬϵ
RESULTADOS Y DISCUSION
Los resultados indicaron que las características físicas y químicas de los sedimentos no
mostraron cambios significativos, pero mientras que las comunidades bentónicas si se
vieron afectadas en diversas formas (Gerdes et al., 2008). Las biomasas se vieron reducidas
en un factor de 10, mientras que las abundancias de las comunidades bentónicas reflejaron
cambios menores, estas respuestas probablemente estén relacionadas con la composición
faunística de las comunidades Antárcticas en este sector del Mar de Weddell, la cual está
dominada principalmente por esponjas y equinodermos (Gerdes et al., 2008).La estructura
de tamaños de las comunidades bentónicas en el área de estudio fue similar a lo descrito
para otros ecosistemas (e.g. Drgas et al., 1998; Saiz-Salinas & Ramos, 1999; Quiroga et al.,
2005, 2011; Akoumianaki et al., 2006; Wang et al., 2010). Además, nuestros resultados
muestran un patrón similar a lo descrito por Saiz-Salinas & Ramos (1999) para la península
antárctica, siendo las pendientes relacionadas con la productividad del sistema. La
estructura de tamaño muestra un patrón espacial muy consistente, siendo el intercepto y la
pendiente del modelo útil para describir a este tipo de comunidades. De hecho, el intercepto
(Log2 a) del modelo desarrollado es considerado un indicador de biomasa, mientras que la
pendiente (b) es una medida de la estructura de tamaños de la comunidad (Quiroga et al.
2005, 2011). Nuestros resultados muestran que la pendiente más negativa fue registrada
para el modelo correspondiente al sitio BENDEX (b = -0.521; EE = 0.147), mientras que en
el Mar de Weddell la pendiente fue cercana a b = -0.439 (EE = 0.128). Estos resultados
indican un predominio de animales con un menor tamaño corporal en el sitio BENDEX,
probablemente asociado a la perturbación. Una comparación con otras regiones de la
Antárctica muestra valores similares de intercepto y pendiente (b = -0.335; EE = 0.126)
para comunidades bentónicas en el plataforma de Larsen, pero cuando se realiza una
comparación con comunidades bentónicas en áreas más profundas de Larsen, se distinguen
una similar estructura de tamaño (b=-0.338; EE = 0.285), pero con menores valores de
intercepto (Log2a = -3.316). Este último resultado coincide con las menores biomasas
bentónicas reportadas en el área de estudio(Gutt et al., 2011).Cabe señalar que estos
resultados muestran que las comunidades bentónicas en términos de su estructura de
tamaños presentan un patrón muy conservativo y estable. Se espera que los resultados
obtenidos durante la expedición CAMBIO 2011, nos aporten nuevos antecedentes
científicos que nos permitan dilucidar aspectos relacionados con los procesos de
recuperación de las comunidades bentónicas por efectos de perturbación por icebergs y
discutir sobre la capacidad de resiliencia y/o resistencia de estas comunidades.
ϮϭϬ
TABLAS Y FIGURAS.
Tabla 1. Información sobre las estaciones de muestreo.
Expedición
ANT XXVII-3
Estación
274
275
279
280
283
285
288
289
293
295
297
310
Fecha
25.03.2011
25.03.2011
28.03.2011
28.03.2011
29.03.2011
29.03.2011
30.03.2011
30.03.2011
31.03.2011
31.03.2011
31.03.2011
05.04.2011
Lat S
70°
56.58
70°
56.42
70°
56.22
70°
56.63
70°
58.00
70°
56.75
70°
56.56
70°
56.77
70°
56.57
70°
56.63
70°
56.60
70°
47.23
Long W
10°
34.27
10°
31.62
10°
30.33
10°
32.08
10°
30.30
10°
32.40
10°
31.86
10°
32.33
10°
31.91
10°
32.01
10°
31.63
10°
45.11
106
105
116
124
125
185
197
201
183
187
199
202
693
700
701
703
704
715
718
722
725
706
709
10.12.2003
10.12.2003
11.12.2003
11.12.2003
11.12.2003
17.12.2003
18.12.2003
18.12.2003
17.12.2003
17.12.2003
18.12.2003
18.12.2003
05.01.2007
11.01.2007
12.01.2007
13.01.2007
14.01.2007
18.01.2007
19.01.2007
21.01.2007
22.01.2007
15.01.2007
15.01.2007
70°
56.64
70°
56.50
70°
56.81
70°
56.40
70°
56.40
70°
56.61
70°
56.29
70°
56.26
70°
56.53
70°
56.60
70°
56.74
70°
56.54
63°
25.48
65°
55.18
65°
56.33
65°
33.01
65°
30.58
65°
06.46
65°
08.05
64°
41.16
64°
55.67
65°
26.10
65°
26.10
10°
32.03
10°
32.01
10°
32.87
10°
31.74
10°
31.56
10°
31.65
10°
30.33
10°
33.00
10°
31.70
10°
32.02
10°
32.25
10°
31.84
55°
31.68
60°
19.74
60°
25.12
61°
37.05
61°
41.50
60°
45.17
60°
45.97
60°
32.70
60°
37.36
61°
26.53
61°
26.53
ANT XXII-2
ANT XXIII-8
Profundidad (m)
Region
333
Weddell Sea Shelf
283
BENDEX
250
Weddell Sea Shelf
261
BENDEX
284
Weddell Sea Shelf
307
BENDEX
288
BENDEX
303
BENDEX
285
BENDEX
303
BENDEX
276
BENDEX
630
Weddell Sea Shelf
BENDEX
304
BENDEX
298
BENDEX
321
BENDEX
290
BENDEX
283
BENDEX
294
BENDEX
253
BENDEX
322
Weddell Sea Shelf
301
Weddell Sea Shelf
303
Weddell Sea Shelf
311
Weddell Sea Shelf
289
274
446
383
299
356
321
328
202
280
850
850
Nro. Testigos
7
8
7
7
7
7
7
7
0
6
7
0
8
6
6
6
6
6
6
4
4
6
6
6
4
Larsen S helf
Larsen Shelf
Larsen Shelf
Larsen Shelf
Larsen Shelf
Larsen Shelf
Larsen Shelf
Larsen Shelf
Larsen Shelf
Larsen Deep
Larsen Deep
9
9
6
7
9
4
4
9
9
9
Tabla 2. Parámetros de regresión para los espectros de tamaño – biomasa normalizado en
el área de estudio.
Region
Weddell Sea Shelf
BENDEX site
Larsen shelf
Larsen deep
Expedición
ANT XXI/2
ANT XXI/2
ANT XXIII/8
ANT XXIII/8
2
2
Prof. (m) Abundancia (N/m ) Biomasa (g/m )
253 - 322
139 ± 228 41.06 ± 190.92
289 - 311
136 ± 247
4.49 ± 9.82
202 - 446
110 ± 376
9.86 ± 28.80
850
65 ± 166
4.37 ± 12.44
Log2a
-1.090
0.102
-1.870
-3.316
Pendiente
-0.439
-0.521
-0.335
-0.338
Err. Est.
0.128
0.147
0.126
0.285
r2
0.49
0.58
0.39
0.19
valor p
p = 0.005
p = 0.006
p = 0.022
p = 0.27
Ϯϭϭ
-30°
-30°
0°
30°
-15°
0°
-60°
-45°
Atlantic Ocean
60°
-60°
-90°
-90°-80°-70°-60°
90°
-65°
BENDEX
-120°
120°
-150°
180°
150°
-70°
-60°
-75°
15°
-80°
-75°
30°
-75°
-60°
-45° -30° -15° 0° 15° 30°
1:9866214 at Latitude 90°
Fig. 1.Scale:
Mapa
del área de estudio señalando los sitios donde se obtuvieron los testigos de
fondo para describir la estructura de tamaños del macrobentos.
4
Log 2 (Biomass/ ∆ weight)
2
0
-2
-4
-6
-8
-10
-12
-4
-2
0
2
4
6
8
10
12
14
Log2 size-class
16
18
20
22
Weddell Sea Shelf
BENDEX site
Larsen Shelf
Larsen Deep
Fig. 2. Espectros de tamaño - biomasa normalizadoen el área de estudio. (1) Mar de
Weddell, (2) sitio BENDEX, (3) plataforma de Larsen y (4) Larsen profundo. Modelo: log2
Y = log2 a + b log2 X.
ϮϭϮ
FINANCIAMIENTO
Proyecto INACH T25-10; Instituto Alfred Wegener (AWI) Alemania.
REFERENCIAS BIBLIOGRAFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Akoumianaki, I., Papaspyrou S. yNicolaidou. A. 2006. Dynamics of macrofaunal body size in a
deltaic environment. Marine Ecology Progress Series 321, 55–66.
Arntz, W. E. yBrey T. 2005. The Expedition ANTARKTIS XXIl2 (BENDEX) of RV "Polarstern" in
2003-2004. Ber.Polarforsch.Meeresforsch.503:149.
Coyle, K., Konar K., Blanchard A., Highsmith R., Carroll J., Carroll M., Denisenko S., Sirenko B.
2007. Potential effects of temperature on the benthic infaunal community on the southeastern Bering
Sea shelf: Possible impacts of climate change. Deep-Sea Res. 54: 2885-2905.
Drgas, A., Radziejewska T. yWarzocha J. 1998.Biomass size spectra of near-shore shallow-water
benthic communities in the Gulf of Gdansk (Southern Baltic Sea). Marine Ecology 19, 209–228.
Gerdes, D.1990. Antarctic trials with the multibox corer, a new device for benthos sampling. Polar
Records 26:35–38.
Gerdes, D, Isla E., Knust R., Mintenbeck M., Rossi S. 2003. Response of Antarctic benthic
communities to disturbance: First results from the artificial Benthic Disturbance Experiment on the
eastern Weddell Sea Shelf, Antarctica. Polar biology 31:1469-1480.
Gerdes, D., Isla E., Knust R., Mitenbeck K. y Rossi S. 2008. Response of Antarctic benthic
communities to disturbance: First results from the artificial Benthic Disturbance Experiment on the
eastern Weddell Sea Shelf, Antarctica. Polar Biology 31, 1469-1480.
Gutt, J. yPienpenburg D. 2003.Scale-dependent impact on diversity of Antarctic benthos caused by
grounding of icebergs. Marine Ecology Progress Series 253: 77–83.
Gutt, et al., 2011. Biodiversity change after climate-induced ice-shelf collapse in the Antarctic. Deep
Sea Res. II. 58: 74-83.
Kerr, S. yDickie L. 2001.The biomass spectrum.A predator-prey theory of aquatic production,
Columbia University Press.
Quiroga, E, Quiñones R., Palma M., Sellanes J., Gallardo V., Gerdes D. yRowe G. 2005.Biomasa
size-spectra of macrobenthic communities in the oxygen minimum zone off Chile. Estuarine, Coastal
and Shelf Science, 62, 217-231.
Quiroga, E., Ortiz P., Reid B., Villagrán S., Gerdes D. y Quiñones R. 2011.Spatial patterns of
macrobenthic communities in the Baker Fjord (Chile, Northern Patagonia) and their relationships to
environmental factors. Journal of Marine Biological Association of the United
Kingdom.doi:10.1017/S0025315411000385.
Saiz-Salinas, J. y Ramos A. 1999. Biomass size-spectra of macrobenthic assemblages along water
depth in Antarctic. Marine Ecology Progress Series, 178, 221-227.
Wang, R., Yuan L. y Zhang L. 2010.Impacts of Spartinaalterfiflora invasion on the benthic
communities of salt marshes in the Yangtze Estuary, China. Ecological Engineering 36: 799–806.
Zar, J.1984.Biostatistical Analysis, second ed. Prentice-Hall, Englewood Cliffs, NY, 718 pp.
Ϯϭϯ
INTERACCIONES POSITIVAS ENTRE EL LIQUEN USNEA
ANTARCTICA (USNEACEAE) Y LA FLORA ANTARTICA EN LA
ISLA REY JORGE, SHETLAND DEL SUR
(Positive interactions between the lichen Usnea antarctica (Usneaceae)
and the Antarctic flora in the King George Island, South Shetland)
Ricote N.1, Muñoz-Ramírez C.2, Gómez-González S.3, Torres-Díaz C.3, Salgado-Luarte C.4, Valladares F.5 &
Gianoli E.4, 6, 7 & Molina-Montenegro M. A.8*
1
Facultad de Ciencias Biológicas, Departamento de Ecología Pontificia Universidad Católica de Chile. Santiago, Chile
Departamento de Zoología, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción, Casilla 160-C, Chile
3
Laboratorio de Genómica y Biodiversidad (LGB), Departamento de Ciencias Básicas, Facultad de Ciencias, Universidad del Bío-Bío,
Chile
4
Departamento de Biología, Universidad de La Serena, Casilla 599 La Serena, Chile. 5Instituto de Recursos Naturales, Centro de Ciencias
Medioambientales, CSIC, Madrid, Spain
6
Departamento de Botánica, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción, Casilla 160-C, Chile
7
Center for Advanced Studies in Ecology and Biodiversity (CASEB), P. Universidad Católica de Chile, Santiago, Chile
8
Centro de Estudios Avanzados en Zonas Áridas (CEAZA), Facultad de Ciencias del Mar, Universidad Católica del Norte. Larrondo
1281, Coquimbo, Chile
2
Questions. Positive interactions will become dominant in stressful environments (Bertness
et al. 1994, Brooker et al. 1998, Calaway et al. 1997). Antarctica is among the most
extreme environments for plant life worldwide, due to severe abiotic stresses (IPCC 2007,
Robinson et al. 2003). Are positive plant-plant interactions more frequent than negative
interactions in Antarctic ecosystems? Are microclimatic modifications by cushions of
Usnea antarctica responsible for the main nurse effect? Is the survival of Deschampsia
antarctica enhanced when is associated to the U. antarctica cushions? (Bruno et al. 2003,
Greene et al. 1971, Krna et al. 2009)
Locations. King George Island, South Shetland, Antarctica.
Methods. To determine whether positive interactions between a lichen and other plant
species predominate over negative interactions along Maritime Antarctica, we evaluated
whether U. antarctica, one of the most abundant lichen, is a nurse species (Tirado et. al
2003) by measuring how frequently other species growth associated with this species and
by comparing the survival percentage of D. antarctica growing associated to U. antarctica
and alone. In addition, we evaluated how the presence of U. antarctica affect microclimatic
conditions (temperature, nutrients availability and soil moisture).
Results. We found that 5 out of 14 species were more frequently associated with U.
antarctica microhabitat than to bare ground. When data from both sites were pooled
together other three species were shown to be positively associated with U. antactica. Only
one species (U. aureant) showed negative association with U. antarctica. Survival
percentage of D. antarctica was significantly higher when growing associated to U.
antarctica than growing alone.
Conclusions. Overall, our results show that U. antarctica cushions ameliorate
microclimatic conditions, creating suitable microhabitats with respect to bare soils,
allowing lichen and mosses to increas abundances and survival of D. antarctica, suggesting
a strong facilitative effect on Antarctic flora. Our findings indicate that Antarctic
Ϯϭϰ
communities are mainly structured by positive biotic interactions (Chapin et al. 1995) and
that U. antarctica is a key component of the Antarctic landscape to maintain the abundance
and richness observed in these environments. Finally we conclude that this nurse effect by
lichens will be core if vascular plants continue colonizing and expanding due to ice melting
induced by global warming.
Keywords. Antarctica; Deschampsia Antarctica; Facilitation; Global warming; Mosses;
Nurse effect
AKNOWLEDGMENTS.
Agradecemos a Fernando Carrasco-Urra y Natalia Ricote-Martínez por su ayuda en el
terreno. Agradecemos la ayuda logística y financiera del Instituto Antártico Chileno
(INACH project T-14-08).
REFERENCES.
•
•
•
•
•
•
•
•
•
•
Bertness, M. & Callaway, R.M. 1994. Positive interactions in communities. Trends in Ecology and
Evolution 9: 191–193.
Brooker, R.W. & Callaghan, T.V. 1998. The balance between positive and negative plant
interactions and its relationship to environmental gradients: a model. Oikos 81: 196-207.
Bruno, J.F., Stachowicz, J.J. & Bertness, M.D. 2003. Inclusion of facilitation into ecological theory.
Trends in Ecology and Evolution 18: 119–125.
Callaway, R.M. & Walker, L.R. 1997. Competition and facilitation: a synthetic approach to
interaction in plant communities. Ecology 78: 1958–1965.
Chapin, F.S., Shaver, G.R., Giblin, A.E., Nadelhoffer, K.J. & Laundre, J.A. 1995. Response of
Arctic tundra to experimental and observed change in climate. Ecology 76: 694–711.
Greene, D.M. & Holtom, A. 1971. Studies in Colobanthus quitensis (Kunth) Bartl. & Deschampsia
antarctica Desv. III. Distribution, habitats and performance in the Antarctic botanical zone. British
Antarctic Survey 26: 1–29.
I.P.C.C. 2007. Intergovernmental panel on climate change. http://www.ipcc.ch
Krna, M.A., Day, T.A. & Ruhland, C.T. 2009. Effects of neighboring plants on the growth and
reproduction of Deschampsia antarctica in Antarctic tundra. Polar Biology 32: 1487-1494.
Robinson, S.A., Wasley, J. & Tobin, A.K. 2003. Living on the edge – plants and global change in
continental and maritime Antarctica. Global Change Biology 9: 1681-1717.
Tirado, R. & Pugnaire, P.I. 2003. Spatial shrub aggregation and consequences for reproductive
success. Oecologia 136: 296-301
Ϯϭϱ
RECENT GLACIOLOGICAL SURVEYS IN THE INTERIOR OF
WEST ANTARCTICA
Rivera, A.1,2, Zamora, R.1 & Uribe, J.1
1
Centro de Estudios Científicos, CECs, 2.- Universidad de Chile
Crevasse detection and snow bridges thickness measurements are important topics of
research for safety reasons during Antarctic traverses. The inspection and analysis of
satellite imagery (RADARSAT and ASTER) are crucial to detect zones were crevasses are
located, allowing planning secure routes. These routes need to be checked on the ground,
and some areas need to be surveyed with sensors capable of penetrating the upper snow
layers covering the crevasses, in order to identify hidden crevasses (Rivera et al, 2010).
In recent years, several new routes have been opened and surveyed CECs in West
Antarctica (Figure 1), including the track to South Pole in 2004, and several profiles at and
nearby Union Glacier (79 º 46' S / 83º 24' W), the main hub for airplane operations in this
part of Antarctica, managed by the private company Antarctic Logistics and Expeditions
(ALE). Tractors and convoys (Photo 1)where equipped with dual frequency GPS receivers
and radar systems, with the main aim of detecting crevasses, measuring surface snow
accumulation and determining ice thicknesses. The last three seasons measurements
included the route between Patriot Hills and Union Glacier, several glaciers nearby Union,
and a new route to the upper plateau where Subglacial Lake Ellsworth (SLE) is located.
Figure 1. West Antarctica location map. Photo 1. Convoy used in recent campaigns.
The main purpose of these studies is mapping surface and subglacial topography of the ice
sheet, including the internal structure of the ice as well as detecting hidden crevasses near
the glacier surface. The collected data have also been used to estimate the present state of
the ice sheet and ice streams, the stability of the ice divides and the location of subglacial
lakes, like Subglacial Lake Ellsworth (Vaughan et al, 2009) where the British Antarctic
Ϯϭϲ
Survey BAS, and scientists from different universities are planning to drill until collecting
water samples in 2012.
METHODS
Remote Sensing: Before the field campaign, detailed mapping of the area was undertaken
using ASTER satellite imagery, in order to detect and map possible crevasses along the
tracks, allowing planning safe routes.
GPS: Dual frequency Javad GPS model Lexon GD receivers were used for positioning the
convoy along the surveyed tracks, allowing the determination of time and co-ordinates each
few seconds (Rivera et al, 2010).
Crevasse radar. The used system was a GPR GSSI SIR 3000 and a transducer model 5103
at 400 MHz central frequency. The transducer includes shielded dipole pairs, transmitter
and receiver. The antennae were polarized orthogonally to the transect directions. Data
were recorded in 16 bit format, using 1024 samples per scan. The range was set at 86 ns
(corresponding approximately to 8 m on the ground) to record subsurface reflection. At the
front of the snow tractor was installed a 7 m long rod with a rubber tire tube installed at the
tip (Photo 1). Inside this tire was located the transducer, which was connected by co-axial
cable to the receptors operated by one CECS scientist seated into the cabin next to the
driver. With this distance, and operating at slow velocities (between 2 and 5 m s-1), the
operator was able to advert the driver of the presence of something wrong on the screen (a
discontinuity, or a crevasse at the ice) with few seconds before being on top of the detected
feature (Zamora et al, 2007). This alert system worked generally well, allowing the driver
to stop and check the possible crevasse. In some cases, where the speed was higher or the
slope was steeper, the lapse time was not enough, meaning that the driver was instinctively
speeding up to avoid falling down into a possible crevasse.
Snow accumulation radar: The FMCW radar was developed by CECs to measure snow
accumulation and the internal layer of the ice at high resolution. This radar operates at
frequencies from 550 to 900 MHz, using two separated log periodic antennae for the
transmitter and receiver. The free-space resolution was 40 cm, the transmit power was 21
dBm, the intermediate frequency (IF) amplifier gain was 70 dB and the whole system
operated at a PRF 10 kHz. A Direct Digital Synthesis (DDS) system was used to generate
an extremely linear frequency sweep transmitted signal. A maximum snow accumulation of
70 m was detected at Union Glacier, and the blue ice / snow layers boundaries were clearly
mapped down to 20 m.
