Hepatic Expression of Adiponectin Receptors Increases with Non

Hepatic Expression of Adiponectin Receptors Increases with Non

Hepatic Expression of Adiponectin
Receptors Increases with Non-alcoholic
Fatty Liver Disease Progression in
Morbid Obesity in Correlation with
Glutathione Peroxidase 1
Obesity Surgery
The Journal of Metabolic
Surgery and Allied Care
ISSN 0960-8923
Volume 21
Number 4
OBES SURG (2011)
21:492-500
DOI 10.1007/
s11695-010-0353-2
1 23
Your article is protected by copyright and
all rights are held exclusively by Springer
Science + Business Media, LLC. This e-offprint
is for personal use only and shall not be selfarchived in electronic repositories. If you
wish to self-archive your work, please use the
accepted author’s version for posting to your
own website or your institution’s repository.
You may further deposit the accepted author’s
version on a funder’s repository at a funder’s
request, provided it is not made publicly
available until 12 months after publication.
1 23
Author's personal copy
OBES SURG (2011) 21:492–500
DOI 10.1007/s11695-010-0353-2
CLINICAL RESEARCH
Hepatic Expression of Adiponectin Receptors Increases
with Non-alcoholic Fatty Liver Disease Progression in Morbid
Obesity in Correlation with Glutathione Peroxidase 1
Angel Carazo & Josefa León & Jorge Casado & Ana Gila & Sergio Delgado & Ana Martín &
Laura Sanjuan & Trinidad Caballero & Jose Antonio Muñoz & Rosa Quiles &
Angeles Ruiz-Extremera & Luis Miguel Alcázar & Javier Salmerón
Published online: 17 January 2011
# Springer Science+Business Media, LLC 2011
Abstract
Background The prevalence of non-alcoholic fatty liver
disease (NAFLD) in obesity is very high. The role of
adiponectin receptors in NAFLD progression remains still
unclear. We speculate that changes in the hepatic expression
levels of the two adiponectin receptors may be associated
with the expression of oxidative stress-related genes.
Methods We studied 60 morbidly obese patients with
NAFLD, who underwent liver biopsy at the time of bariatric
surgery. We measured the hepatic messenger-RNA concentration of adiponectin receptors (ADIPOR1 and ADIPOR2),
glutathione peroxidase 1 (GPx1), glutathione reductase (GRd)
and inducible oxide nitric synthase. Additionally, biochemical
parameters and oxidative stress markers were determined in
A. Carazo : J. León : J. Casado : A. Gila : A. Martín :
L. Sanjuan : J. A. Muñoz : R. Quiles : A. Ruiz-Extremera :
L. M. Alcázar : J. Salmerón
Research Unit,
San Cecilio University Hospital,
Av de Madrid s/n,
18012 Granada, Spain
J. León : A. Gila : T. Caballero : R. Quiles : A. Ruiz-Extremera :
L. M. Alcázar : J. Salmerón
Centro de Investigación Biomédica en Red de Enfermedades
Hepáticas y Digestivas (Ciberehd),