Ice thickness radar. A pulse compression radar depth sounder (ULUR-5.0) was designed
and built by CECs for cold ice thickness measurements. The radar operates at a central
frequency of 155 MHz, a bandwidth of 20 MHz, a sample rate of 100 MHz and 200 W of
peak power. An eight element Yagi antennae were used for both the transmitter and
receiver. These data can be correlated with surface crevasses and related to subglacial
topography changes.
RESULTS
A total profile length of more than 165 km was surveyed around Union Glacier in 2010,
where several crevasse zones were mapped, allowing ALE to design safe routes along this
Ϯϭϳ
region. Most of these crevasses were buried by snow bridges from 0.5 to more than 2 m
thick, most of them having widths between 1 and 2 m.
The radar survey from Union Glacier to the Antarctic Plateau where SLE is located
collected 80 km of data along Union, Schanz, Schneider and Balish Glaciers (Figure 2),
where a maximum ice thickness of 1600 m and a snow accumulation of 70 m were detected
(around Union Glacier base camp the radargram showed a 30 m of snow accumulation). In
other traverses, maximum thicknesses of 2300 m were detected.
Figure 2. Surveyed profile in 2010 (80 km) between Union Glacier, Schanz Glacier, Schneider Glacier,
Balish Glacier and Driscoll Glacier, along the way to the upper plateau (A).
The route from the Union Glacier to the Antarctic Plateau is almost totally free of
crevasses, however, some areas were detected with cracks and also with crevasses which
were mapped and signalled to avoid accidents.
Most of the detected crevasses are located at the junction between different ice flow bodies.
Sometimes, a glacier is flowing from a small lateral valley toward Union glacier, and at its
junction, there is a moraine line indicating the two ice bodies moving together. In other
cases, there is no moraine, but a topography inflection with steeper slopes (Figure 3).
Generally speaking, any of these junctions could allocate crevasses, because the intervening
ice bodies are flowing at different velocities, the ice thickness could be very different, and
Ϯϭϴ
because the immediately above junction slope could be very different, generating lateral
stresses resulting in crevassing.
Figure 3. Crevasses at Union Glacier without surface topographic corrections.
CONCLUSIONS
The GPR survey around Union Glacier and along the track to the Antarctic Plateau allowed
the detection of many more crevasses than were previously mapped with the ASTER
imagery. All of these additional crevasses were covered by snow, and even with knowledge
of their location, they could not be distinguished on the satellite imagery. The 400 MHz
GPR is capable of identifying in real time surface and buried crevasses, which are
characterized by distortions and diffractions in the upper firn layers of the glaciers. GPR
and FMCW were compared, yielding similar results however, the FMCW radar did not
provide the best information of snow bridge thicknesses because it has not enough
resolution for the first meters of the snow pack. Most of the widest crevasses were found in
the steepest parts of the route. The maximum ice thickness measured in recent years
reached 2300 m at the Horseshoe valley, near Patriot Hills.
ACKNOWLEDGEMENTS
CECs, ALE, GLIMS.
REFERENCES
•
•
Rivera, A., R. Zamora, C. Rada, J. Walton and S. Proctor, 2010. Ice dynamics of Union Glacier in
the Ellsworth Mountains, West Antarctica. Annals of Glaciology, 51(55): 91-96.
Vaughan, D. G., A. Rivera, J. Woodward, H. F. J. Corr, J. Wendt, and R. Zamora (2007).
Topographic and hydrological controls on Subglacial Lake Ellsworth, West Antarctica. Geophys.
Res. Lett., 34, L18501,doi:10.1029/2007GL030769.
Ϯϭϵ
•
Zamora, R., G. Casassa, G. Neira, L. Araya, A. Rivera and R. Mella., 2007. Crevasse detection in
glaciers of Southern Chile and Antarctica by means of ground penetrating radar. IAHS Publ., 318:
153-162.
ϮϮϬ
¿FLUJO HIDROTERMAL EN EL MONTE SUBMARINO ORCA?
(Hydrothermal flux in the Orca Seamount?)
Rodrigo, C. 1, Blamey, J. 2, Huhn, O.3 & Provost, C. 4
1
Instituto Antártico Chileno, Departamento Científico; Punta Arenas, Chile
2
Fundación Biociencia, Santiago, Chile
3
Universidad de Bremen, Bremen, Alemania
4
Université Pierre et Marie Curie, LOCEAN, Paris, Francia
INTRODUCCIÓN
Para comprender el impacto de la actividad hidrotermal sobre los océanos se requiere una
aproximación multidisciplinaria que permita entender los procesos tanto físicos como
biogeoquímicos. La zona de rift de Bransfield, situado en el estrecho Bransfield, Antártica,
es tectónica y geológicamente única, donde interactúa un proceso de subducción y uno de
separación de placas en forma simultánea, no existiendo a la fecha claridad en su evolución
geológica (Barker y Austin, 1994; Fretzdorff et al., 2004; Solari et al., 2008). El
descubrimiento de la actividad hidrotermal que difiere al de las dorsales mesooceánicas
(e.g. no existencia de fumarolas ni de organismos típicos) en algunos de los edificios
volcánicos del rift, demuestran que es una zona activa especial (Klinkhammer et al., 1995;
Bohrmann et al., 1998; Dahlman et al., 2001; Klinkhammer et al., 2001; Petersen et al.,
2004).
Lawver et al. (1995) realizaron mediciones oceanográficas al interior del monte submarino
Orca, el cual es uno de los edificios volcánicos del rift del Bransfield, para comprobar su
actividad hidrotermal, sin embargo, no encontraron evidencias que lo probaran. Debido al
conocimiento de reciente actividad sísmica en las cercanías del monte Orca (Robertson
Maurice et al., 2003), la cual es asociada a actividad magmática, motivó para iniciar una
exploración del volcán y comprobar su actividad hidrotermal, la cual serviría como
antecedente para futuros estudios sobre la interacción de flujos hidrotermales sobre aguas
muy frías.
METODOLOGÍA
Durante el crucero ANT-XXV/4 a bordo del R/V “Polarstern”, en abril de 2009,
mediciones con CTD y de muestreo de agua fue llevado a cabo sobre el monte Orca
(Estacion A) y fuera de él (estación B) (Fig. 1). El agua de mar fue colectada por botellas
Niskin de 12 l montada sobre una roseta SeaBird SBE 32 equipada con CTD Sea-Bird
Electronics SBE911 plus. Al CTD se le agregó un sensor de oxígeno SBE 43, un sensor de
transmisión de luz (WetLabs C-Star, 660 nm de longitud de onda) y un fluorómetro
(Chelsea Aquatracka). Con los datos de temperatura se calculó su anomalía según la
metodología de Baker et al. (2002). También se analizaron muestras para obtener el
contenido de gases nobles según la metodología de Sultenfuss et al. (2009). Para el análisis
de gases nobles además se consideró la estación de referencia “R” cuyos datos fueron
obtenidos durante el crucero ANT-XIII/4 en el R/V "Polarstern" en 1996.
Para el análisis microbiológico, en ambas estaciones las muestras fueron tomadas a tres
niveles desde el fondo usando las botellas Niskin y fueron mantenidas a 4°C en recipientes
estériles. Para crecer los organismos se usaron técnicas similares a las presentadas por
Summit y Baross (1998), quienes las utilizaron para aguas próximas al eje de dorsales
ϮϮϭ
meso-oceánicas. Se realizó microscopía fluorescente para una muestra de cada cultivo
principal.
Figura 1. Área de estudio y el monte submarino Orca. Se indican las posiciones de las estaciones “A” y
“B”, y de “R” respecto del monte Orca.
RESULTADOS Y DISCUSIÓN
Los perfiles de temperatura potencial y salinidad para ambas estaciones son similares,
mostrando las características típicas hidrográficas de la zona (Fig. 2). En la estación A las
variables T-S y el oxígeno se mantienen estables a profundidades mayores de 650 m, un
comportamiento normal dentro de una caldera submarina (Fig. 2a y 2b). Las características
hidrográficas locales no hacen posible calcular una anomalía de temperatura fiable (dT)
utilizando el método estándar, por lo que el ajuste entre la anomalía de temperatura y la
curva de densidad es enorme y no corresponde con una influencia hidrotermal desde el
fondo. La temperatura del agua en el interior del volcán y en la parte inferior se encuentra
bajo -1°C (Fig. 2a), esto es muy diferente de la temperatura media de las dorsales
mesooceánicas a ~2000 m de profundidad (~2°C) sin tener en cuenta la influencia de una
fuente hidrotermal (Baker et al., 2002).
Utilizando valores relativos de transmisión de luz (Fig. 2c), vemos que disminuyen en el
interior de Orca, en consonancia con la idea de que existe un flujo hidrotermal dentro del
volcán. Los mayores valores de ˇ 3He confirman la actividad hidrotermal de Orca (Fig. 2d).
Mediciones anteriores en el estrecho Bransfield mostraron que el exceso de 3He se
interpreta como una inyección local de un componente de rica en 3He por el rift a aguas
profundas (Schlosser et al., 1988). Dentro del monte submarino el máximo es de ˇ 3He de
13,94% y se interpreta debido a una fuente proveniente del mismo volcán.
El análisis de los cultivos mostró que dentro de la estación A, así como en la estación B, los
microorganismos no se encontraron en cantidades similares (Fig. 3). En la estación A, la
mayoría de los microorganismos corresponden a Cocci de Gram negativos y morfología de
ϮϮϮ
barra. Todos ellos crecieron entre 70°- 80ºC y otros a 90ºC. La información sobre el tipo
de material utilizado para el cultivo, la necesidad de oxígeno, temperatura, pH, NaCl en
combinación con el análisis de ADN reveló que estos microorganismos pertenecen al
Phylum Archaea y Bacteria. Aún más, se pudieron identificar hipertermófilos, termófilos y
halófilos. La mayoría de estas cepas crecen en un amplio rango de temperaturas (65-90°C).
Temperaturas óptimas se encuentran entre 80ºC y 90ºC y los tiempos de duplicación son
del orden de una hora. Ninguna de las cepas crecieron a temperaturas mesofílicas o por
debajo.
De los experimentos se puede ver que dentro de Orca hay un mayor número de termófilos e
hipertermófilos que en el exterior del volcán, y también la cantidad es mayor desde el fondo
del volcán a la parte superior. Eso indica que hay un flujo volcánico desde el subsuelo del
interior del monte.
Como conclusión se puede mencionar que los resultados confirman la existencia de un flujo
proveniente del fondo del monte submarino de Orca, especialmente por los altos valores de
3
He y la distribución vertical de microorganismos termófilos e hipertermófilos, aunque no
se tiene certeza de su impacto térmico.
Figura 2. Perfiles de variables oceanográficas y de 3He al interior (A) y exterior (B) al monte submarino
Orca (PT: temperatura potencial, S: salinidad, PD: densidad potencial, O: oxígeno; R: estación de referencia).
ϮϮϯ
AGRADECIMIENTOS
Al grupo de científicos y tripulación del crucero ANT-XXV/4 a bordo del R/V
“Polarstern”.
REFERENCIAS BIBLOGRÁFICAS
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Baker, E. T., R. N. Hey, J. E. Lupton, J. A. Resing, R. A. Feely, J. J. Gharib, G. J. Massoth, F. J.
Sansone, M.
Kleinrock, F. Martínez, D. F. Naar, C. Rodrigo, D. Ohnenstiehl y D. Pardee.
2002. Hydrothermal
Venting Along Earth’s Fastest Spreading Center: East Pacific Rise,
27.5°-32.3° S. J. Geophys. Res., 17:
EPM 2/1-14.
Barker D.H.N. y Austin, J.A. 1994. Crustal Diapirism in Bransfield Strait, West Antarctica:
Evidence for
Distributed
Extension in Marginal-Basin Formation. Geology, 22: 657-660.
Baross, J.A. y J.W. Deming. 1983. Growth of “black smokers” bacteria at temperatures of a least
250°C. Nature, 303: 423-426.
Bohrmann G., C.S. Chin, S. Petersen, H. Sahling, U. Schwarz-Schampera, J. Greinert, S. Lammers,
G. Rehder, A. Daehlmann, K. Wallmann, S. Dijkstra y H.W. Schenke. 1999. Hydrothermal
activity at Hook Ridge in the
Central Bransfield Basin, Antarctica. Geo. Mar. Lett., 18: 277–
284.
Dählmann, A. Wallmann, K. Sahling, H. Sarthou, G. Bohrmann, G. Petersen, S. Chin y S.
Klinkhammer, G. 2001. Hot vents in an ice-cold ocean: Indications for phase separation at the
southernmost area of hydrothermal
activity, Bransfield Strait, Antarctica. Earth Planet. Sci.
Lett., 193: 381-394.
Fretzdorff, S., T. J. Worthington, K. M. Haase, R. Hekinian, L. Franz, R. A. Keller, y P. Stoffers.
2004. Magmatism in the Bransfield Basin: Rifting of the South Shetland Arc?, J. Geophys. Res.,
109, B12208.
Klinkhammer G.P., C.S. Chin, C. Wilson, M. Rudnicki, R.A. Keller, M.R. Fisk, y L.A. Lawver.
1995. Results of a
search for hydrothermal activity in the Bransfield Strait, Antarctica. EOS
Supplement November 7,: 710.
Klinkhammer, G., C. Chin, R. Keller, A. Dählmann, H. Sahling, G. Sarthou, S. Petersen, F. Smith y
C. Wilson. 2001.
Discovery of new hydrothermal vent sites in Bransfield Strait, Antarctica.
Earth Planet. Sci. Lett., 193: 395- 407.
Lawver L.A., B. Sloan, D.H.N. Barker, M. Ghidella, R.P. Von Herzen, R.A. Keller, G.P.
Klinkhammer y C.S.
Chin. 1996. Distributed, active extension in Bransfield Basin, Antarctic
Peninsula: Evidence from
multibeam bathymetry. GSA Today, 6:1-6
Petersen S., M. Peter, H.U. Schwarz-Schampera, MD. Hannington y I.R. Jonasson. 2004.
Hydrothermal precipitates associated with bimodal volcanism in the Central Bransfield Strait,
Antarctica. Mineralium Deposita, 39: 358–379.
Robertson Maurice, S.D., D.A. Wiens, P.J. Shore, E. Vera, y L.M. Dorman. 2003. Seismicity and
tectonics of the South Shetland Islands and Bransfield Strait from a regional broadband
seismograph deployment. J.
Geophys. Res., 108(B10), 2461.
Schlosser P., Suess E., Bayer R.y Rhein M. 1988. 3He in the Bransfield Strait waters: indication for
local injection from back-arc rifting. Deep Sea Res. Part A, Oceanographic Research Papers,
35(12): 1919-1935.
Solari, M.A., Hervé, F., Martinod, J., Le Roux, J.P., Ramírez, L.E. y Palacios, C. 2008. “Geotectonic
Evolution of
the Bransfield Basin, Antartic Peninsula: Insights From Analogue Models”.
Antarctic Science, 20(2): 185196.
Sultenfuss, J., Rhein, M. y Roether, W. 2009. The Bremen Mass Spectro-metric Facility for the
measurement of helium isotopes, neon, and tritium in water. In: Proceedings of the International
Symposium on Quality Assurance for Analytical Methods in Isotope Hydrology. IAEA
Proceedings, IAEA-CN 119-7.
ϮϮϰ
AISLAMIENTO Y CARACTERIZACIÓN DE CEPAS
ANTÁRTICAS PRODUCTORAS DE COMPUESTOS
ANTIMICROBIANOS DEL TIPO BACTERIOCINA
(Isolation and characterization of Antarctic strains producing
bacteriocin-like antimicrobial compounds)
Rojas, J.1,2, Asencio, G.1, Lavín, P.1, 3, González-Rocha, G.4 & González, M.1
1. Laboratorio de Biorrecursos Antárticos, Instituto Antártico Chileno
2. Facultad de Cs. Agropecuarias y Forestales, Universidad de la Frontera
3. Fundación Científica y Cultural Biociencia
4. Facultad de Cs. Biológicas, Universidad de Concepción
Las enfermedades infecciosas causadas por bacterias y otros microorganismos patógenos
representan un desafío serio para la farmacología actual. El rápido desarrollo de la
resistencia antibiótica de muchos patógenos y la toxicidad de algunos de los antibióticos
actualmente usados propicia la búsqueda y el desarrollo de nuevos agentes antimicrobianos
(Leiva et al., 2004).
Los compuestos antimicrobianos producidos por bacterias han sido ampliamente
estudiados, reconocidos por su potencial uso en la industria y se han empleado para tratar
infecciones producidas por bacterias patógenas. Sin embargo, en los últimos años se ha
producido una notable merma en el hallazgo de nuevos productos, es por ello que las
pesquisas se han reorientado a ambientes extremos. La Antártica posee poblaciones de
microorganismos únicos, producto de los fenómenos que impiden el flujo génico, un clima
que ha conducido a la evolución de adaptaciones bioquímicas nuevas frente a temperaturas
extremadamente bajas, elevados niveles de radiación ultravioleta, altos niveles de estrés
hídrico, modificación de la salinidad, entre otros. Esta presión selectiva confiere a esta zona
un potencial medio natural para obtener nuevos organismos que puedan expresar proteínas,
péptidos o compuestos secundarios con características únicas e irrepetibles.
El objetivo de este trabajo es aislar y caracterizar bacterias antárticas con actividad
antimicrobiana, dilucidar si esta es producida por compuestos del tipo bacteriocina y
estudiar su actividad contra bacterias multirresistentes aisladas de hospitales chilenos y
patógenos del área alimentaria.
MATERIALES Y MÉTODOS
Muestreo. Se obtuvieron 7 muestras de agua Antártica y 17 muestras de sedimentos. Las
muestras fueron transportadas en frascos estériles y cajas térmicas a 4°C y fueron
procesadas inmediatamente en el Laboratorio de Biorrecursos Antárticos del Instituto
Antártico Chileno ubicado en la Base Prof. Julio Escudero.
Aislamiento de cepas. Las muestras de sedimentos fueron homogeneizadas con agua ultra
pura a 20°C por 30 minutos. Se sembraron alícuotas del líquido en medio sólido para
Actinomicetes. Las muestras de agua fueron sembradas directamente en el mismo medio.
Se incubaron a 20°C por al menos 8 días. Se seleccionaron distintas colonias de acuerdo a
sus morfologías para los estudios posteriores.
Selección de cepas con actividad antimicrobiana. Se determinó la actividad
antimicrobiana mediante la técnica Agar Spot Test (Fleming et al, 1975) utilizando como
ϮϮϱ
cepa indicadora a Staphylococcus aureus. El ensayo consiste en sembrar las cepas
en medio Actinomicetes de manera que crezca de manera circular hasta un tamaño de 2-3
mm. Posteriormente se añaden sobre ellas aproximadamente 8 ml de LB molten al que se le
han inoculado 100 µ l de un cultivo de la cepa patógena en fase exponencial. Las placas se
incuban a 37 ºC por 24 h. Una inhibición en el crecimiento del patógeno se evidencia con
un halo alrededor de la colonia.
Las cepas que presentaron actividad antimicrobiana contra Staphylococcus aureus fueron
ensayadas contra cepas multirrestentes aisladas de hospitales chilenos Pseudomonas
aeruginosa (P145), Escherichia coli (Ec241 y Ec325), Acinetobacter baumannii (Ab1),
Kliebsella pneumoniae (Kb495 y Kb503) Serratia marcescens (S32 y S41) y sobre una
cepa de Listeria monocytogenes aislada de productos alimenticios.
Obtención de sobrenadante de cultivo libre de células. Las cepas seleccionadas se
inocularon en medio líquido LB o Actinomicetes durante 4 días a 20 ºC. Los cultivos se
centrifugaron a 8000 rpm por 20 minutos de manera de separar la masa bacteriana del
sobrenadante. El sobrenadante de cultivo libre de células fue liofilizado y concentrado 20
veces.
Ensayos de actividad antimicrobiana del sobrenadante. En microplacas de 96 pocillos
se ensayó la actividad del sobrenadante concentrado, adicionando 50 ˇ l del sobrenadante
concentrado sobre 100 ˇ l de un cultivo de Staphylococcus aureus o Escherichia coli en
fase de latencia. Las placas se incubaron a 37ºC por 24 horas. La actividad antimicrobiana
se evidencia en que el cultivo permanece sin turbiedad.
Se realizó la misma técnica probando la actividad de sobrenadantes que fueron sometidos a
calor (99ºC por 10 minutos) para probar la termoestabilidad y el posible origen proteínico
del compuesto inhibitorio.
Extracción de ADN y amplificación mediante PCR. El ADN se extrajo de cultivos puros
utilizando el método descrito por Ruiz-Barba (2005). Los fragmentos de ADN parcial 16S
fueron amplificados por PCR usando partidores estándar 16S Fw (5’AGAGTTTGATCCTGGCTCAG-3’), 16S Rv (5’-CGGTTACCTTGTTACGACTT-3’).
Pre-purificación de muestras utilizando cromatografía en columna. Se seleccionaron
dos sobrenadantes libre de células correspondientes a cepas de agua que presentan
inhibición frente a una mayor cantidad de patógenos. Se utilizaron cartuchos de
cromatografía SEP-PAK C18 (Waters). El procedimiento consistió en transferir la muestra
a la columna y eluir con una fase móvil de soluciones de acetonitrilo (10%, 40% y 80%) en
agua ultra pura. Se colectaron las fracciones, se liofilizaron y resuspendieron. Las
fracciones se utilizaron para realizar test de actividad antimicrobiana en microplacas según
el método ya descrito.
Determinación del perfil de proteínas de las muestras. Se realizo un gel de Tris –
Tricita. Se utilizó la técnica de electroforesis vertical para determinar el perfil de proteínas
en geles de acrilamida-bisacrilamida. El gel se tiñó con plata utilizando el kit ProteoSilver
(SIGMA).
ϮϮϲ
RESULTADOS
De un total de 1079 cepas (411 de agua y 668 de sedimientos), 45 presentaron actividad
contra Staphylococcus aureus, lo que representa un 3.4% del total de cepas aisladas de agua
y un 4.6% de las cepas aisladas desde suelo. Los halos de inhibición fluctuaron entre 0.3 y
2.7 cm de diámetro.
Cepa patógena
Pseudomonas aeruginosa P145
Escherichia coli Ec241
Escherichia coli Ec325
Acinetobacter baumannii Ab1
Kliebsella pneumoniae Kb495
Kliebsella pneumoniae Kb503
Serratia marcescens S32
Serratia marcescens S41
Listeria monocytogenes ListM
Cantidad de cepas de
Cantidad de cepas de agua que
tierra que inhiben el
inhiben el crecimiento
crecimiento
2 (0.49%)
19 (2.84%)
2 (0.49)
3 (0.45%)
0
0
1 (0.24%)
21 (3.14%)
0
29 (4.34%)
2 (0.49%)
3 (0.45%)
0
28 (4.19%)
3 (0.73%)
27 (4.04%)
9 (2.19%)
23 (3.44%)
Tabla 1. Muestra la cantidad de cepas que inhiben el crecimiento de cada cepa patógena ensayada. Entre
paréntesis se indica el porcentaje que representa esta cantidad en el universo estudiado.
A la fecha se tiene la secuencia parcial o total del gen ADNr 16S de cuatro cepas, tres de
ellas tienen homología con el género Pseudomonas y una correspondería a
Janthinobacterium.
Se ha ensayado la actividad del sobrenadante libre de células de catorce cepas, ocho de
estos inhibieron a Staphylococcus aureus y seis de ellos se inactivaron al ser sometidos a
altas temperaturas. Del mismo modo se estudió la inhibición sobre Escherichia coli
obteniendo nueve cepas activas, con siete inactivadas con el alza de temperatura.
Luego de la prepurificación se obtuvo que las fracciones eluídas con 40% y 80% de
acetonitrilo del sobrenadante 1 y todas las fracciones del sobrenadante 2 inhiben el
crecimiento de Staphylococcus aureus.
El perfil de las fracciones evidenció una gran cantidad de proteínas de bajo peso molecular.
En cuanto a las fracciones del sobrenadante 1, se observa una mejor separación entre las
fracciones, destacándose en la fracción de 80% proteínas de peso molecular cercanas a 6
kDa y a 21.5kDa que podrían ser las responsables de la actividad antimicrobiana. En el
sobrenadante 2 no se observan diferencias significativas en los distintos perfiles, con mayor
cantidad de bandas entre 6 y 21.5 kDa.
ϮϮϳ
Figura 1. Gel de Proteína Tris-Tricina Urea. El número 1 ó 2 representa a los sobrenadante y (A) a la
fracción eluída con 10% de acetonitrilo, (B) a la fracción 40% y (C) a la fracción 80%. Figure 1: Protein Gel
Tris-Tricine urea. The number 1 or 2 represents the supernatant. (A) Fraction eluted with 10% acetonitrile,
(B) fraction 40% and (C) fraction 80%.
DISCUSIÓN
La cepa Listeria monocytogenes fue inhibida por la mayor cantidad de cepas (2,97% del
total), esto se debería a que la primera selección se realizó utilizando otra cepa gram
positiva; Staphylococcus aureus. La frecuencia de detección de compuestos
antimicrobianos fue de 4.2%; la que es comparable con otros estudios de bacterias que
poseen actividad antimicrobiana (O'Brien et al. 2004, Lo Giudice et al. 2007 a,b).
Tanto Pseudomonas y Janthinobacterium han sido reportadas con anterioridad desde
sedimentos y agua en Antártica (Reddy et al. 2004, Wong et al. 2011), en ambos géneros se
han descrito propiedades antimicrobianas.
Las pruebas de sensibilidad a temperaturas elevadas que inactivaron algunas muestras, más
los resultados obtenidos luego de la prepurificación con SEP-PAK son coincidentes con
compuestos de naturaleza proteica y el tamaño de las bandas observadas concuerda con
compuestos del tipo bacteriocinas.
CONCLUSIONES
Las actividades de bioprospección realizadas han permitido caracterizar parcialmente 45
cepas con actividad antimicrobiana, muchas de estas con actividad sobre bacterias
multirresistentes aisladas desde hospitales chilenos y un número importante de cepas que
inhiben el crecimiento de Listeria monocytogenes.
El estudio de actividad de los sobrenadantes de cultivo libre de células indican algunos de
los compuestos activos son extracelulares, sensibles a temperaturas elevadas y presentan un
perfil de proteínas con tamaños moleculares típicos de bacteriocinas, lo que se confirmará
mediante la aplicación de ensayos adicionales.
El estudio de estos compuestos puede derivar en aplicaciones industriales de alto interés,
para su uso en farmacología, cosmética o alimentaria.
ϮϮϴ
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
Fleming, H. Etchells, J. y Costilow, R. 1975. Microbial inhibition by an isolate of Pediococcus from
cucumber brines. Applied Microbiology, 30(6):1040-1042.
Leiva, S. Yañez, M. Zaror, L. Rodríguez, H. y García-Quintana, H. 2004. Actividad antimicrobiana
de actinomycetes aislados desde ambientes acuáticos del sur de Chile. Revista Médica de
Chile.132:151-159.
Lo Giudice, A. Brilli, M. Bruni, V. De Domenico, M. Fani, R. y Michaud, L. 2007. Bacteriumbacterium inhibitory interactions among psychrotrophic bacteria isolated from Antarctic seawater
(Terra Nova Bay, Ross Sea). FEMS Microbiology Ecology, 60(3):383-396.
Lo Giudici, A. Bruni, V. y Michaud, L. 2007. Characterization of Antarctic psychrotrophic bacteria
with antibacterial activities against terrestrial microorganisms. Journal of basic microbiology,
47(6):496-505.
O’Brien, A. Sharp, R. Russell, N. y Roller, S. 2004. Antarctic bacteria inhibit growth of food-borne
microorganisms at low temperatures. FEMS Microbiology Ecology, 48(2):157-167.
Reddy, S. Genki I. Matsumoto, G. Peter Schumann, P.Erko Stackebrandt, E. Shivaji,S. 2004.
Psychrophilic pseudomonads from Antarctica: Pseudomonas antarctica sp. nov., Pseudomonas
meridiana sp. nov. and Pseudomonas proteolítica sp. nov. International Journal of Systematic and
Evolutionary Microbiology, 54: 713–719
Ruiz-Barba, J. Maldonado, A. Jiménez-Díaz. 2005. Small-scale total DNA extraction from bacteria
and yeast for PCR applications. Analytical Biochemistry, 347(2):333-335.
Wong,C. Tam,H. Aalias,S .González, M. González−Rocha, G. Dominguez−Yévenes, M. 2011.
Pseudomonas and Pedobacter isolates from King George Island inhibited the growth of foodborne
pathogens. Polish Polar Research, 32(1):3–14.
ϮϮϵ
CARACTERIZACIÓN DE UNA CEPA FÚNGICA AISLADA
DESDE LA RISÓZFERA DE Deschampsia antarctica Desv.
(Characterization of a fungal strain isolated from Deschampsia
antarctica rhizosphere)
Sagredo, C. E1., Gutiérrez, A.1, 2, Gidekel, M.3, Cabrera, G.3*
1
Laboratorio de Biología Molecular Aplicada. Facultad de Ciencias Agropecuarias y Forestales. Departamento de Producción
Agropecuaria. Universidad de La Frontera. Temuco, Chile
2
Faculta de Ingeniería y Ciencias, Universidad Adolfo Ibáñez, Santiago, Chile
3
[email protected] Escuela de Negocios, Universidad Adolfo Ibañez, Santiago, Chile
Deschampsia antarctica Desv., una poaceae conocida como pasto antártico, es una de las
dos plantas fanerógamas que han colonizado exitosamente la Antártica (Sánchez-Moreiras
et al., 2004), durante el periodo del holoceno (Avery et al., 2003). Esta se encuentra en
varias islas oceánicas del sur, restringiéndose en el territorio antártico a la península
antártica e islas mar adentro. Esta planta, posee adaptaciones naturales para sobrevivir a las
condiciones hostiles de su hábitat tales como: tolerancia al hielo extracelular, un aparato
fotosintético que mantiene un 30% del óptimo fotosintético a 0ºC, y la acumulación de
carbohidratos como fructanos y sacarosa (Xiong et al., 1999; Zuñiga et al., 2003). No
obstante, es posible que la microbiota asociada a su rizosfera también le facilite su
sobrevivencia.
Nuestro grupo de trabajo, ha estado investigando la comunidad bacteriana asociada a la
rizosfera de Deschampsia y su posible función biológica. Hasta el momento, se han aislado
70 cepas de bacterias pero sólo algunas se han caracterizado e identificado molecularmente
(Barrientos et al., 2008). Las características bioquímicas de estas bacterias sugieren que
tienen un rol activo en el crecimiento, disponibilidad de nutrientes, sanidad y sobrevivencia
de la planta a las condiciones Antárticas. Sin embargo, hasta el momento no tenemos
conocimiento sobre las características y funciones de hongos que habiten en este mismo
entorno.
El conocimiento del metabolismo y la composición de dichos microorganismos no solo
permitirá conocer cual es su rol en este ecosistema, sino que también permitirá utilizarlo
como una potencial fuente de productos biotecnológicos (enzimas, polisacáridos,
pigmentos, antibióticos, etc). Por tanto, el objetivo del presente trabajo es aislar y
caracterizar una cepa de hongo presente en la rizosfera de Deschampsia.
METODOLOGÍA
Para aislar el microorganismo se tomaron trozos de raíces Deschampsia antarctica Desv y
se colocaron en medio PDA hasta observar un halo de crecimiento. Después, este hongo se
cultivó a 4°C y 25ºC y se midió su crecimiento. Se realizó una tinción para observar las
hifas y esporas del microorganismo usando microscopía óptica. La caracterización
bioquímica del microorganismo se realizó utilizando el kit comercial ApiZYM® 200, que
permite determinar algunas de las enzimas que posee el hongo.
Para identificar el género del microorganismo se realizó su caracterización molecular.
Primeramente, se extrajo el DNA genómico y se realizó un PCR con partidores ITS1 y
ITS4 que se secuenciaron. El producto de PCR se alineó por medio de la herramienta
informática BLAST y se construyó el dendograma.
ϮϯϬ
RESULTADOS
El microorganismo aislado desde la rizosfera de Deschampsia demuestra tener un
comportamiento psicrotolerante porque crece a 4ºC y 25ºC. El resultado de la identificación
molecular indica que este hongo tiene una alta homología con microorganismos del género
Mucor y, en particular , con una especie que tiene característica de simbionte en plantas
superiores. Este hecho, sugiere que la cepa estudiada también podría ser un simbionte de
Deschampsia y que sería benigna para su crecimiento en las condiciones antárticas.
Dentro de la batería de enzimas que presenta este hongo se encuentran la fosfatasa alcalina,
la fosfatasa ácida y la naftolfosfohidrolasa, lo que indica que estos hongos tienen la
capacidad de solubilizar P desde diferentes fuentes. Un grupo similar de enzimas fosfatasas
ha sido hallada por nuestro grupo en bacterias psicrotolerantes, con propiedades PGPR
isladas también desde la rizosfera de Deschampsia. Otras enzimas halladas son la esterasa
C4, glicina, leucina y valinarilamidasa, respectivamente. Dentro de las hidrolasas ensayadas
presenta enzimas alfa-glucosidasa (degrada maltosas) y beta-glucosidasa (celulasa) lo que
le permitirían degradar pared celular de plantas para su colonización.
Se concluye que el hongo aislado podría tener un rol como simbionte de Deschampsia
antártica. Otros ensayos encaminados a demostrar este hecho están en progreso.
AGRADECIMIENTOS
INACH por el apoyo logístico en la Antártica y a Vitrogen S.A.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
Avery L., Lewis Smith R. y West H. 2003. Response of rhizosphere microbial communities
associated with Antarctic hairgrass (Deschampsia antarctica) to UV radiation. Polar Biology 26:
525–529.
Barrientos L., Gidekel M & Gutiérrez A. 2008. Characterization of rhizospheric bacteria isolated
from Deschampsia antarctica Desv. World J Microbiol Biotechnol. 24:2289–2296 p.
Sánchez–Moreiras A., Weiss O., y Reigosa–Roger M. (2004). Allelopathic Evidence in the Poaceae.
The Botanical Review, 69(3): 300–319.
Zúñiga-Feest A., Inostroza P, Vega M., Bravo L. A. Corcuera L.J. 2003. Sugars and enzyme activity
in the grass Deschampsia antarctica. Antarctic Science 15 (4): 483–491.
Xiong, F., Ruhland, C. Day, T. 1999. Photosynthetic temperature response of the Antarctic vascular
plants Colobanthus quitensis and Deschampsia antarctica. Physiologia Plantarum 106: 276-286.
Ϯϯϭ
IDENTIFICACIÓN DE GENES EXPRESADOS
DIFERENCIALMENTE EN Deschampsia antarctica DESV.,
FRENTE A ESTRÉS OXIDATIVO POR RADIACIÓN UV.
(Identification of differentially expressed genes in Deschampsia
antarctica Desv., Against oxidative stress by UV radiation)
Sandoval, A.1, Fernández, E.2, Gidekel, M.3 & Gutiérrez, A.1, 3
Universidad de La Frontera1, Universidad Católica de Córdova1, Universidad Adolfo Ibañez3.
La Antártica es el continente más frío, ventoso y árido del planeta. Sus rasgos climáticos
extremos, así como la historia geológica que dio origen a su morfología actual, son los
responsables de que la vida desarrollada sobre la Antártica, como así también las
oportunidades científicas que ofrece el continente, compartan la naturaleza excepcional que
la caracteriza. Pero la Antártica no es en absoluto un desierto. Entre hielos perpetuos y en
las frías aguas que rodean el inhóspito continente, florece una biodiversidad asombrosa en
cantidad y variedad, la cual ha despertado el interés de numerosos especialistas por
descubrir en ella potenciales usos para la agricultura e industria, y también por comprender
los mecanismos de tolerancia y adaptabilidad que estos organismos extremófilos poseen.
Desde el descubrimiento del denominado “agujero” de ozono en la Antártica, el interés por
estudiar las principales consecuencias de la radiación ultravioleta sobre los organismos ha
aumentado considerablemente. La sobreexposición a la radiación ultravioleta (UV)
promueve la formación de sustancias altamente tóxicas, llamadas Especies Reactivas de
Oxigeno (EROs). Una planta que habita esas latitudes y que es capaz de anular el impacto
que provoca la radiación ultravioleta es la gramínea Deschampsia antarctica Desv., ya que
posee importantes biomoléculas como metabolitos, proteínas y ácidos nucleicos que
participan en el proceso de reducir su efecto. Su singular respuesta fisiológica en
condiciones in situ, hace suponer que posee genes responsables de conferir propiedades de
resistencia a estreses abióticos, interesantes de ser identificados y caracterizados, para un
futuro uso en el mejoramiento de cultivos y la industria farmacéutica. Nuestra hipótesis de
trabajo sostiene que Deschampsia antarctica in situ activa o suprime genes específicos
como uno de sus mecanismos para tolerar el estrés oxidativo inducido por radiación UV. El
objetivo general de este trabajo es identificar genes mediante tecnología de Microarreglos
cuya función génica es clave en la respuesta y tolerancia de Deschampsia antarctica frente
a estrés oxidativo inducido por radiación UV.
Para obtener la información contenida en el transcriptoma de Deschampsia la metodología
contempló la selección de genes sobrexpresados frente a estrés oxidativo inducido por
radiación UV. Una biblioteca de cDNAs normalizada de Deschampsia antartica construida
bajo condiciones naturales de Antártica, fue utilizada para la fabricación e impresión de
Microarreglos. La validación de los resultados obtenidos tras la hibridación del
microarreglo se realizo mediante PCR en tiempo real de algunos genes diferenciales.
Inicialmente, y para comprobar que las plantas de Deschampsia estaban sometidas a estrés
oxidativo en su ambiente natural, analizamos el contenido de polifenoles totales presentes
en extractos metanólicos de Deschampsia (cond. Antártica y cond. Bloqueo UV) y su
capacidad antioxidante. La capacidad de Deschampsia de tolerar el estrés oxidativo
inducido por el ambiente Antártico, se correlacionaría con una alta actividad de los sistemas
ϮϯϮ
antioxidantes. Las plantas acumulan polifenoles que absorben la radiación ultravioleta, y en
general juegan un rol preponderante en las interacciones de la planta con su entorno.
El contenido de compuestos fenólicos totales de los extractos metanólicos condición
Antártica fue de 6,21±0,143 y 3,72±0,139 para la condición Bloqueo de UV. siendo ambas
condiciones mayores que el contenido de polifenoles totales en plantas de sorgo (Sorghum
bicolor, L. Moench) 2,34±0,032, y la condición Antártica similar a la planta de cacao
(Theobroma cacao) 6,66 ±0,044 (Padilla et al. 2008). El contenido de compuestos fenólicos
de diferentes fuentes vegetales ha sido reportado como responsable de actividad
antioxidante y correlacionado con ella (Kim et al. 2003), por lo cual un contenido elevado
de compuestos fenólicos sugiere una alta capacidad antioxidante (Cheung et al. 2003). Por
otro lado, la condición Antártica presenta mayor actividad capturadora con un valor 1,4 +
0,009 mientras que la condición Bloqueo de UV solo alcanza un 0,86 + 0,003. Esta
propiedad está relacionada con la capacidad antioxidante de los polifenoles, formados por
un anillo aromático al que están unidos uno o más grupos hidroxilos, los cuales son capaces
de reducir la producción de radicales libres. Estos resultados confirman que a nivel de
metabolitos secundarios, como los polifenoles, existe una producción diferenciada y
estadísticamente significativas en muestras de Deschampsia expuestas, o con bloqueo, a
radiación UV.
Previo al análisis de genes diferenciales, las intensidades en cada uno de los canales fueron
sometidas a una etapa de normalización de datos, específicamente normalización LOESS
para eliminar dependencias M-A y la normalización MAD (median absolute deviation)
para centrar los valores de M en cero y estandarizar las distribuciones de todos los chips. El
análisis estadístico a partir de los valores de señal obtenidos de la hibridación, arrojo una
lista con 158 genes diferencialmente expresados y estadísticamente significativos (p<0.05 y
FC 0.7) entre las dos condiciones evaluadas
Con los 158 genes diferencialmente expresados (p<0.05 y FC 0.7), se realizó un análisis
de biclustering jerárquico utilizando el software R (http://www.r-project.org/). Con este
análisis 97 genes fueron clasificados como sobreexpresados y 62 como reprimidos en
Deschampsia bajo la condición Antártica (biblioteca cDNAs normalizada). Estos datos se
encuentran ordenados por promedio de nivel de cambio expresado en LogFC de la razón
Antártica / Bloqueo UV.
Entre los genes sobreexpresados, encontramos 12 categorías generales: Metabolismo 4
genes (5,5%), Energía 4 genes (5,5%), Transcripción 3 genes (4,1%), Síntesis de Proteína 2
genes (2,7%), Procesamiento de Proteínas 5 genes (6,9%), Proteínas con Función de Unión
2 genes (2,7%), Regulación del Metabolismo y Función de Proteínas 1 gen (1,37%),
Rescate Celular, Defensa y Virulencia 2 genes (2,74%), Interacción con el Medio Ambiente
1 gen (1,37%), Procesamiento Celular 1 gen (1,37%), Biogénesis de Componentes
Celulares 1 gen (1,37%), Proteínas sin Clasificación 46 genes (63%). La categoría que
presentó un mayor número de genes fue la de Proteínas sin Clasificación, seguida de
Procesamiento de Proteínas, Metabolismo y Energía.
Respecto de los genes reprimidos, 6 categorías generales fueron determinadas:
Metabolismo 1 gen (5,9%), Energía 2 genes (11,8%), Proteínas con Función de Unión o
Necesidad de Cofactores 1 genes (5,9%), Rescate Celular, Defensa y Virulencia 2 genes
(11,8%), Interacción con el Ambiente Celular 2 genes (11,8%) y Proteínas sin Clasificación
9 genes (52,9%). Nuevamente un alto porcentaje de los genes analizados correspondieron a
proteínas sin clasificación alguna, seguidas por Energía, Rescate Celular, Defensa y
Virulencia e Interacción con el Ambiente Celular.
Ϯϯϯ
Para validar los resultados del Microarreglo, se realizó la cuantificación relativa de 38
(24%) genes diferenciales (30 genes sobreexpresados y 6 genes reprimidos) con muestras
de Deschampsia bajo las mismas condiciones experimentales del Microerreglo (Bloqueo de
UV vs Antártica). Un análisis de columna t test, Unpaired (and nonparametric test)
(GraphPad Prism) confirmó la calidad de genes diferenciales. El 97% de los genes presentó
cambios significativos al comparar las muestras Bloqueo UV y Antártica. Entre ellos, 15
(40%) presentaron una significancia estadística < a 0.05, 9 (24%) una significancia
estadística < a 0.01 y 14 (37%) una significancia estadística < a 0.001. Se destacan por el
aumento de su expresión, respecto de la muestra Bloqueo UV los genes CR2, bHLH y Cy,
también lo hace el gen Da2D4 (NS), sin similitud encontrada en la base de datos, y el gen
24A14 (hp) correspondiente a una proteína hipotética. Entre los genes reprimidos, se
destacan por su disminución de expresión ante condiciones Antárticas los genes ELIP y
PSI. Aunque la técnica de qPCR valida la calidad de genes diferenciales obtenida en el
Microarreglo, en general, ambos no presentan una correlación entre los valores de los datos,
salvo los primeros 4 genes de la lista, que corresponderían a los genes seleccionados con
mayores valores LogFC. Como un control positivo de las diferencias de expresión en
ambas muestras se utilizó el gen superoxide dismutase (SOD), conocido gen de respuesta a
estrés oxidativo y claramente inducido en las muestras Antártica (García Echauri et al.
2009, Sánchez-Venegas et al. 2009). El 95% de los genes (39) evaluados por PCR en
tiempo real fue validado. El nivel de expresión relativa fue calculado utilizando un cDNA
de Deschampsia bajo la condición Bloqueo de la UV como calibrador.
Si bien todos los organismos vivos soportan numerosos factores endógenos y exógenos de
estrés oxidativo, al mismo tiempo poseen numerosos sistemas de defensas antioxidantes
regulables, enzimáticos y no enzimáticos. Además, también poseen otros mecanismos de
protección que contribuyen a disminuir el posible daño oxidativo, tales como la fidelidad de
las reacciones metabólicas de oxido reducción, la gran compartimentalización celular
evitando que las EROs y sus fuentes estén cerca de sus blancos de acción, y otros varios
factores estructurales de los ácidos nucleicos que favorecen su protección ante el estrés
oxidativo como la cromatina compacta, la presencia de histonas y la formación de
complejos. De acuerdo con los resultados obtenidos en el presente trabajo podemos
concluir que:
Mediante la metodología de Microarreglos se logro identificar genes regulados por
radiación UV, los cuales participan activamente como mecanismos de defensa y tolerancia
en Deschampsia antarctica. La expresión diferencial de un grupo de genes fue corroborada
mediante PCR Tiempo Real
Los valores FoldChange obtenidos en ambas técnicas no presentaron una correlación de la
expresión génica.
Tras la secuenciación ambos alineamientos, BLASTN y BLASTX, encontraron similitud
principalmente con otras especies gramíneas. Uno de los problemas con los que nos
encontramos durante la interpretación fue la existencia de un alto porcentaje de secuencias
similares a proteínas hipotéticas de las cuales podremos conocer su secuencia de
aminoácidos pero nada directamente sobre su bioquímica, su estructura o su función. Solo
será posible deducir indirectamente algunos de estos rasgos mediante la búsqueda de
dominios conservados de otras proteínas conocidas en otros organismos diferentes, con las
que la secuencia de la proteína en cuestión presente similitud.
La respuesta de Deschampsia frente al estrés abiótico fue la activación transcripcional de
genes específicos. La regulación espacial y temporal de patrones de expresión de genes de
Ϯϯϰ
estrés específicos es una parte importante de la adaptación de la planta al estrés abiótico
(Riechmann et al. 2000). Entre los grupos de genes regulados se incluyen aquellas
proteínas que probablemente funcionan en la tolerancia al estrés. Se trata de proteasas para
el recambio proteico, proteínas que participan en el movimiento de agua a través de la
membrana, enzimas requeridas para la biosíntesis de osmoprotectores (azúcares, prolina),
proteínas que protegen macromoléculas y membranas (proteínas LEA, osmotina, proteínas
de anticongelación, chaperonas y proteínas de unión al mRNA), y de enzimas de
detoxificación. También están presentes aquellos factores proteicos que participan en la
transducción de la señal que se produce en la respuesta a estrés. Se trata de proteínas
quinasas, fosfatasas, inhibidor de proteasas y factores de transcripción. La sobreexpresión
de estos genes inducibles contribuye con la tolerancia de Deschampsia frente al estrés
oxidativo. Para evitar la fotoinhibición Deschampsia suprime la expresión de genes
componentes del PSI, lo cual es un proceso esencial para poder crecer en condiciones de
alta luminosidad. Un exceso de EROs, puede provocar la inactivación de la fotosíntesis.
Para evitar este daño los organismos fotosintéticos deben aclimatarse al exceso de luz
alterando su aparato fotosintético para lo cual disminuyen la cantidad de pigmentos antena,
entran en estados de transición, aumentan su capacidad de fijar CO2, y activan sus sistemas
capturadores de EROs. Es así como también encontramos un mayor contenido y actividad
antioxidantes en compuestos polifenólicos de Deschampsia antarctica expuesta a la
radiación UV.
AGREDECIMIENTOS
Proyecto FONDEF D03I-1079 “Deschampsia antarctica Desv.: Prospección de Genes y
Agentes Fotoprotectores Ultravioletas para su uso en la Industria Farmacéutica”; Apoyo
Logístico Instituto Antárctico Chileno (proyecto INACH 01- 03-Part II); Consorcio de
Tecnología e Innovación para la Salud S.A. CONICYT CTE – 06; Beca Doctorado
CONICYT; Beca arancel, Universidad de La Frontera; Beca de Doctorado, Universidad de
La Frontera; Becas Dirección Académica de Postgrado y Convenio de Desempeño,
Universidad de La Frontera.
REFERENCIA BIBLIOGRÁFICA
•
•
•
•
•
•
CHEUNG, L., CHEUNG, P. & OOI, V. 2003. Antioxidant activity and total phenolics of edible
mushroom extracts. Food Chemistry, 81, 249-255.
GARCÍA ECHAURI, S.A., GIDEKEL, M., MORAGA, A.G., ORDÓÑEZ, L.G., ROJAS
CONTRERAS, J.A., BARBA DE LA ROSA, A.P. & DE LEÓN RODRÍGUEZ, A. 2009.
Heterologous expression of a novel psychrophilic Cu/Zn superoxide dismutase from Deschampsia
antarctica. Process Biochemistry, 44, 969-974.
KIM, D., JEOUNG, S. & LEE, C. 2003. Antioxidant capacity of phenolic phytochemicals from
various cultivars of plums. Food Chemistry, 81, 321-326.
PADILLA, F.C., RINCÓN, A.M. & BOU-RACHED, L. 2008. Contenido de polifenoles y actividad
antioxidante de varias semillas y nueces. ARCHIVOS LATINOAMERICANOS DE NUTRICION, 58,
303-308.
RIECHMANN, J.L., HEARD, J., MARTIN, G., REUBER, L., JIANG, C., KEDDIE, J., ADAM, L.,
PINEDA, O., RATCLIFFE, O.J., SAMAHA, R.R., CREELMAN, R., PILGRIM, M., BROUN, P.,
ZHANG, J.Z., GHANDEHARI, D., SHERMAN, B.K. & YU, G. 2000. Arabidopsis transcription
factors: genome-wide comparative analysis among eukaryotes. Science, 290, 2105-2110.
SÁNCHEZ-VENEGAS, J., DINAMARCA, J., GUTIÉRREZ-MORAGA, A. & GIDEKEL, M.
2009. Molecular characterization of a cDNA encoding Cu/Zn superoxide dismutase from
Ϯϯϱ
Deschampsia antarctica and its expression regulated by cold and UV stresses. BMC Research Notes,
2, 198.
Ϯϯϲ
MERCURY CONCENTRATION IN FEATHERS OF THE CAPE
PETREL (Daption capense)
(Concentración de Mercurio em Plumas del Petrel Damero (Daption
capense))
Souza, J.S.1, 2,3*, Costa, E.S.2, 3, 4*; Pessoa, A.R.L.2, Cunha, L.2, Alves, M.A. S.3, 4, Torres, J.P.M.2 & Malm, O.2
1
Curso de Aperfeiçoamento em Ensino de Ciência e Biologia, Centro de Ciências da Saúde, Instituto de Bioquímica Médica,
Universidade Federal do Rio de Janeiro UFRJ
2
Laboratório de Radioisótopos Eduardo Penna Franca, Centro de Ciências da Saúde, Instituto de Biofísica Carlos Chagas Filho,
Universidade Federal do Rio de Janeiro (UFRJ), CEP: 214941-900, Ilha do Fundão, Rio de Janeiro, RJ
3
Laboratório de Ecologia de Aves, Departamento de Ecologia, Instituto de Biologia Roberto Alcantara Gomes, Universidade do Estado
do Rio de Janeiro (UERJ), Rua São Francisco Xavier, 524, Maracanã, CEP 20550-011, Rio de Janeiro, RJ, Brasil
4
Programa de Pós-Graduação em Ecologia, Universidade Federal do Rio de Janeiro (UFRJ). Caixa Postal: 68.020, CEP: 21.941-540, Ilha
do Fundão, Rio de Janeiro, RJ, E-mails: [email protected], [email protected]
Seabirds are considered excellent bioindicators because they are conspicuous and relatively
easy to observe, catch and sampled. Such birds are sensitive to environmental changes
because they are the top of the marine food chain, thus accumulating the highest level of
pollutants, such as trace elements and persistent organic pollutants.
Mercury is a common metal that can be found in sediments, rocks, and organic matter. It
is a very interesting element to be evaluated because of its toxicity and the serious damage
that big concentrations can cause in individuals (Furness et al. 1997; Burger & Gochfeld,
2004). High levels of mercury can cause erratic behavior, appetite suppression, and,
consequently, weight loss in birds. Lower levels reduce the production and hatchability of
the eggs, as well as embryo and chick survival. Some studies in Arctic seabirds, such as in
puffin (Fratercula arctica), fulmar (Fulmarus glacialis) and Manx shearwater (Puffinus
puffinus) show cellular-level kidney damage associated with high levels of mercury
accumulation (Nicholson & Osborn, 1983).
The feathers are considered archives of exposures to heavy metals because during the
feathers’ growth the organism can excrete the contaminants accumulated in the internal
tissues since the previous molt cycle (Burger, 1993). The feathers allow non-destructive
and non-invasive sampling and permit retrospective study, being particularly convenient for
monitoring heavy metal pollution in marine food webs. Seabirds such as albatrosses and
petrels (Procellariiformes) can be exposed to high concentrations of mercury because of
their position in the food chain, and can serve as good monitors of the presence of mercury
in marine ecosystems (Goodale et al., 2008.)
The Cape petrel (Daption capense) is a pelagic seabird found in Antarctica and SubAntarctic Islands. In the winter it migrates to Angola, Australia and the Galapagos
Islands. It can also be found on the Brazilian coast from Rio Grande do Sul to Rio de
Janeiro.
The present study aimed to evaluate mercury concentrations in feathers of the Cape petrel
collected in Admiralty Bay, King George Island, South Shetlands Islands, Antarctica.
MATERIAL AND METHODS
Sample collection. Field work took place from December 2010 to March 2011 in
Admiralty Bay, Kin George Island. Ten carcasses of the Cape petrel found dead in
territories of Skuas (Catharacta spp.) were collected by Costa, E.S. and kept frozen for
analyses in Brazil.
Ϯϯϳ
Laboratory analyses. All mercury (Hg) levels for feathers were analyzed in the
“Radioisotopes Laboratory Eduardo Penna Franca” at Federal University of Rio de Janeiro
(UFRJ). Feather samples were washed subsequently with deionized water, EDTA solution
(0.01%) and MILLI-Q water (ultra-pour water) to remove gross surface contamination. The
methodology by Bastos (1998) for human hair was adapted to feathers. The samples were
cut in to small pieces (about 1mm) and digested in H2SO4:HNO3 (1:1) for 15 minutes in a
hot-water bath at 60oC. After total dissolution we added KMnO4 (5%) and the samples
returned to bath for 10 more minutes at 60oC. The samples were neutralized with
HONH3Cl+NaCl (12%) and the final volume (10ml) was completed with deionized water.
Mercury was analyzed by cold vapor technique CVAAS (FIMS-Perkin Elmer system). The
Hg concentration levels were expressed in mg/kg, based on wet weight. Analytical quality
control was carried out with the use of a certified reference. The recovery from the certified
sample was 93.87%.
Statistical analyses. Significance for all statistical tests was assumed at the 0.05 level. All
tests were performed using GraphPad InStat program. The Kruskal-Wallis test
(nonparametric ANOVA) was used to compare differences among the individuals.
RESULTS, DISCUSSION AND CONCLUSIONS
Mercury concentrations in sampled Cape petrels ranged from 0.32 to 3.58 mg/kg with
average 1.42 (± 1.05 mg/kg). Mercury concentration was significantly higher in three
individuals (KW = 28.52, p <0.05; n = 10). Because we did not observe variation in the
plumage of the birds collected (which could indicate the age difference), the results may be
due to the difference between the sexes. Molecular analysis to confirm the sex of the
individuals will be carried out using the technique of the CHD gene (Griffiths et al. 1998)
to investigate this hypothesis.
In the literature only one article mentions the results of mercury contamination in the Cape
petrel (Lock, 1992). These authors have analyzed only one individual of the species and
found a concentration of 1.3 mg/kg; n = 1). This value is within the range of our results, but
because it refers to just one individual it was not possible to do statistical comparison with
our results.
For mercury concentrations for Catharacta maccormicki (the South polar Skua), and C.
lonnbergi (Sub-antarctic Skua), both predators of the Cape petrel, ranged from 0.65 to 9.44
mg/kg (n=42) and from 0.950 to 2.94 mg/kg (n=9), respectively (Costa et al. 2008).
Mercury concentration was significantly higher for the South Polar Skua (KW = 22.93, p
<0.001). We did not find significant differences between the concentration levels of
mercury in feathers of the Sub-antarctic Skua and the Cape Petrel, which suggests that the
migration patterns and foraging behavior of these species can be more similar. The highest
levels found in the South polar Skua can be explained because its migration pattern during
the winter – the species can migrate as far as Europe areas, which have highest levels of
contaminants, including mercury. For migratory species the winter range may be a critical
factor in mercury levels.
Additional studies, such as the concentration of mercury for the species in their wintering
areas, are important to understand the pattern of mercury contamination in Antarctic region
and also to understand what effects mercury may have on individual animals or on wildlife
populations.
Ϯϯϴ
ACKNOWLEDGMENTS
We thank José Ricardo Thomáz for his help with the mercury measurements, Miriam
Hebling Almeida and Katia Pereira for the English review. This work was supported by
CNPq (MCT/CNPq:
557049/2009-1),
FAPERJ (E-26/111.505/2010),
Mount Sinai
School of Medicine (NIH Grant 1D43TW0640). The logistical support is from Brazilian
Antarctic
Program
(PROANTAR). JSS received
a
grant from FAPERJ
(E26/102.159/2011) ESC a doctoral fellowship (process 141474/2008-4), MASA and JPMT
received research grant from CNPq (308792/2009-2 and 306003/2008-2, respectively)
and MASA also received research grant of FAPERJ (process no. 26/102.868/2008).
REFERENCES
•
•
•
•
•
•
•
•
•
Bastos, W.R.; Malm, O.; Pfeiffer, W.C. and Cleary, D. 1998. Establishment and analytical quality
control of laboratories for Hg determination in biological and geological samples in the Amazon,
Brasil. Ciência e Cultura, 50:255–260.
Burger, J. 1993. Metals in avian feathers: bioindicators of environmental pollution. Rev Environ
Toxicol, 5:203-311.
Burger, J. and Gochfeld, M. 2004. Marine birds as sentinels of environmental pollution. EcoHealth,
1:263-274.
Costa, E.S.; Alves, M.A.S.; Santos, M.M.; Coria, N.R. e Torres, J.P. 2008. Mercury concentration in
feathers of Skuas in Antarctic Peninsula. In: XVI Simpósio Brasileiro sobre Pesquisa Antártica,
2008, São Paulo. Programa e resumos do XVI Simpósio Brasileiro sobre Pesquisa Antártica, 2008. p.
28-29.
Furness, R.W. and Camphuysen, K.C.J. 1997. Seabirds as monitors of the marine environment Journal of Marine Science, 54: 726-737.
Goodale, M.W.; Evers, D.C.; Mierzykowski, S.E.; Bond, A.L.; Burgess, N.M.; Otorowski, C.I.;
Welch, L.J.; Hall, C.S.; Ellis, J.C.; Allen, R.B.; Diamond, A.W.; Kress, S.W. and Taylor, R.J. 2008.
Marine foraging birds as bioindicators of mercury in the Gulf of Maine. EcoHealth, 5(4):409-425.
Griffiths, R.; Double, M.C.; Orr, K. and Dawson, R, J. 1998. A DNA test to sex most birds. Mol
Ecol., 7(8):1071-1075.
Lock, J.W.; Thompson, D.R.; Furness, R.W. and Bartle, J.A. 1992. Metal concentrations in seabirds
of the New Zealand region. Environ. Pollut., 75:289-300.
Nicholson, J.K. and Osborn, D. 1983. Kidney lesions in pelagic seabirds with high tissue levels of
cadmium and mercury. Journal of Zoology, 200:99-118.
Ϯϯϵ
EFECTOS DE LOS EXTRACTOS ACUOSOS DEL LIQUEN U.
aurantiaco Y MUSGO W. sarmentosa SOBRE MODELOS
MOLECULARES DE MEMBRANAS CELULARES
(Effects of the aqueous extracts of the lichen U. aurantiaco and moss W.
sarmentosa in cell membrane molecular models)
a
Suwalsky, M., abOsorio, P., bAvello, M., cVillena, F., dStrzalka, K.
a
Facultad de Ciencias Químicas, Universidad de Concepción, Concepción, Chile
b
Facultad de Farmacia, Universidad de Concepción, Concepción, Chile
c
Facultad de Ciencias Biológicas, Universidad de Concepción, Concepción, Chile
d
Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Krakow, Poland.
La Antártica es el continente más frío y seco, con vientos que superan los 50 nudos y tiene
la mayor altura promedio. Es considerada un desierto, con precipitaciones anuales de 200
mm sobre la costa, y sólo los seres vivos adaptados al frío pueden sobrevivir allí. La flora
consiste en gran medida de líquenes, briofitas, algas y hongos, que habitualmente crecen en
verano. Hoy en día se han identificado más de 200 especies de líquenes y 50 de briofitas; y
sólo se conocen dos especies de plantas florales. El crecimiento de las plantas esta inhibido
por las bajas temperaturas, pobre calidad solar, sequías prolongadas, altas radiaciones
solares, en especial de rayos UV-B, y por la oscuridad del invierno (Øvstedal y Lewis,
2001). Estas condiciones extremas incrementan la formación de especies reactivas del
oxígeno (ROS), por lo tanto las plantas y líquenes deben contener importantes cantidades
de antioxidantes para protegerse del daño causado por la oxidación (Wilson y Brimble,
2008). Para poder sobrevivir los organismos desarrollan varios mecanismos de defensa,
algunos de ellos involucran biosíntesis de metabolitos secundarios. Se ha reportado que los
musgos y liquenes en la antártica son ricos en antioxidantes lipofilícos. En particular el
liquen Usnea aurantiaco contiene 2.19 µ /gps α-tocoferol y el musgo Warnstorfia
sarmentosa 88.4 µ/gps α-tocoferol y 1.2 µ /gps de γ-tocoferol (Strzalka et al. 2011).
MATERIALES Y MÉTODOS
U. aurantiaco y W. sarmentosa fueron recolectadas en las islas antárticas Rey Jorge y
Ardley durante el verano de 2010. El musgo fue identificado por el profesor Ryszard
Ochyra del Instituto de Botánica Wladyslaw Szafer de la Academia Polaca de Ciencias
(Cracovia, Polonia), y el liquen por la profesora María Olech del Instituto de Botánica de la
Universidad Jagiellonian (Cracovia, Polonia). A partir de estas especies se obtuvo un
extracto acuoso que posteriormente fue liofilizado. Estos extractos fueron estandarizados
mediante la determinación de polifenoles totales por el método de Folin-Ciocalteu
(Velioglu et al. 1998). Además, se realizó un screening con reacciones fitoquímicas para
conocer la naturaleza de algunos de los compuestos presentes en los extractos. Se
determinó el efecto de los extractos sobre la morfología de eritrocitos humanos, incubando
distintas concentraciones de U. aurantiaco y W. sarmentosa con una suspensión de
eritrocitos obtenidos de un donante sano sin tratamiento farmacológico. Las muestras se
examinaron mediante un microscopio electrónico de barrido (Etec Autoscan, Etec. Corp.,
Hayward, CA, USA and JEOL JSM-6380LV, Japan) (Suwalsky et al, 2008).También se
realizó un análisis de los efectos que producen los extractos acuosos en multibicapas de
dimiristoilfosfatidilcolina (DMPC) y dimiristoilfosfatidiletanolamina (DMPE) (Avanti
Polar Lipids ALA, USA), clases de fosfolípidos presentes respectivamente en monocapas
ϮϰϬ
externas e internas de membranas celulares. Para ello se incubaron ambos lípidos con
distintas concentraciones de los respectivos extracto a 30 y 60 ºC, tras lo cual se sometieron
a difracción de rayos X en capilares de vidrio (Glas-Technik & Konstruktion, Berlin,
Germany) durante 25 minutos a 19 ± 1 ºC, utilizando radiación CuK (λ=1.52 Å) con filtro
de Ni proveniente del generador de rayos X Bruker Kristalloflex 760 (Germany). Las
intensidades de las reflexiones fueron obtenidas mediante un detector lineal sensible a
posición (MBraun PSD 50 M, Germany) y procesadas por el software ASA (Suwalsky et
al, 2008). La capacidad antioxidante de los extractos frente al ácido hipocloroso (HClO) se
estudió indirectamente por medio de la cuantificación de hemoglobina libre producida por
la lisis de eritrocitos, utilizando tres concentraciones distintas de agente oxidante (0,05,
0,25 y 0,5 mM). Para el estudio se obtuvieron 10 mL de sangre de un donante sano sin
tratamiento farmacológico. Tras la incubación con las distintas concentraciones de extracto
se agregó una alícuota de HClO necesaria para obtener las concentraciones de estudio. La
hemoglobina liberada por lisis de eritrocitos se cuantificó midiendo la absorbancia a 540
nm (Bausch & Lomb SP2000UV, USA) (Suwalsky et al. 2007). Actualmente se encuentran
en proceso un estudio de identificación de algunos compuestos presentes en los extractos
pertenecientes a la familia de flavonoides y alcaloides, mediante HPLC/MS y actividad
ORAC. De forma adicional, se realizará un estudio mediante espectroscopía de
fluorescencia en vesículas unilamelares grandes (LUV) de DMPC y membranas no selladas
de eritrocitos humanos (IUM) incubados con diferentes concentraciones de los extractos
acuosos de las especies en estudio. Para ello se utilizarán los fluoróforos Laurdan (6Dodecanoil-2-dimetilaminonaftaleno), mediante el que se determinará el parámetro
Polarización Generalizada (PG), y DPH (1,6-Difenil-1,3,5-hexatrieno), que determinará la
Anisotropía (r). Las mediciones serán realizadas en un espectrofluorímetro multifrecuencial
de desplazamiento de fases y modulación modelo K2 (ISS Inc., USA) (Parasassi et al,
1990).
RESULTADOS
El screening realizado mediante reacciones fitoquímicas reveló la presencia de alcaloides,
presentes en mayor cantidad en Usnea aurantiaco. Por otra parte, resultó negativo para la
presencia de taninos, cumarinas, flavonoides y saponinas en ambos extractos. Cabe destacar
que estas pruebas son cualitativas. Además Warnstorfia sarmentosa contiene gomas y
mucilagos mientras que esta reacción resultó negativa para U. aurantiaco. El contenido
total de polifenoles determinado por el método de Folin-Ciocalteu fue de 0.09 mM EAG en
Usnea aurantiaco y de 1.56 mM EAG en Warstorfia sarmentosa. El estudio por
microscopía electrónica de barrido reveló los siguientes cambios morfológicos inducidos
por el extracto acuoso de U. aurantiaco cuyas concentraciones están expresadas en EAG:
Ϯϰϭ
Figura 1: Eritrocitos humanos afectados por diferentes concentraciones de U. aurantiaco.
Human erythorcytes affected by different concentrations of U. aurantiaco.
Control (Glóbulos rojos (GR) incubados en suero fisiológico)
0.025 mM: estomatocitosis; además, hay knizocitos, un equinocito y algunos normocitos.
0.05 mM: estomatocitosis; además hay knizocitos, equinocitos, y algunos normocitos.
0.1 mM: esferocitosis; hay algunos knizocitos y crenocitos.
0.2 - 0.3 - 0.4 - y 0.5 mM: estomatocitosis en etapa de lisis celular.
Los resultados con extractos de W. sarmentosa fueron los siguientes:
Figura 2: Eritrocitos humanos afectados por diferentes concentraciones de W.sarmentosa. Human
erythrocytes affected by different concentrations of W. sarmentosa.
ϮϰϮ
Control (Glóbulos rojos incubados en suero fisiológico).
0.4 mM: estomatocitos y equinocitos; además, algunos normocitos.
0.8 mM: estomatocitos, knizocitos y equinocitos; no se observan normocitos.
1.5 mM: la mayoría son estomatocitos; también hay knizocitos, ambos con áreas de
crenación.
3.0 mM: estomatocitos, esferoestomatocitos y knizocitos, con áreas de crenación.
4.5 mM: esferoestomatocitos, esferocitos y knizocitos. Todos presentan áreas de crenación.
El estudio por difracción de rayos X muestra una disminución en las intensidades de
reflexión del DMPC tanto para U. aurantiaco como para W. sarmentosa. Mientras que para
DMPE no se observan cambios significativos.
(WA)
(LA)
DMPE+
DMPC+
H2O
H2O
0,1 mM EAG
0,025 mM EAG
Relative Intensity
0,05 mM EAG
(WA)
DMPE+
H2O
Extracto de Usnea
Extracto de Usnea
Relative Intensity
(LA)
(WA)
0,05 mM EAG
0,1 mM EAG
Extracto de Warnstorfia
Relative Intensity
(LA)
0,8 mM EAG
1,5 mM EAG
0,2 mM EAG
0,3 mM EAG
0,2 mM EAG
3 mM EAG
0,4 mM EAG
0,3 mM EAG
4.2
56.4
Observed Spacing (Å)
(LA)
4,5 mM EAG
0,5 mM EAG
64.5 32.0
4.20
Observed Spacing (Å)
56.4
4.2
Observed Spacing (Å)
(WA)
DMPC+
H2O
Relative Intensity
Extracto de Warnstorfia
0,4 mM EAG
0,8 mM EAG
1,5 mM EAG
3 mM EAG
4,5 mM EAG
64.5 32.0
4.20
Observed Spacing (Å)
Figura 3: Efectos de los extractos acuosos de U.aurantiaco y W.sarmentosa sobre multiibicapas de DMPC
y DMPE.
Effects of the aqueous extracts of U. aurantiaco and W. sarmentosa in multibilayers of DMPC and DMPE.
Ϯϰϯ
Por otra parte, el estudio de capacidad antioxidante por hemólisis no mostró un efecto
protector del extracto frente a la lisis producida por el agente oxidante.
DISCUSION
Los polifenoles son extensamente estudiados por sus conocidas propiedades antioxidantes.
La cantidad de polifenoles totales encontrada en U. aurantiaco y W. sarmentosa fue
bastante menor que las que se encuentran en plantas mayores (Strzalka et al. 2011). Sin
embargo, se hace necesaria la identificación de estos compuestos y la realización de
pruebas de capacidad antioxidante para determinar el verdadero potencial de estos
compuestos presentes en las especies analizadas. El estudio por microscopía electrónica de
barrido mostró en el caso de U. aurantiaco una potente interacción con la membrana de los
eritrocitos induciendo principalmente la formación de estomatocitos. Estos se originan por
la inserción de moléculas presentes en el extracto con la monocapa interna de la membrana.
A medida que aumenta la concentración se observa un mayor efecto, el que finalmente
provoca la lisis celular. Por otra parte, W. sarmentosa induce la formación
mayoritariamente de estomatocitos con crenaciones, lo cual indicaría una interacción del
fitocomplejo tanto con la monocapa interna como externa de la membrana celular. Sin
embargo, no se observó la toxicidad de U. aurantiaco. Es por esta razón, que se vuelve
importante la identificación de los alcaloides presentes en estos extractos, ya que son
conocidos sus grandes efectos biológicos y toxicidad. El estudio por difracción de rayos X
mostró disminuciones en las intensidades de las reflexiones de DMPC para ambos
extractos. Esto indica que los compuestos presentes en los fitocomplejos interaccionarían
preferentemente con la monocapa externa de la membrana celular, aumentando su fluidez.
Para complementar estos datos se esperan los resultados por espectroscopía de
fluorescencia. El estudio de capacidad antioxidante no reveló un efecto protector frente a la
oxidación provocada por HClO. Este estudio se corroborará con los resultados que se
obtendrán de actividad ORAC.
CONCLUSIONES
- Las especies en estudio contienen polifenoles y alcaloides. El contenido de
polifenoles totales determinado por el método de Folin-Ciocalteu es de 0.09 mM
EAG en Usnea aurantiaco y de 1.56 mM EAG en Warstorfia sarmentosa.
- Los fitocomplejos inducen cambios en la morfología de eritrocitos humanos, lo que
se explica por su inserción en sus membranas.
- Los resultados obtenidos por difracción de rayos X, indican los fitocomplejos
interaccionan con DMPC, clase de lípido que se ubica preferentemente en la
monocapa externa de eritrocitos humanos
- Los fitocomplejos no presentaron propiedades antioxidantes frente a HClO.
AGRADECIMIENTOS
Proyecto FONDECYT 1090041.
REFERENCIA BIBLIOGRÁFICA
•
Øvstedal, D. Lewis Smith, R. 2001. Lichens of Antarctica and South Georgia. Cambridge University
Press, Cambridge.
Ϯϰϰ
•
•
•
•
•
•
Suwalsky, M. Vargas, P. Avello, M. Villena, F. Sotomayor, C. 2008. Human erythrocytes are
affected in vitro by flavonoids of Aristotelia chilensis (Maqui) leaves. International Journal of
Pharmaceutics 363: 85-90.
Parasassi, T., de Stasio, G., d’Ubaldo, A., Gratton, E. 1990. Phase fluctuation in phospholipid
membranes revealed by laurdan fluorescence, Biophysical Journal, 57: 1179-1186.
Suwalsky, M. Orellana, P. Avello, M. Villena, F. 2007. Protective effect of Ugni molinae Turcz
against oxidative damage of human erythrocytes. Food and Chemical Toxicology, 45: 130-135.
Strzalka, K. Szymanska, R. Suwalsky, M. Prenyllipids and pigments content in selected antartic
lichens and mosses. J.Chil.Chem.Soc. 56, Nº 2, 2011 (En prensa).
Velioglu, Y., Mazza, G., Gao, L., Oomah, B. 1998. Antioxidant activity and total phenolics in
selected fruits, vegetables, and grain products, Journal of Agricultural and Food Chemistry, 46 (10):
4113-4117.
Wilson, Z. Brimble, M. 2008. Nat. Prod. Rep. 26, 44.
Ϯϰϱ
ESTIMACION DE LA ACTIVIDAD DIARIA DE LA LAPA NACELLA
CONCINNA, DEL ERIZO STERECHINUS NEUMAYERI Y OTROS
ORGANISMOS IN SITU
Daily activity of the Antarctic limpet Nacella concinna, the sea urchin Sterechinus
neumayeri and other organisms in situ.
Schories, D.1, Sack, A.2, Garrido, I.1, Heran, T.1, Holtheuer, J.1 & Kappes, J.1
1
Instituto de Cs. Marinas y Limnológicas, Avda. Inés de Haverbeck, casas 9, 11 y 13, Campus Isla Teja, Valdivia
Multiscale Simulations Engineering of Advanced Materials, Friedrich-Alexander University Erlangen-Nürnberg, Germany
2
El inicio de fotografías submarinas ya fue en los años 1850, usando platos de vidrio como
medio. Los primeros cascos submarinos para cameras fotográficas y de video fueron
construidos a finales de los años 1940, y en el año 1949 la famosa camera submarina
Rolleimarin con origen de Alemania llegó al mercado. Cuando el buceo con botellas se
inicio, los primeros documentales del ambiente marítimo fueron publicados (ver Shortis et
al. 2007, y referencias allí). A principios de los años 1980 varios biólogos marinos iniciaron
experimentos y ejecutaron mediciones de tamaño de animales usando imágenes submarinas
y videograbaciones como un instrumento no destructivo (Done, 1981; Boland y Lewbell,
1986; Schories et al. 2011, Schories & Niedzwiedz, aceptado). Desde finales de los años
1990 cámaras digitales han estado en el uso para trabajos submarinos, como monitoreo
ambiental, mapeo del fondo del mar y estudios de comportamiento. Sin embargo las
resoluciones de cámaras de vídeo tradicionales son restringidas por su formato de emisión,
PAL o y NTSC. Sólo recién han llegado cámaras de vídeo de una resolución de 1920 x
1080 px al mercado, pero ellas a menudo carecen de la opción de grabar en intervalos por
varios horas sin componentes adicionales, de una hardware externo como por ejemplo el
sistema Focus Firestore que incluye esta posibilidad para de grabación.
SITIOS DE TRABAJO
(1) Islote SHOA, Bahia Fildes, Isla Rey Jorge
(2) San Isidro, Estrecho de Magallanes
(3) Caleta la Arena, Puerto Montt, X Region
MÉTODOS
Realizamos dos experimentos para medir la actividad de erizos de mar y lapas submareales.
La metodología de videograbación estuvo usada en la Región Antárctica, adicionalmente
nosotros tomamos en Seno de Reloncaví secuencias de fotos de alta resolución (Figura 1).
El movimiento diario del erizo de mar antártico Sterechinus neumayeri (Meissner, 1900) y
la lapa Nacella concinna (Strebel, 1908) fue estudiado en la Bahía Fildes (Isla Rey Jorge,
Antártida) in situ. Una Sony DCR-TRV 900, cámara de vídeo digital, fue instalado en una
profundidad de 8 m y fue programado para la grabación de intervalo (1 segundo de
grabación cada 2 minutos). La grabación fue realizada entre el 21 y 28 de Febrero 2011
entre 12:30-18:30 hrs. En total cinco grabaciones fueron realizadas. Bitmap de imagines
fueron extraídos de cada archivo en cada intervalo de grabación de vídeo y analizados con
el plugin, manual tracking, del software ImageJ vers. 1.44. Dónde al menos 3 individuos
de S. neumayeri y 5 ind. de N. concinna fueron analizados. Usamos el mismo diseño
Ϯϰϲ
experimental en el Seno de Reloncaví, pero hicimos grabaciones adicionales con una foto
cámara de alto resolución (NIKON D70s) para registrar la actividad de los erizos de mar
Loxechinus albus (Molina, 1782) y Arbacia dufresni (Blainville 1825) durante la noche.
Usamos un control externo de grabación de intervalo autoconstruida que uso la entrada de
control remoto de la cámara para ejecutar las grabaciones en lapsos de tiempo (Figura 2).
RESULTADOS & DISCUSIÓN
Las investigaciones de la movilidad y el comportamiento de organismos acuáticos por
grabaciones en lapso de tiempo se han estado usados mucho en experimentos de laboratorio
(Schütz & Taborsky 2003). Sin embargo Thompson & Riddle (2005) mostraron que
resultados obtenidos de organismos cultivados en un acuario pueden ser significamente
diferente comparado con experimentos realizados en situ. Los autores estudiaron la
movilidad de erizo de mar Abatus ingens Koehler, 1926 durante un período de 24 hrs. in
situ y en el acuario. Los erizos estaban períodos de tiempo prolongados inmóviles (16.7 h)
y períodos de tiempo cortos en movimiento (7.3 h), mientras los erizos observados en el
acuario gastaban la mitad del tiempo moviéndose y el otro a mitad estaban inmóvil.
Además, la velocidad media de los animales era más rápida en el acuario que in situ.
Nuestros resultados preliminares demuestran que el movimiento diario de la lapa antártica
N. concinna varía in situ entre inactividad total y un movimiento máximo de 42 cm h-1.
Pequeños individuos de N. concinna (1.92 ± 0.45 cm de largura) demuestran la misma
actividad que el erizo de mar S. neumayeri (3.30 ± 0,75cm de diámetro) (Figura 3). Sin
embargo esta actividad no siempre está relacionada con el movimiento, pero si con el
comportamiento alimenticio de las lapas. Sin embargo un rastreo adecuado de pequeños
individuos no siempre fue posible, debido a la resolución restringida de la cámara de vídeo
(PAL, 720 x 576 px). Al contrario, la grabaciones en intervalos en el Seno de Reloncaví
con la cameras Nikon D70s (3000 x 2000 px) permitieron el análisis de imagen más
detallado, sobre todo bajo el aspecto que un flash externo es usado para iluminar el área del
interés. Una iluminación artificial del área de interés durante la videograbación no fue
realizada por nosotros, porque esto requiere un complejo diseño incluyendo un ordenador
electrónico para controlar la operación de la cámara (Thompson & Riddle 2005).
Las medidas exactas del movimiento dependen, sin embargo, en todos los experimentos de
la posición precisa vertical del sistema de la cámara en relación al fondo. Cualquier
inclinación del fondo resulta ser una subestimación de distancias recorridos de los
animales. Este error aumenta en individuos pequeños (aquí lapas contra erizos de mar).
AGRADECIMIENTOS
El apoyo financiero fue concedido por el Instituto Antárctico Chileno (Proyecto T21-09), el
DID, UACh, e el DAAD.
REFERENCIA BIBLIOGRÁFICA
•
•
•
Boland, G. S., Lewbell, G. S. (1986). The estimation of demersal fish densities in Biological surveys
using underwater television systems. Oceans '86, 1. Systems, Structures and Analysis, IEEE
Publishing Services, New York, pp 9-13.
Done, T. J. (1981). Photogrammetry in coral reef ecology: A technique for the study of change in
coral reef communities. Fourth International Coral Reef Symposium, Manila, pp 315-320.
Schütz, D., Taborsky M. (2003). Adaptations to an aquatic life may be responsible for the reversed
sexual size dimorphism in the water spider, Argyroneta aquatica. Evolutionary Ecology Research, 5:
105–117.
Ϯϰϳ
•
•
•
•
Schories, D., Niedzwiedz, G. (2011). Precision, accuracy and application of diver towed underwater
GPS receivers. Environmental Monitoring and Assessment.
Schories, D., Reise, K. Sanamyan, K., Sanamyan, N. Clasing, E., Reise, A. (2011). Actinian
dominated intertidal mudflats: A universally outstanding phenomenon from Southern Chile. Journal
of Sea Research 65:304-314
Shortis, M. R., Harvey, E. S., Seager, J. W. (2007). A review of the status and trends in underwater
videometric measurement. Invited paper, SPIE Conference 6491, Videometrics IX, IS&T/SPIE
Electronic Imaging, San Jose, California, USA, 26 pages.
Thompson, B.A.W., Riddle, M.J. (2005) Bioturbation behaviour of the spatangoid urchin Abatus
ingens in Antarctic marine sediments. Marine Ecology progress Series. 290: 135–143, 2005
Figura 1. Instalación de una camera de video SONY TVR 995 en el Seno de Reloncaví
(Installation of a video camera in Seno de Reloncaví)
Figura 2. Microcontrolador para programar el
lapso de tiempo.
(Microcontroler to control time lapse intervals)
Ϯϰϴ
Figura 3. Comparacion de movimientos en cm min-1 de Nacella concinna y Sterechinus neumayeri en la
Bahia Fildes. (Comparison of the movement cm min-1of Nacella and Sterechinus in Fildes Bay )
Ϯϰϵ
EXPANSIÓN DEL PASTO ANTÁRTICO, EN EL
ARCHIPIÉLAGO DE LAS SHETLAND DEL SUR Y LA
PENÍNSULA ANTÁRTICA, REVISITADA
(Antarctic hairgrass expansion, in the South Shetland archipelago and
Antarctic Peninsula, revisited)
Torres-Mellado, G. A.1, Jaña, R.2 & Casanova-Katny, M. A.3
2
1
Departamento de Botánica, Universidad de Concepción, casilla 160 C, Concepción, Chile
Departamento Científico - Instituto Antártico Chileno, y Fundación Centro de Estudios del Cuaternario Fuego-Patagonia y Antártica
(CEQUA), Punta Arenas, Chile
3
Centro de Biotecnología, Universidad de Concepción, casilla 160 C, Concepción Chile
Populations of both native higher Antarctic plants, Deschampsia antarctica and
Colobanthus quitensis, increased during the last decades. However, for D. antarctica,
previous population studies on the South Shetland Islands and the Antarctic Peninsula have
been too sporadic, patchy and methodologically different to allow general conclusions. Our
aim was to compare sites with D. antarctica along a North-South latitudinal transect with
an integral census method to assess the possible impact of climatic change on grass
population dynamics. During two summer seasons (2009-2010), plant populations were
censed on Fildes and Coppermine Peninsula and several localities on the west coast of the
Antarctic Peninsula. Largest plants populations were found on Fildes Peninsula with
vegetation cover (VC) of 44-46%. Six out of eleven stands of D. antarctica on Coppermine
Peninsula were new records, with increasing plant number and VC (0.1-22%). In the
Antarctic Peninsula, contrarily to our expectation, only at Forbes Point D. antarctica VC
was relatively high (ca. 2%) and a new stand of Colobanthus quitensis was found. At three
previously reported sites, plants had disappeared. Our monitoring confirms, that northern
D. antarctica populations are expanding, but that this expansion is not continuous along the
Antarctic Peninsula and inconsistent with the gradient of relative temperature increase in
North-South direction. We suggest that other abiotic and biotic factors are influencing the
colonization and expansion of vascular plants in this particular ecosystem.
INTRODUCCIÓN
El continente antártico está experimentando una de las tendencias más veloces de aumento
de temperaturas en la Tierra; y el calentamiento regional es especialmente pronunciado en
la Península Antártica, con una tendencia de +0.56°C por década, y el calentamiento más
marcado ocurriría desde la parte más austral de la Península Antártica occidental hasta el
norte de las islas Shetland del Sur (Turner & Overland 2009).
Un efecto del incremento de las temperaturas es el aumento en la disponibilidad de agua,
proveniente tanto de las precipitaciones como del derretimiento de los glaciares. En este
escenario la flora nativa Antártica ha sido capaz de colonizar el suelo expuesto,
aumentando el tamaño de sus poblaciones y expandiendo su distribución local (Fowbert &
Smith 1994; Gerighausen et al. 2003; Convey & Smith 2006).
Las dos especies de plantas vasculares antárticas Deschampsia antarctica Desv. y
Colobanthus quitensis (Kunth) Bartl., han sido el foco de varios estudios en los años
recientes ya que se consideran bioindicadores de calentamiento regional (Fowbert & Smith
1994). Sin embargo, existen pocos estudios que reporten los cambios del tamaño de las
poblaciones de la flora Antártica. Tres áreas principales han sido censadas: la isla Signy
ϮϱϬ
(Islas Orcadas del Sur), Península Fildes en la isla Rey Jorge (Islas Shetland del Sur) y el
archipiélago de las islas Argentinas. Varios estudios han reportado que desde que el
calentamiento regional es más pronunciado, existiría una correlación con el aumento de las
poblaciones de D. antarctica y C. quitensis. Experimentos de calentamiento pasivo han
reportado una mayor tasa de crecimiento y reproducción, además también aumenta la
maduración de semillas, la germinación y la viabilidad de las plántulas (Day et al. 2009,
Smith 1994), lo anterior explicaría la respuesta de las poblaciones naturales.
El objetivo principal de este estudio fue censar y documentar la distribución actual y
tamaño de las poblaciones de D. antarctica a lo largo de un transecto latitudinal desde las
islas Shetland del Sur hasta la Bahía Paraíso, en la Península Antártica occidental, y
comparar estos datos con reportes previos. Estuvimos especialmente interesados en saber si
sitios lejos de la Península Fildes mostraban patrones similares de procesos de expansión,
principalmente las poblaciones de la isla Robert, de donde solo existe un reporte (Casaretto
et al. 1994) Más aún, censamos las poblaciones de áreas previamente descritas pero que
nunca habían sido censadas en las cercanías de la Bahía Paraíso.
MATERIALES Y MÉTODOS
El trabajo de terreno se desarrolló durante la Expedición Científica Antártica de dos años
(2009 y 2010). Los sitios censados fueron isla Rey Jorge (62º00'S, 58º15'W) e isla Robert
(62º24'S, 59º30'W) en las islas Shetland del Sur; y en la Península Antártica en las
cercanías de la Bahía Paraíso (64º51'S, 62º54'W). En isla Rey Jorge se consideraron las
poblaciones más grandes y antiguas de la Península Fildes ubicadas en Punta Nebles y
Bahía Collins, de las cuales se tienen registros previos. En isla Robert se censaron las
poblaciones de la Bahía Carlota y Bahía Coppermine previamente reportadas por (Casaretto
et al. 1994). En la Península Antártica se visitaron sitios previamente reportados por
Komárkova et al. (1985, 1990) y se visitaron sitios no descritos anteriormente.
Se contó el número de colonias en cada sitio, en cada una, además, se contó el número de
plantas y se lanzaron cuadrantes al azar (n=20-30) en todas direcciones en los que se midió
el área de cada planta. Luego el tamaño de cada planta se asignó a una de cinco clases (050, 50-150, 150-250, 250-500, >500 cm2) y se calculó la frecuencia de cada clase para cada
población. Las distribuciones de clases de tamaño para cada sitio fueron comparadas con un
test Chi cuadrado. Además, otras características de los sitios como georeferencia, altitud,
características ecológicas fueron registradas.
RESULTADOS
En Bahía Collins y Punta Nebles, Península Fildes, se encontraron grandes poblaciones de
D. antarctica con varias especies de musgos dominando la comunidad y formando carpetas,
frecuentemente inundadas; algunas plantas aisladas se encontraron cerca de la morrena del
glaciar Collins. La cobertura vegetal en Bahía Collins alcanza el 46% y en Punta Nebles,
43%.
Ϯϱϭ
ϳϬϬ
En isla Robert, se censaron dos
sitios de la Península Coppermine,
ϲϬϬ
Bahía Carlota y Bahía Coppermine.
ϱϬϬ
En Bahía Carlota se encontraron 6
colonias de plantas, 4 de ellas
ϰϬϬ
nuevos registros. Las 2 colonias
ϯϬϬ
más grandes, con una cobertura
entre ca. 3 y 8% y más de 2800
ϮϬϬ
plantas corresponderían a las
previamente descritas. En las
ϭϬϬ
colonias
restantes,
las
más
Ϭ
pequeñas, las plantas crecen
ϳϬϬ
dispersas sobre el suelo desnudo.
b
ŽƉƉĞƌŵŝŶĞŽǀĞ
Por otro lado, en Bahía Coppermine
ϲϬϬ
ĂƌůŽƚĂŽǀĞ
las colonias son las más grandes de
ϱϬϬ
la isla Robert. Encontramos sólo 5
sitios de los reportados debido a la
ϰϬϬ
presencia de nieve. Dos de estas
ϯϬϬ
colonias son nuevos registros; las
otras tres corresponden a sitios
ϮϬϬ
previamente descritos, dos de las
cuales poseen la mayor cobertura,
ϭϬϬ
alcanzando el 22%, y más de 4000
Ϭ
plantas.
ϬͲϱϬ
ϱϬͲϭϱϬ
ϭϱϬͲϮϱϬ ϮϱϬͲϱϬϬ
хϱϬϬ
En Bahía Paraíso se exploraron 10
^ŝnjĞĐůĂƐƐ;ĐŵϮͿ
sitios. Se confirmó la presencia de
Figura 1. Estructura de clases de tamaño de las colonias de
D. antarctica en 3 de 7 sitios
Deschampsia antarctica en a) isla Rey Jorge y b) isla Robert.
reportados por Komárkova et al.
(1985, 1990). En los otros 3 sitios
Figure 1. Size structure of Deschampsia antarctica stands
en la costa Danco no se
at a) King George Island and b) Robert Island.
encontraron plantas ya que los
sitios estaban cubiertos por hielo
proveniente del glaciar y nieve. También exploramos 3 nuevos sitios en los que no
encontramos plantas vasculares. El número de colonias en general es menor y son más
pequeñas que en las islas Rey Jorge y Robert y se limitan a grietas de difícil acceso. Se
encontró una nueva colonia de C. quitensis en Punta Forbes creciendo en asociación con D.
antarctica y musgos de varias especies; en este sitio la cobertura de D. antarctica alcanzó
el 2,4%, perteneciendo completamente a la primera clase de tamaño. La distribución de
clases de edad estuvo fuertemente influenciada por el sitio, siendo las clases más pequeñas
las predominantes, sobre todo en isla Robert (Fig. 1)
ŽůůŝŶƐ,ĂƌďŽƵƌ
EĞďůĞƐWŽŝŶƚ
&ƌĞƋƵĞŶĐLJ
a
DISCUSIÓN Y CONCLUSIONES
Nuestros resultados sugieren que la colonización y expansión de D. antarctica no es un
fenómeno generalizado en la Península Antártica y que para una visión más completa será
necesario censar varios sitios a lo largo de un gradiente latitudinal durante la misma
temporada de crecimiento, y usando métodos estandarizados.
ϮϱϮ
En general, la alta frecuencia de la clase de tamaño menor indica que la isla Robert estaría
en un proceso de colonización temprana y que la población de D. antarctica aún se está
expandiendo.
Los datos climáticos muestran una tendencia de aumento relativo de las temperaturas desde
el norte hacia el sur de la Península Antártica, pero contrario a lo que se puede esperar, la
expansión de las plantas es más marcada en las poblaciones más al norte, probablemente
como un resultado del efecto combinado del calentamiento y el aumento de las
precipitaciones. Una posible explicación para el bajo número de plantas en las colonias de
la Península es que la temperatura aumenta considerablemente durante el invierno,
aumentando la temperatura anual, pero durante la temporada de crecimiento no cambia
sustancialmente, reduciendo su impacto sobre las plantas. Probablemente la acumulación de
hielo y nieve también ha reducido el número de sitios adecuados para la colonización en
esta área.
AGRADECIMIENTOS
A INACH y Base Julio Escudero; a la dotación de la base Gabriel González Videla
(2009/2010). A los briólogos Juan Larraín y Gloria Gallegos-Haro de la Universidad de
Concepción. Este estudio se realizó bajo el proyecto INACH T0307.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
•
Casaretto JA, Corcuera LJ, Serey I, Zúñiga G (1994). Ser Cient INACH 44:61–66
Convey P, Smith RIL (2006). Plant Ecol 182:1–10
Day TA, Ruhland CT, Strauss SL, Park JH, Krieg ML, Krna MA, Bryant DM (2009). Glob Change
Biol 15:1640-1651
Fowbert JA, Smith RIL (1994). Arctic Alpine Res 26:290-296
Gerighausen U, Bräutigam K, Mustafa O, Peter HU (2003) In: Huiskes AHL, Gieskes WWC,
Rozema J, Schorno RML, van der Vies SM, Wolf WJ (eds) Antarctic biology in a global context.
Backhuys, Leiden, pp 79–83
Komárková V, Poncet S, Poncet J (1985). Arctic Alpine Res 17:401–416
Komárková V, Poncet S, Poncet J (1990). Arctic Alpine Res 22:108–113
Smith RIL (1994). Oecologia 99:322–328
Turner J, Overland J (2009). Polar Res 28:146-164
Ϯϱϯ
CARACTERIZACIÓN DE BACTERIAS AISLADAS DESDE EL
LÍQUIDO CELÓMICO DEL ERIZO ANTÁRTICO Sterechinus
neumayeri
(Characterization of bacteria isolated from coelomic fluid of the
antarctic sea-urchin Sterechinus neumayeri)
Urtubia, R.1, Rojas, J.1, 2, Asencio, G.1, Lavín, P.3 & González, M.1
2
1
Laboratorio de Biorrecursos Antárticos, Instituto Antártico Chileno
Facultad de Cs. Agropecuarias y Forestales, Universidad de la Frontera
3
Fundación Científica y Cultural Biociencia
El erizo de mar Sterechinus neumayeri, es uno de los más abundantes en las aguas del mar
antártico, posee una distribución batimétrica de 5 hasta 750 metros de profundidad. Se
puede encontrar tanto en la Península Antártica como en islas subantárticas. Debido a su
abundancia, amplia distribución y fácil disponibilidad, este organismo ha sido utilizado
como un sistema modelo antártico en muchos campos de la biología, tales como: biología
evolutiva, embriología, ecología, fisiología y toxicología (Lee et al., 2004). Los
equinodermos son animales osmoconformadores, por lo tanto, pueden presentar en su
líquido celómico un medio interno similar al agua de mar, sin embargo, esta situación
podría ser diferente respecto a los microorganismos al interior de este, debido a la
capacidad de las bacterias de vivir dentro de hospederos y formar parte de una flora normal.
A la fecha existe poca información respecto a la flora normal presente en estos organismos
y no hay reportes de las comunidades bacterianas cultivables en equinodermos antárticos.
El objetivo de este trabajo es realizar una primera caracterización de la microflora
bacteriana cultivable asociada al líquido celómico del erizo antártico Sterechinus
neumayeri.
MATERIAL Y MÉTODOS
Aislamiento de cepas. Se extrajo líquido celómico de cinco ejemplares de Sterechinus
neumayeri. Estos se mezclaron en igual proporción y se tomaron alícuotas de 100 ˇ l, las
que inmediatamente fueron sembradas en medio de cultivo R2A, Agar Marino y Medio
Actinomicetes en quintuplicado. Las placas fueron incubadas por al menos diez días. A
medida que fueron visualizándose unidades formadoras de colonias éstas fueron aisladas en
medios de cultivo sólidos concordantes.
Caracterización microbiológica. Se reconocieron distintas morfologías según su
pigmentación, borde, forma y consistencia. Se realizó tinción Gram de cada una de las
cepas y el resultado de la observación al microscopio fue agregado a los datos
morfológicos. De acuerdo a estos criterios se seleccionaron proporcionalmente cepas
representativas del universo total para los análisis posteriores.
Extracción de Material Genético. A las cepas seleccionadas se les realizó extracción de
ADN ribosomal mediante el método de fenol-cloroformo. Se amplificó el gen 16S ADNr,
mediante PCR con partidores universales 16S Fw (5`-AGAGTTTGATCCTGGCTCAG-3´)
y 16S Rv (5´-CGGTTACCTTGTTACG ACTT-3´).
Tratamiento con enzimas de restricción RFLP. Con el objeto de disminuir el número de
muestras a secuenciar, se realizó el protocolo de RFLP (Restriction Fragment Length
Ϯϱϰ
Polymorphisms) sobre los productos de PCR del gen 16S ADNr, utilizando dos enzimas de
restricción: RSA I y ALU I, según las instrucciones del fabricante. Los fragmentos
digeridos fueron sometidos a electroforesis para observar los distintos patrones de bandas.
Los geles fueron fotografiados y analizados mediante técnicas computacionales. De cada
grupo de cepas que presentó un mismo patrón de cortes se escogió una representativa para
enviar su producto PCR del gen ADNr 16S a secuenciar.
Test de temperatura. Se evaluó el crecimiento de las mismas cepas enviadas a secuenciar
a 4º, 7º, 20º y 37ºC, inoculando en 200 µl de medio 10 µl de los cultivos en fase
exponencial. Se consideró como crecimiento positivo la presencia de turbidez en el cultivo.
Se realizaron observaciones a las 16, 24 y 48 hrs.
RESULTADOS
Se consiguió aislar un número importante de bacterias desde el líquido celómico del erizo
antártico Sterechinus neumayeri. En total se aislaron 276 cepas, 128 de éstas corresponden
al medio R2A (46%), 88 en Agar Marino (32%), y 60 cepas del medio Actinomycetes
(22%).
El análisis morfológico mostró una amplia diversidad, ya que en el medio R2A se
reconocieron nueve morfologías diferentes, diez en Agar Marino y once en medio
Actinomycetes. A su vez, el análisis de RFLP se realizó para 25 cepas provenientes de los
medio R2A y Agar Marino, mientras que la totalidad de las cepas aisladas desde el medio
Actinomicetes fueron analizadas por RFLP. Se obtuvieron 55 patrones de corte distintos,
distribuidos del siguiente modo: R2A: 13, Agar Marino: 15, medio Actinomycetes: 27.
La identificación de los distintos tipos bacterianos se realizó a partir de las secuencias
parciales obtenidas, lo que permitió establecer el género del 93% de las cepas (Figura 1).
Por BLAST se logró determinar la predominancia de bacterias pertenecientes a la clase
Flavobacteria (51%) mayoritariamente aquellas pertenecientes al género Flavobacterium.
Otro grupo importante correspondió a bacterias de la clase Gammaproteobacteria (46%),
predominando los géneros Pseudoalteromonas, Psychrobacter y Pseudomonas.
Finalmente, se logró aislar desde el medio actinomicetes dos cepas pertenecientes a la clase
Actinobacteria (3%), asociadas a los géneros Microbacterium sp. y Agreia sp., sin
embargo, este medio resulto no ser tan específico para actinomycetes ya que se recuperaron
bacterias pertenecientes a otras clases.
El 52 % de las cepas creció en un rango de 4º a 20ºC mientras que un 48% lo hizo de 4º a
37ºC. Las que corresponden al género Shewanella poseen el mismo comportamiento de
crecimiento, en cambio, las otras cepas pertenecientes a Flavobacterium, Pseudomonas,
Pseudoalteromonas y Psychrobacter, su rango de temperatura varió dentro del género,
creciendo hasta 20º o 37ºC.
Ϯϱϱ
Figura 1. Distribución de géneros de bacterias aislados desde el líquido celómico de Sterechinus
neumayeri. Distribution of bacterial genera isolated from coelomic fluid of Sterechinus neumayeri.
DISCUSIÓN
En los invertebrados antárticos es muy escasa la información respecto de la flora bacteriana
asociada. La mayoría de los estudios se han realizado con equinoideos de aguas tropicales o
temperadas. En el caso de equinodermos antárticos no hay información disponible por lo
que este es el primer estudio de este tipo. El interés por caracterizar las comunidad
bacteriana asociada en organismos marinos radica principalmente en la presencia de
bacterias patógenas y su posible implicancia en mortalidades masivas como en el caso de
Diadema atillarum (Lessios, 1988). En uno de los primeros estudios realizado por Unkles
(1977) se determinó que los géneros de bacterias predominantes en el líquido celómico de
otra especie de erizo de mar, Echinus esculentus, correspondió a bacterias del tipo Vibrio,
Pseudomonas y Aeromonas, aunque en bajas cantidades. Estas bacterias, junto con
Flavobacterium y Aeromonas son potenciales patógenos y pueden encontrarse
naturalmente en el interior o en las superficies de dichos organismos (Bauer y Agerter,
1987). En Paracentrotus lividus la flora está principalmente dominada por
gammaproteobacterias además de la presencia de Vibrios (Becker et al., 2008). La
presencia de bacterias del tipo Pseudoalteromonas, Psychrobacter y Flavobacterium es
concordante a los estudios realizados en muestras de agua y sedimentos marinos en
Antártica (Michaud et al., 2004). Sin embargo, la no presencia de Vibrios resulta llamativa
si se compara con erizos tropicales o de aguas templadas. No se descarta que este tipo de
bacterias estén asociadas más estrechamente con el sistema digestivo, por lo que futuros
estudios deberían de caracterizar otras regiones o tejidos en este erizo. La presencia de
actinomycetes también es llamativa por la capacidad de estos para producir compuestos
antibacterianos. Este estudio base de la microflora puede ayudar también a entender si las
comunidades bacterianas pueden cambiar como consecuencia de condiciones estresantes
como el aumento de la temperatura o de procesos de acidificación del Océano Austral,
parámetros que modificarían el equilibrio de las bacterias aeróbicas caracterizadas.
Ϯϱϲ
CONCLUSIONES
Las cepas aisladas del líquido celómico presentan una alta variabilidad genética
interespecífica entre los diversos grupos estudiados.
Las clases predominantes de la microflora estudiada fueron las flavobacterias y las
gammaproteobacterias, siendo el género predominante Flavobacterium con prácticamente
un 50% de las cepas aisladas.
Este estudio constituye el primer reporte de la microflora bacteriana cultivable asociada al
líquido celómico del erizo antártico Sterechinus neumayeri, información que se pretende
ampliar con el estudio en otros tejidos o regiones del erizo.
AGRADECIMIENTO
Proyecto Fondecyt 11090265.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
Bauer, J. C. y Agerter C. J. 1987. Isolation of bacteria pathogenic for the sea urchin Diadema
antillarum (Echinodermata: Echinoidea). Bulletin of Marine Science, 40(1):161-165.
Becker, P.T. Egea, E. y Eeckhaut, I. 2008. Characterization of the bacterial communities associated
with the bald sea urchin disease of the echinoid Paracentrotus lividus. Journal of Invertebrate
Pathology, 98(2):136-147.
Lee, Y. Song, M. Lee, S. Leon, R. Godoy, S. Canete, I. 2004. Molecular phylogeny and divergence
time of the Antarctic sea urchin (Sterechinus neumayeri) in relation to the South American sea
urchins. Antarctic Science, 16(1):29-36.
Lessios, H. A. 1988. Mass mortality of Diadema antillarum in the Caribbean: What have we
learned?. Annual Review of Ecology and Systematics, 19:371-393.
Michaud, L. Di Cello, F. Brilli, M., Fani, R. Lo Giudice, A. Bruni, V. 2004. Biodiversity of
cultivable psychrotrophic marine bacteria isolated from Terra Nova Bay (Ross Sea, Antarctica).
FEMS Microbiology Letters 230(1):63-71.
Unkles, S. 1977. Bacterial Flora of the sea urchin Echinus esculentus. Applied and Environmental
Microbiology, 34(4):347-350.
Ϯϱϳ
COMPARACION DE ABSORCION RADIOELECTRICA
RIOMETRICA EN LA ANTARTICA Y FLUJOS DE
ELECTRONES ENERGETICOS DE LA MISION THEMIS
(Comparison of Antarctic riometer radio wave absorption and
THEMIS mission energetic electron fluxes)
Vidal, S. E., Ovalle, E. M. & Foppiano, A. J.
Departamento de Geofísica, Universidad de Concepción, Chile
Over the December 2007 to March 2008 interval the five THEMIS satellites (Time History
of Events and Macroscale Interactions during Substorms; Burch and Angelopoulos, 2008)
were located well in the tail of the Earth´s magnetosphere during a significant part of their
orbital periods (apogees from about 10 to 30 Earth’s radii). The instruments on board
measured, among other quantities, the fluxes of energetic electrons for a range of energies.
Over the same interval several riometers (relative ionospheric opacity meter) located on the
Antarctic southern fringe of the auroral zone and on the polar cap measured auroral radio
wave absorption produced by the interaction between precipitating energetic electrons and
the atmosphere at heights of around 100 – 120 km.
The present report compares the time series of THEMIS electron fluxes and of riometer
absorptions in an attempt to find whether the electron fluxes could be considered as the
source of the absorptions.
Although similar comparisons have been made between THEMIS observations and
observations of other ground based instruments, such as magnetometers or all-sky cameras,
mostly in the northern hemisphere (e.g. Du et al., 2011; Liu et al., 2011), there is no
reference to the comparisons reported here.
DATA ANALYSES
The analysed electron fluxes and riometer absorption time series were selected so as to
correspond to intervals for which the satellites and the riometers were geomagnetically
conjugate. To determine conjugacy the T89 geomagnetic field model was used
(Tsyganenko, 1989). Computations were made with the TTRACE2IONO.PRO code (
http://sprg.ssl.berkeley.edu/~davin/idl/socware/external/IDL_GEOPACK/trace/ttrace2ino.p
ro; latest changes made by Patrick Cruce). Electron fluxes were downloaded from
http://themis.ssl.berkeley.edu/data/themis. Riometer absorptions were provided by A. T.
Weatherwax, Siena College, New York and correspond to the network of Automatic
Geophysical Observatories funded by the National Science Foundation, U.S.A.
All possible conjugacy intervals from 1 January to 31 March 2008 were identified and only
for six intervals both electron fluxes and riometer absorption were readily available. The
Table gives general information on these six intervals. In all but one interval, the
geomagnetic activity was fairly low (Kp between 1- and 3- ). Although conjugacy
inaccuracies derived from departures of the geomagnetic field from model values are most
likely they may be not too significant. Details of a sample interval are given in Figures 1 to
3. Figure 1 shows the locations of the five satellites in the GSM coordinate system
corresponding to 02:02 UT of 29 January 2008. The Antarctic footprints of the
geomagnetic field lines crossed by the THEMIS B satellite from 01:00 to 03:00 UT are
shown in Figure 2 together with the fields of view (at about a height of 100 km) of five
Ϯϱϴ
riometers. Figure 3 shows the absorption observed by riometers P2 and P3 (at 38.2 MHz)
and the electron fluxes observed using the ESA instrument (McFadden et al., 2008)
onboard the satellite (channels 24 to 32 corresponding to about 15 to 32 keV).
Table. General information on selected intervals of January-March 2008
Figure 1. Location of the five THEMIS
satellites in the GSM coordinate system at 02:02
UT of 29 January 2008. (a) XZ plane. (b) XY
plane.
Figura 1.Posición de los cinco satélites
THEMIS en el sistema de coordenadas GSM a
las 02:02 UT del 29 de Enero de 2008. (a) Plano
XZ. (b) Plano XY.
Figure 2. Field of view (at about 100 km
height) of Antarctic riometers on geographic
(black) and corrected geomagnetic (gray)
coordinate systems. Geomagnetic field line
footprint of THEMIS B satellite for the 01:00 –
03:00 UT of 29 January 2008 interval crossing
P3 riometer field of view (thick gray line).
Footprint at 02:02 UT highlighted.
Figura 2. Campo de visión (a unos 100 km de
altura) de riometros antárticos en sistemas de
coordenadas geográficas y geomagnéticas
corregida (gris). Traza de la línea de campo
geomagnético que pasa por el satélite THEMIS
B para el intervalo 01:00 – 03:00 del 29 de Enero
de 2008 que cruza el campo de visión del
riometro P3 (línea gris gruesa). La traza a
las 02:02 UT está destacada.
Ϯϱϵ
Figure 3. Ionospheric absorption at 38.2 MHz observed using P2 (85.67° S, 46.38 W) and P3 (82.75° S,
28.59° E) riometers and electron fluxes of 15 to 32 keV [channels 24 – 32] observed by the ESA instrument
on board THEMIS B satellites during 29 January 2008.
Figura 3. Absorción ionosférica a 38.2 MHz observado con los riometros, P2(85.67° S, 46.38 O) y
P3(82.75° S, 28.59° E) y flujo de electrones entre 15 y 32 keV [canales 24 – 32] observados por el
instrumento ESA del satélite THEMIS B durante el día 29 de Enero de 2008.
RESULTS
Although there are clear associations between fluxes and absorptions for some intervals
these do not necessarily correspond to conjugacy intervals. For example, no absorption
events are observed at P3 for the 29 January 01:00 to 03:00 UT interval, when intense
fluxes are observed in channels 25 and 26 of satellite B (Figure 3). Furthermore, absorption
events at P2 and P3 associated to fluxes in channels 24 and 25 (less clearly in channel 26)
are observed from about 03:00 to 04:45 and from 08:30 to 10:45. The P3 events being
shorter (start later and end earlier) and weaker. However, neither P2 nor P3 are
geomagnetically conjugate to satellite B during these intervals. Moreover, increased fluxes
in channels 27 and 28 and no significant fluxes in channels 24 to 26, a kind of spectra
hardening, are observed from about 05:15 to 07:20 and from 10:00 to 11:00. For these
intervals absorption events are observed. It is to be noted that during part of the first
interval intensification of auroral arcs are observed in northern hemisphere conjugate
locations (Liu et al., 2008).
CONCLUSIONS
Comparison between THEMIS mission tail season observations of tens of keV electron
fluxes and ground based Antarctic radio wave absorption observations have not been made
so far. These comparisons may be valuable since they relate to nighttime but sunlit
conditions (southern hemisphere summer). The few intervals analysed show that clear
associations between fluxes and absorptions for some intervals. However, these do not
ϮϲϬ
necessarily correspond to conjugacy intervals. The use of finer parameterization of
geomagnetic models to determine conjugacy may be need. An analysis of more intervals is
needed to draw more specific conclusions.
REFERENCES
•
•
•
•
•
•
Burch, J.L. and Angelopoulos, V. (Eds.) 2008. The THEMIS Mission, Space Science Reviews, 141:
Issues 1–4.
Du, A. M., et al. 2011. Fast tailward flows in the plasma sheet boundary layer during a substorm on 9
March 2008: THEMIS observations, Journal of Geophysical Research, 116, A03216,
doi:10.1029/2010JA015969.
Lui, A. T. Y., et al. 2008. Determination of the substorm initiation region from a major conjunction
interval of THEMIS satellites, Journal of Geophysical Research., 113, A00C04,
doi:10.1029/2008JA013424.
Liu, J., Angelopoulos, V., Kubyshkina, M., McFadden, J., Glassmeier, K.-H. and Russell, C.T. 2011.
Revised timing and onset location of two isolated substorms observed by Time History of Events and
Macroscale Interactions During Substorms (THEMIS), Journal of Geophysical Research, 116,
A00I17, doi:10.1029/2010JA015877.
McFadden, J.P., Carlson, C.W., Larson, D., Bonnell, J., Mozer, F., Angelopoulos, V., Glassmeier,
K.-H. and Auster, U. 2008. THEMIS ESA first science results and performance issues, Space
Science Reviews, 141:477-508.
Tsyganenko, N. A. 1989. A magnetospheric magnetic field model with a warped tail current sheet,
Planetary and Space Science, 37:5 –20.
.
Ϯϲϭ
VEEFECTO DE AUXINAS Y CITOQUININAS EM EL CULTIVO
DE TEJIDO DE AHNFELTIA PICATA (HUDSON) FRIES, 1836
(AHNFELTIALES, RHODOPHYTA): UNA ESPECIE DE
DISTRIBUCION BIPOLAR
(Effects of auxins and cytokinins on tissue culture of Ahnfeltia plicata
(Hudson) Fries, 1836 (Ahnfeltiales, Rhodophyta) a species with
bipolar distribution)
Villanueva, F.1, Ávila, M.1, Mansilla, A.2, 3, Abades, S.4, 5 & Cáceres, J.1
2
1
Instituto de Ciencia y Tecnología, Universidad Arturo Prat, Puerto Montt, Chile
Departamento de Ciencias y Recursos Naturales, Facultad de Ciencias, Universidad de Magallanes, Punta Arenas, Chile
3
Instituto de Ecología y Biodiversidad. Institute of Ecology & Biodiversity
4
Centro de Estudios Avanzados en Ecología y Biodiversidad (CASEB), P. Universidad Católica
5
Instituto de Ecología y Biodiversidad (IEB), U. de Chile
El desarrollo de técnicas de cultivo de tejido y protoplastos ha sido utilizado para la
manipulación genética y la micropropagación en macroalgas, tanto para mejorar los
cultivos acuícolas como para incrementar el conocimiento acerca de procesos de
diferenciación, morfogénesis y regeneración (Yokoya & Handro, 1996) y productos de
interés comercial (Reddy et al., 2008).
Desde hace algún tiempo, se han utilizado técnicas de cultivo in vitro para propagar
distintos genotipos de algas de interés económico. El avance en el conocimiento tanto sobre
la regulación hormonal como de la importancia de los diferentes factores sobre los procesos
fisiológicos en algas rojas, han jugado un papel fundamental para obtener éxito en la
propagación in vitro de muchas especies (Yokoya & Handro, 1997). Los reguladores de
crecimiento (PGR) actúan sobre procesos fisiológicos y han sido muy importantes para
determinar el control de éstos sobre el crecimiento y regeneración en algas (Yokoya &
Handro, 1996).
Ahnfeltia plicata (Hudson) Fries es una de las principales agarófitas comercialmente
importantes en países de altas latitudes (regiones polares), principalmente en las costas de
Rusia, explotada como una fuente de agar de alta calidad y bajo contenido de sulfato
(Maggs & Pueschel, 1989). En Chile, esta especie ocurre en las costas de la Región de
Magallanes y en forma similar a las poblaciones en Rusia, parece presentar un ciclo de vida
heteromórfico. El objetivo de este estudio es probar el efecto en crecimiento y regeneración
de 2 tipos de hormonas: 6- Bencilaminopurina (BAP) y ácido Indolacético (IAA) a través
de técnicas de cultivo in vitro de tejido intercalar y apical de A. plicata.
MATERIAL Y METODOS
De cada ejemplar se cortaron trozos de talos gametofíticos no reproductivos de 3 cm de dos
sectores: región apical y región intercalar, que fueron sonicados y enjuagados con solución
betadina 0,5%, con el fin de eliminar epífitos y microorganismos. Posteriormente, se
mantuvieron por 48 horas en penicilina/nistatina (Villanueva et al., 2010), con el fin de
eliminar bacterias y hongos, a una temperatura de 10ºC y con un fotoperiodo de 16:8 (luz:
oscuridad). Transcurrido ese tiempo, cada trozo fue cortado en explantes de
aproximadamente 5 mm que posteriormente fueron utilizados para los experimentos de
crecimiento con hormonas. Para el tratamiento control, se tomaron trozos de talos
ϮϲϮ
gametofíticos no reproductivos, los cuales fueron lavados en agua de mar esterilizada y
mantenidos en PES.
Se utilizaron dos hormonas de crecimiento, IAA (auxina) y BAP (citoquinina), a 3
concentraciones: 0.1 mg/L, 1.0 mg/L y 5.0 mg/L, preparadas en medio de cultivo Provasoli
(PES).
El experimento se realizó en triplicado para cada concentración de hormonas y para cada
sección del talo, utilizando un n= 4 explantes por placa de cultivo en dos fotoperiodos:
Tratamiento 1. Se mantuvieron los cultivos a un fotoperiodo de 16:8 (luz oscuridad), con
una temperatura de 10ºC y una intensidad luminosa de 9 - 10 µ mol seg-1 m-2.
Tratamiento 2. Se mantuvieron los cultivos a un fotoperiodo de 12:12 (luz oscuridad), con
una temperatura de 10ºC y una intensidad luminosa de 9 - 10 µ mol seg-1 m-2.
Durante el estudio, los cambios de medio de cultivo enriquecido con hormonas se
realizaron semanalmente. Mediante fotografías se evaluó el crecimiento cada 15 días con
el programa ImageJ. Una vez finalizada la etapa experimental, se compara el crecimiento
de los diferentes tratamientos experimentales través de un análisis estadístico factorial
(ANDEVA).
RESULTADOS
El porcentaje de sobrevivencia total de los explantes durante el experimento fue de 79,2%,
tanto de regiones apicales como intercalares. Se observó mayor sobrevivencia en explantes
cultivados en el tratamiento 1. En aquellos explantes cultivados con BAP concentración 3
(5 mg/L) mantenidos en el tratamiento 2, hubo necrosis temprana de tejido.
Los explantes cultivados con hormona BAP presentaron tanto crecimiento en los polos o
extremos como formación de ramificaciones laterales, en las dos regiones de corte (Fig. 1 –
3). En los tratamientos con IAA, se observó crecimiento en los polos. Hubo desarrollo de
estructuras similares a callos en todos los tratamientos y segmentos, excepto en explantes
de región apical del tratamiento 2.
Figura 1. Crecimiento de
explantes de región apical de
A.
plicata
con
BAP.
Ramificaciones laterales
Figura 2. Crecimiento de
explantes de región apical de
A.
plicata
con
BAP.
Crecimiento polar
Figura 3. Crecimiento de
explantes de región intercalar
de A. plicata con IAA.
Crecimiento polar
También, en algunos casos, hubo formación de una cubierta blanquecina que se denominó
“estructura hialina”, que cubrió todo el talo en ambas regiones de corte y en los 2
tratamientos. (Fig. 4 y 5).
Ϯϲϯ
Ă
Đ
Figura 4. Cubierta hialina desarrollada
en cultivos in vitro de A. plicata. a)
ramificación lateral; b) estructura hialina;
c) ramificación polar (aumento: 32X).
ď
Ă
ď
Figura 5. Corte transversal de cubierta hialina desarrollada en cultivos in vitro de A. plicata. a) Vista
general del corte (10X). b) vista detallada del corte (40X), donde se indica cubierta hialina (tejido) que
recubre el talo.
Existe una relación entre el fotoperíodo y el tipo de hormona utilizada en explantes de
región apical (fig. 6). El tratamiento con BAP (1 mg/L) a fotoperíodo 12:12 muestra
tamaños significativamente superiores al resto de los tratamientos utilizados, incluyendo el
tratamiento control. Se aprecia diferenciación en tamaño a partir de la semana 12, para el
caso del tratamiento experimental con BAP a concentración 1mg/L en el tratamiento 2.
ϵ
ϭϲ͗Ϭϴ
Talla (mm)
ϴ
ϭϮ͗ϭϮ
ϳ
ϲ
ϱ
K
Ed
ZK
>
/
;
ϱ
ŵ
Őͬ
ůͿ
ŵ
Őͬ
ůͿ
/
;
ϭ
ŵ
Őͬ
ůͿ
͕ϭ
/
;
Ϭ
W;
ϱ
ŵ
Őͬ
ůͿ
W;
ϭ
ŵ
Őͬ
ůͿ
W;
Ϭ
͕ϭ
ŵ
Őͬ
ůͿ
ϰ
tratamiento hormonal
Figura 6. Interacción entre tratamiento hormonal y fotoperíodo sobre la talla promedio de regiones apicales
(mm) de A. plicata. Barras de error corresponden a dos errores estándar. BAP: 6-bencilaminopurina; IAA:
Ácido Indolacético.
Ϯϲϰ
En explantes de la región intercalar, existe una relación entre el fotoperíodo y el tipo de
hormona utilizada (Fig. 9). Se aprecia, que las tallas promedio de fragmentos intercalares
de A. plicata aumentan a partir de la semana 10 para el tratamiento 2.
16:08
12:12
9
Talla (mm)
8
7
6
5
dZ
K>
ϱŵ
;
/
K
E
Őͬ
ůͿ
Őͬ
ůͿ
ϭŵ
;
/
;
Ϭ͕
ϭŵ
Őͬ
ůͿ
Őͬ
ůͿ
/
ŵ
W;
ϱ
Őͬ
ůͿ
ŵ
W;
ϭ
W;
Ϭ͕
ϭ
ŵ
Őͬ
ůͿ
4
Tratamiento hormonal
Figura 9. Interacción entre tratamiento hormonal y fotoperíodo sobre la talla promedio de regiones
intercalares de A. plicata. Barras de error corresponden a dos errores estándar. BAP: 6-bencilaminopurina;
IAA: Ácido Indolacético.
DISCUSIÓN Y CONCLUSIONES
Auxinas y citoquininas promueven el crecimiento de segmentos apicales e intercalares de
Ahnfeltia plicata, estimulando la división celular, similar a lo observado por Yokoya &
Handro (1996, 1997) en regiones apicales e intercalares de Grateulopia dichotoma.
Al utilizar citoquinina (BAP) se observó tanto crecimiento de las regiones polares como
diferenciación y formación de ramificaciones laterales. Los resultados demostraron que el
proceso de regeneración de los explantes fue estimulado principalmente con el uso de
citoquinina (BAP) a una concentración de 1 mg/L y en cultivos mantenidos en fotoperíodo
12:12 (luz:oscuridad) y a 10ºC (tratamiento 2). Los tejidos cultivados bajo estas
condiciones presentaron mayor decoloración, necrosis temprana de tejido y mayor
porcentaje de mortalidad, aunque bajo las dos condiciones de cultivo hubo pérdida de
explantes, similar a lo observado por Yokoya et al.(1999) en explantes de Gracilaria
vermiculophylla en Japón. No se detectaron diferencias significativas atribuibles a ninguno
de los tratamientos en este estudio. Se comparan los resultados obtenidos en la Región de
Magallanes con información reportada en la literatura para el hemisferio Norte.
AGRADECIMIENTOS
Financiamiento otorgado por FONDEF al proyecto D08I1163. Proyecto CIMAR
FIORDOS 16.
Ϯϲϱ
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
McLachlan, J. 1973. Culture media – marine. En Stein, J. (Ed.) Handbook of Phycological Methods.
Cambridge University Press, Cambridge, 25- 51 pp.
Maggs, C. & C. Pueschel. 1989 Morphology and development of Ahnfeltia plicata (Rhodophyta):
proposal of Ahnfeltiales ord. Nov. Journal of Phycology. 25: 333 – 351.
Polne- Fuller, M. & A. Gibor. 1987. Calluses and callus-like growth in seaweeds: Induction and
culture. Hydrobiologia. 151/152: 131 – 138.
Reddy, C., Jha, B. & Y. Fujita. 2008. Seaweed micropropagation techniques and their potentials: an
overview. Journ. Appl. Phycol. 20: 609 – 617.
Villanueva, F., ävila, M., Mansilla, A. & J. Cáceres. 2010. Desarrollo de técnicas de
micropropagación in vitro de Ahnfeltia plicata (Hudson) Fries, 1836 (Ahnfeltiales, Rhodophyta) de
la Región de Magallanes. Resúmenes XXXCongreso de Ciencias del Mar. Universidad Católica de la
Santísima Concepción, Concepción, 2010). P: 179.
Yokoya, N. & W. Handro. 1996. Effects of auxins and cytokinins on tissue culture of Grateulopia
dichotoma (Gigartinales, Rhodophyta). Hidrobiologia 326/327: 393 – 400.
Yokoya, N. & W, Handro. 1997. Thallus regeneration and growth induced by plant growth
regulators and light intetsity Grateloupia dichotoma (Rhodophyta) In Kitamura, T. (Ed.) Proceedings
of I.T.I.T. International Symposium on New Technologies from Marine-Sphere, Agency of
Industrial Science and Technology (AIST/MITI) and New Energy and Industrial. Technology
Development Organization (NEDO) Takamatsu, Japan: 83 – 86.
Yokoya, N., Kakita, H., Obika, H. & T. Kitamura. 1999. Effects of environmental factors and plant
growth regulators on growth of the red alga Gracilaria vermiculophylla from Shikoku Island, Japan.
Hydrobiologia. 398/399: 339 – 347.
Ϯϲϲ
CAMBIOS DE ELEVACIÓN Y DE VELOCIDAD EN EL
GLACIAR FLEMING, PENÍNSULA ANTÁRTICA
(Ice velocity and ice elevation changes at Fleming Glacier, Antarctic
Peninsula)
Wendt, A.1, Rivera, A. 1,2, Bown, F. 1, Zamora, R. 1, Casassa, G. 1, Bravo, C. 2, Dietrich, R. 3 & Fritsche, M. 3
1
Centro de Estudios Científicos, Valdivia, Chile
2
Universidad de Chile, Santiago, Chile
3
Technische Universität Dresden, Germany
La Península Antártica es una de las regiones más fuertemente afectadas por el cambio
climático, al experimentar un aumento en las temperaturas atmosféricas un orden de
magnitud superior al promedio mundial observado en las últimas décadas (Vaughan et al.,
2001). Esto ha generado cambios que no se habían registrado en los últimos 10 mil años,
tanto en los glaciares de la región como en sus ecosistemas (Dormack et al., 2005). Entre
los mayores impactos del calentamiento atmosférico y oceánico, está el colapso de las
plataformas de hielo flotante y el consecuente retroceso y aceleración de los glaciares que
fluyen hacia dichas plataformas. La plataforma flotante de Wordie en el suroeste de la
Península era la primera plataforma en la cual se relacionó este fenómeno de retroceso a los
cambios climáticos en la década de los 80 (Doake & Vaughan, 1991). Desde entonces la
plataforma siguió retrocediendo y en la actualidad quedan sólo 100 km2 de su superficie
original de 2000 km2 en 1966 (Figura 1).
Ϯϲϳ
Figura 1. Retroceso de la plataforma de hielo flotante Wordie entre 1966 y 2010. En negro la línea de vuelo
de CAMS en 2008, en blanco las líneas P3 en 2002 y 2004, imagen de fondo: Mosaico de Landsat del año
1989 (Bennat et al., 1998).
Retreat of the Wordie Ice Shelf between 1966 and 2010. In black flightline of CAMS in
2008, in white flightlines of 2002 and 2004, background: Landsat TM mosaic Antarctic
Peninsula in 1989 ((Bennat et al., 1998).
Para investigar el efecto que tiene la reducción de la plataforma de Wordie en sus glaciares,
el proyecto Anillo Antártico del Centro de Estudios Científicos (CECS) y la Dirección
Meteorológica de Chile (DMC) realizó 3 expediciones a la zona entre los años 2007 y 2010
en forma complementaria a un estudio con sensores de percepción remota satelital.
CAMBIOS DE ELEVACIÓN
En el año 2008 durante la expedición de terreno se realizó un levantamiento con el escáner
láser aerotransportado del CECs (CAMS, CECs airborne mapping system). El componente
principal es un escáner láser RIEGL LMS-Q240 que trabaja en infrarrojo cercano con un
barrido de 60º y un rango máximo aproximado de 500 m. Además el sistema incluye un
equipo GPS de doble frecuencia Javad Lexon GGD para determinar la posición del avión,
una unidad inercial IMAR iNav para medir la orientación y actitud, y una cámara réflex
digital EOS 5D para obtener ortofotos. Las líneas de vuelo (véase Fig. 1) fueron designadas
para repetir vuelos anteriores de 2002 y 2004 de las campañas organizadas por CECs,
NASA y Armada de Chile (Rignot et al. 2005). Los cambios de elevación de 2008 en
comparación con 2002 y 2004 demuestran un adelgazamiento a lo largo del perfil desde el
frente del glaciar hasta una altura de casi 1100 m (Fig. 2). La pérdida llega a más de 4 m
por año en el frente del glaciar. La tasa anual entre 2004 y 2008 es mayor a la observada
entre 2002 y 2008, pero la diferencia no es estadísticamente significativa. Tasas de cambio
de elevación derivadas de datos ICESat del Glaciar Fleming entre 2003 y 2009 confirman
los resultados (Zwally, comunicación personal).
Figura 2. Cambios de elevación a lo largo del Glaciar Fleming basados en datos desde 2002 a 2009.
Elevation changes along Fleming Glacier based on data between 2002 and 2009.
Ϯϲϴ
CAMBIOS DE VELOCIDADES
En 2008 se midieron velocidades del flujo de hielo mediante datos de GPS en puntos con
velocidades medidas en 1974 (Doake, 1975, Fig. 3). Estos datos revelan una aceleración del
50% en comparación a los valores previos y confirman el incremento en las velocidades
obtenidas para los años 90 mediante interferometría de radar (Rignot et al., 2005). Sin
embargo, los resultados de interferometría no tienen la precisión suficiente para deducir
cambios de velocidad desde entonces. Los cambios de elevación derivados de los datos de
GPS ilustran el decrecimiento en alturas cerca de 1000 m.
Figura 3. Velocidades del flujo de hielo en 1974 por teodolito (Doake, 1975), en 1996 por Inter-ferometría
de rádar (Rignot et al., 2005) y en 2008,2009 por GPS (Wendt et al., 2010).
Ice flow velocities in 1974 derived by theodolite (Doake, 1975), in 1996 by radar
interferometry (Rignot et al., 1996) and in 2008, 2009 by GPS (Wendt et al., 2010).
Complementando los trabajos en terreno se realizó un estudio de velocidades del flujo de
hielo mediante seguimiento de puntos (feature tracking) usando datos ópticos de los
satélites Landsat y datos de radar del satélite Envisat. La figura 4 muestra las velocidades
derivadas por el método de correlación de orientación (Haug et al., 2010) en base a dos
imágenes Landsat de 2009-11-10 y 2010-02-14. En el frente del glaciar las velocidades
alcanzan 2800 m por año (Fig. 5). Comparando estas velocidades con las de años anteriores
Ϯϲϵ
se determina un aumento de alrededor de un 50% desde el año 1989 concordante con los
resultados que fueron obtenidos a mayor altura mediante técnicas GPS.
Figura 4. Velocidades de flujo de hielo de los glaciares de la Bahía de Wordie en verano 2009/2010.
Ice flow velocities of the glaciers in Wordie Bay in summer 2009/2010.
Figura 5. Velocidades en el frente del glaciar Fleming (perfil A-B en Fig. 4).
Velocities at the glacier front (profile A-B in Fig. 4).
CONCLUSIÓN
ϮϳϬ
En las últimas décadas, el Glaciar Fleming perdió su plataforma de hielo flotante,
gatillando una significativa disminución de la fuerza de sustentación que explica su
inestabilidad . El glaciar muestra una importante aceleración en su flujo y pérdida de
espesor, los que en conjunto indican que el glaciar aún no ha llegado a un nuevo equilibrio
y por lo cual está drenando y perdiendo masa en forma significativa.
AGRADECIMIENTOS
Este proyecto fue financiado por el Programa de Investigación Asociativa (PIA, Anillos de
Ciencia Antártica), contando con el apoyo logístico de INACH, FACh y BAS a través de su
base antártica Rothera. El Centro de Estudios Científicos (CECs) es financiado por el
Gobierno de Chile a través del Programa de Financiamiento Basal para Centros de
Excelencia de CONICYT, entre otros. Agradecemos la colaboración de Jay H. Zwally y
John Robbins de Goddard Space Flight Center con los datos de ICESat. Los datos de
ENVISAT fueron provistos por ESA vía el proyecto AOCRY.2674. Los autores agradecen
a Torborg Haug de la Universidad de Oslo, Noruega por su apoyo en el análisis de los datos
ópticos satelitales.
REFERENCIAS BIBLIOGRÁFICAS
•
•
•
•
•
•
•
•
Bennat H., Heidrich H., Grimm J., Sievers J., Walter H. & Wiedemann A. (1998): Das
"Geowissenschaftliche Informationssystem Antarktis" (GIA) am Institut für Angewandte Geodäsie
(IfAG). In: Goßmann H. (ed.): Patagonien und Antarktis - Geofernerkundung mit ERS-1Radarbildern. Petermanns Geographische Mitteilungen, Ergänzungsheft 287, 13 - 34.
Doake, C.S.M. 1975. Bottom sliding of a glacier measured from the surface. Nature, 257, 780-782.
Doake, C. S. M. & D. G. Vaughan. 1991. Rapid disintegration of the Wordie Ice Shelf in response to
atmospheric warming. Nature, 350, 328-330.
Domack, E., D. Duran, A. Leventer, S. Ishman, S. Doane, S. McCallum, D. Amblas, J. Ring, R.
Gilbert and M. Prentice (2005), Stability of the Larsen B ice shelf on the Antarctic Peninsula during
the Holocene epoch, Nature 436, 681-685.
Haug, T., A. Kääb, P. Skvarca. 2010. Monitoring ice shelf velocities from repeat MODIS and
Landsat data – a method study on the Larsen C ice shelf, Antarctic Peninsula, and 10 other ice
shelves around Antarctica. The Cryosphere, 4, 161-178, doi:10.5194/tc-4-161-2010.
Rignot, E., G. Casassa, S. Gogineni, P. Kanagaratnam, W. Krabill, H. Pritchard, A. Rivera, R.H.
Thomas, J. Turner & D. Vaughan. 2005. Recent ice loss from the Fleming and other glaciers, Wordie
Bay, West Antarctic Peninsula. Geophysical Research Letters, 32 (L07502).
Vaughan, D. G., G. J. Marshall, W.M. Connolley, J.C. King & R. Mulvaney. 2001. The devils in the
details. Science, 293, 1777-1779.
Wendt, J., A. Rivera, A. Wendt, F. Bown, R. Zamora, G. Casassa, C. Bravo. 2010. Recent icesurface-elevation changes of Fleming Glacier in response to the removal of the Wordie Ice Shelf,
Antarctic Peninsula. Annals of Glaciology, 51(55), 97-102.
Ϯϳϭ
BONE MICROSTRUCTURE AND GROWTH DYNAMICS OF
EOCENE GIANT PENGUINS –AVES, SPHENISCIFORMESFROM SEYMOUR ISLAND, ANTARCTICA: PRELIMINARY
RESULTS
(Microestructura ósea y dinámica de crecimiento de pingüinos –
Aves, Sphenisciformes- gigantes del Eoceno de Isla Seymour,
Antártica: resultados preliminares)
Yury–Yáñez, R. E.1*, Sallaberry, M.1, Rubilar–Rogers, D.2, Otero, R. A.3, Gutstein, C. S.4, Mourgues, F. A.5,
Robert, E.6 & Torres, T.7
Laboratorio de Zoología de Vertebrados, Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile. Las
Palmeras 3425, Ñuñoa, Santiago de Chile* [email protected]
Área de Paleontología, Museo Nacional de Historia Natural. Interior Parque Quinta Normal s/n, Santiago de Chile, Consejo de
Monumentos Nacionales. Vicuña Mackenna 084, Providencia, Santiago de Chile
Laboratorio de Ecofisiología, Departamento de Ciencias Ecológicas, Facultad de Ciencias, Universidad de Chile. Las Palmeras 3425,
Ñuñoa, Santiago de Chile
Servicio Nacional de Geología y Minería. Avda. Santa María 0104, Providencia, Santiago de Chile
Observatoire des Sciences de l'Univers de Grenoble (OSUG). Université Grenoble 1. Institut Dolomieu. 15 rue M. Gignoux. 38031
Grenoble cedex, France
Facultad de Ciencias Agronómicas, Universidad de Chile. Santa Rosa 11315, Santiago de Chile
Here we present the preliminary results of the first study of bone microstructure of fossil
penguins through histology, dealing mainly with the search of bone marks affected by time
recording in order to asses growth dynamics of fossil species. The lack of annual lines of
arrested growth and the presence of highly vascularized bone in the inner bone layers
shows fast growth rate in fossil giant penguins from the Eocene of Seymour Island, and
these fossil penguins are recognized as the biggest representatives of the order
Sphenisciformes. Our results show that high rates of growth observed today in extant
Antarctic penguins can be a plesiomorphic condition adapted in a greenhouse environment
50 million years ago or, alternatively as the retained general condition of birds (mainly
Neornithes). In any case, penguins (different as in other birds) did not evolve extended
growth rates (over a year long) in Antarctica and probably the giant penguins (such as
Anthropornis or Palaeeudyptes) can represent the highest rate of growth of known
vertebrates considering the known rates in extant Antarctic penguins such as Aptenodytes.
INTRODUCTION
Penguins (Class: Aves, Order: Sphenisciformes) are recognized as a typical Antarctic bird
and probably as the most representative element of the Antarctic fauna, even when its
distribution is known from the entire Southern Hemisphere. Moreover, besides the 17
extant species, penguins are known by one of the most diverse and well-studied fossil
record of birds, representing nearly 40 species known from the Paleocene to the Holocene
from localities all over the Southern Hemisphere (Jadwiszczak, 2009). The most diverse
record from the Paleogene is known from the middle – late Eocene of the La Meseta
Formation (Jadwiszczak, 2006a). Paleogene penguins represent a highly diverse extinct
fauna, with a large distribution shared almost completely with the current distribution of
these aquatic birds. Across all the known diversity of penguins (extant and extinct) several
changes in size are observed, being possibly that the plesiomorphic condition of the order
be big sized (Clarke et al., 2007). Today the biggest penguins are the genus Aptenodytes
(from Antarctica and the southern tip of South America) with two species known as King
and Emperor penguins, with nearly 1.2 m. These species are smaller than fossil
ϮϳϮ
representatives sized in a range between 1.3 to 1.7 meters such as Anthropornis and
Palaeeudyptes, both from the Eocene of Seymour Island (Marambio Island in Argentinian
maps) (Jadwiszczak, 2001).
Histological studies in fossil vertebrates have been performed allowing
access to
paleobiological information previously thought impossible to obtain from the fossil record
such as ontogeny, developmental plasticity, physiology, reproduction and behavior (e.g.
Erickson et al, 2007; Erickson et al., 2009; Lee and Werning; 2008), but in birds such
studies have been focused in the origin of Neornithes (Chinsamy and Elzanowsky, 2001;
Padian et al., 2001) and very few studies have been conducted in extant birds or fossil
Neornithes.
Here we studied through histology fossil giant penguins from the Eocene in order to
understand their growth dynamics and compare it with the data existent on extant
penguins.
MATERIALS AND METHODS
Fossil bones were recovered from the Vertebrate Paleontology field trip of the Proyecto
Anillo “Geological and paleontological evolution of the Magellan and Larsen Basins during
the Mesozoic and Cenozoic: source areas and possible similarities” ACT105, CONICYT
(directed by one of the authors, T.T.) during January 2011 in the XLVII Chilean Antarctic
Expedition in Seymour Island. Two partially complete proximal fragments of tibiotarsi
were sectioned transversally in the petrographical laboratory of the Department of Geology,
University of Chile. Later, thin sections were observed and photographed under traditional
light microscopy in the Facultad de Ciencias (Universidad de Chile).
Penguins have an unusual tarsometatarsus position (highly derived between birds) which is
the reason why tibiotarsus together with femur is considered to support penguin weight in
their upright position (Acosta Hospitaleche et al., 2008) is considered as a good proxy to
start studying variation in size through histological studies.
Fossil bones are referred here as cf. Palaeeudyptes sp. based in general anatomy; being this
the most diverse and robust fossil penguin from the La Meseta Formation. Current
knowledge of fossil Eocene penguins make it difficult to assess more accurate taxonomical
determination of tibiotarsi by several reasons, mainly: traditional use of tarsometatarsal
character in the diagnosis of fossil penguins (Myrcha et al., 2002), lack of associated
penguin skeletons with different bone elements (but see Acosta Hospitaleche and Reguero,
2010) and the use of non-associated and isolated fossil bones in the description of
characters different to tarsometatarsi based in size-class groups (Jadwiszczak, 2006b).
RESULTS
Bone microstructure in birds is characterized by high vascularization, rapidly formed
fibrolamellar bone, encircled peripherally and endosteally by a layer of lamellar bone
slowly formed (Chinsamy and Elzanowsky, 2001). This layer of slowly formed bone call
the Outer Circumference Layer (OCL) shows negative allometry, being virtually absent in
big birds for example, in ratites (Ponton et al., 2004). In comparison with mammals which
present a layered organization of the bone and lines of interrupted growth; i.e., lines of
arrested growth (LAGs) or annuli (Castanet et al., 2006), with few exceptions such as the
moa and kiwi (Bourdon et al., 2009; Turvey et al., 2005), LAGs are absent in birds, because
Neornithes reach their full osseous development within 1 year.
Ϯϳϯ
The high density of penguin bone, compared with other birds, explains a reduced medullar
cavity. Our preliminary results (Figure 1) shows that bone microstructure in the analyzed
bones is represented by two main types of tissues related with fast rate of growth, being
this; 1) a highly vascularized tissue endosteally and 2) a large amount of fibrolamellar
bone. Apparently, in both thin sections analyzed an outer layer of lamellar bone (OCL) is
absent, which is congruent with what is expected for big sized birds. No LAGs were
observed in any of the thin sections prepared.
DISCUSSION
Yearly LAGs are not observed in fossil penguins analyzed here, showing that probably
osseous maturity was reached within a continuous time spam, likely one year that is the
general condition in Neornithes birds. The most accepted outgroup to penguins:
Procellariformes also show absent LAGs (but more sampling is needed) so we can infer
that penguins probably retained the general condition of birds, also confirmed by the
presence of bone considered of rapid formation (highly vascularized and unordered
fibrolamellar bone) and the absent of an OCL as is expected in big birds with low or none
residual growth (Ponton et al., 2004). Frase larguísima!!
Extant Emperor penguin (Aptenodytes patagonicus) has an unusual pattern of growth
within 3 months marked by the beginning of the Austral winter, and shows the highest rates
of bone tissue growth known (de Margerie et al., 2004). Our results demonstrate that fast
rates of growth could be a conserved condition to reach big sizes in Sphenisciformes over
extending phases of growth, the condition observed here is already presented by penguins
from the Eocene, this could be due to the presence of predators and the duration of daylight
in a non frozen (warm climate) Antarctica do not allow to reach big size trough extending
growth time over fast growth rates.
Birds that show LAGs are considered to extend growth times over a year such as the kiwi
(Apteryx spp.) or the extinct moa as a consequence of the lack of mammalian predators in
the origin of the clade kiwi + moa in the Neogene of New Zealand (Bourdon et al., 2009),
also Diatryma another bird that shows LAGs is considered a top predator, probably the
reason that allows to relax the accelerated rate of growth characteristic of birds.
The origin of fast growth rates in birds is considered a consequence of reduced size to the
origin of Neornithes and a mechanism to allow rapid attainement of osseous maturity for
the origin of active flight (Chinsamy and Elzanowsky, 2001).
In consequence, big sizes of Eocene penguins is not exclusive to high latitude penguins
such as the ones here studied, and it seems to be a general condition to the Eocene (Clarke
et al., 2007) probably as a consequence of the greenhouse environment and not related to
the physiological Bergmann’s Rule.
The quality of the bone microstructure of fossil Eocene penguins, allows us to observe
ontogenetic record of bone formation showing low or none reconversion during life history.
This is due to the presence of highly vascularized bone, which could represent juvenile
growth, showing bone microstructure as an active record of bone formation ontogeny.
Ϯϳϰ
Figure 1. a) Spheniscus humboldti, Humboldt Penguin small extant penguin currently breeder of Chilean
coast, b) cf. Palaeeudyptes sp. SGO.PV.22041 (escale is for both bones), c) transversal section under light
microscopy.
CONCLUSIONS AND FUTURE PERSPECTIVES
Fast growth rates over extended time of growth seem to be a plesiomorphic condition to
Sphenisciformes for reaching big sizes. More data on several species of the so called giant
fossil penguins from different environments and times are needed to corroborate this
hypothesis. The retention of this condition of growth in the Order could generate the
ground for the extant crown group Spheniscidae to re-conquest Antarctica after the
beginning of the Neogene global cooling. Alternatively, they could have stayed in
Antarctica considering the basal phylogenetic position of the genus Aptenodytes) and reach
a big size in the modern time ( Cenozoic) as a physiological response to the global cooling.
Considering the extended presence of giant fossil penguins in the Paleogene, the ecological
causes to reach big size through fastened rates of bone growth (rather than extended growth
time) remains unanswered, also this suggest biomechanical constraints and developmental
consequences, for example, in survival of chicks. This last hypothesis should be explored in
a wide paleobiological perspective and could help to understand the replacement of fossil
penguins by a monophyletic crown group Spheniscidae across the entire Southern
Hemisphere.
ACKNOWLEDGEMENTS
Research supported by ACT105, CONICYT. R. Y. is granted with a CONICYT fellowship.
REFERENCES
•
•
•
Acosta Hospitaleche, C.; Castro, L.; Tambussi, C. and Scasso, R.A. 2008. Palaeospheniscus
patagonicus (Aves, Sphenisciformes): new discoveries from the early miocene of Argentina. Journal
of Paleontology, 82(3):565-575.
Acosta Hospitaleche, C. and Reguero, M. 2010. First articulated skeleton of Palaeeudyptes gunnari
from the late Eocene of Isla Marambio (Seymour Island), Antarctica. Antarctic Science, 22(3):289298.
Bourdon, E.; Castanet, J.; de Ricqlès, J.A.; Scofield, P.; Tennyson, A.; Lamrous, H. and Cubo, J.
2009. Bone growth marks reveal protracted growth in New Zealand kiwi (Aves, Apterygidae).
Biology Letters, 5:639-642.
Ϯϳϱ
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Castanet, J. 2006. Time recording in bone microstructures of endothermic animals; functional
relationships. Comptes Rendus Paleovol, 5:629-636.
Chinsamy, A. and Elzanowski, A. 2001. Evolution of growth pattern in birds. Nature, 412:402-403.
Clarke, J.A.; Ksepka, D.T.; Stucchi, M.; Urbina, M.; Giannini, N.; Bertelli, S.; Narváez, Y. and
Boyd, C. A. 2007. Paleogene equatorial penguins challenge the proposed relationship between
biogeography, diversity, and Cenozoic climate change. Proceedings of the National Academy of
Sciences, USA, 104(28):11545-11550.
de Margerie, E.; Robin, J.-P.; Verrier, D.; Cubo, J.; Groscolas, R. and Castanet, J. 2004. Assesing a
relationship between bone microstructure and growth rate: a fluorescent labeling study in the king
penguin chick (Aptenodytes patagonicus). The Journal of Experimental Biology, 207:869-879.
Erickson, G.M.; Curry Rogers, K.; Varrichio, D.J.; Norell, M.A. and Xu, X. 2007. Growth patterns
in brooding dinosaurs reveals the timing of sexual maturity in non-avian dinosaurs and genesis of the
avian condition. Biology Letters, 3:558-561.
Erickson, G.M.; Rauhut, O.W.M.; Zhou, Z.; Turner, A.H.; Inouye, B.D.; Hu, D. and Norell, M.A.
2009. Was Dinosaurian Physiology Inherited by Birds? Reconciling Slow Growth in ArchaeopteryxPLoS one, 4(10):e7390.
Jadwiszczak, P. 2001. Body size of Eocene Antarctic penguins. Polish Polar Research, 22(2):147158.
Jadwiszczak, P. 2006a. Eocene penguins of Seymour Island, Antarctica: Taxonomy. Polish Polar
Research, 27(1):3-62.
Jadwiszczak, P. 2006b. Eocene penguins of Seymour Island, Antarctica: The earliest record,
taxonomic problems and some evolutionary considerations. Polish Polar Research, 27(4):287-302.
Jadwiszczak, P. 2009. Penguin Past: The current state of knowledge. Polish Polar Research, 30(1):328.
Lee, A.H. and Werning S. 2008. Sexual maturity in growing dinosaurs does not fit reptilian growth
models. Proceedings of the National Academy of Sciences, USA, 105(2):582-587.
Myrcha, A.; Jadwiszczak, P.; Tambussi, C.P.; Noriega, J.I.; Gazdzicki, A.; Tatur, A. and del Valle,
R. 2002. Taxonomic revision of Eocene Antarctic penguins based on tarsometatarsal morphology.
Polish Polar Research, 23(1):5-46.
Padian, K.; de Ricqlès, A.J. and Horner, J.R. 2001. Dinosaurian growth rates and birds origins.
Nature, 412:405-408.
Ponton, F.; Elzanowski, A.; Castanet, J.; Chinsamy, A.; de Margerie, E.; de Ricqlès, A.J. and Cubo,
J. 2004. Variation of the outer circumferential layer in the limb bones of birds. Acta Ornithologica,
39(2):21-24.
Turvey, S.T.; Green, O.R. and Holdaway, R.N. 2005. Cortical growth marks reveal extended
juvenile development in New Zealand moa. Nature 435:940-943.
Ϯϳϲ

Documentos relacionados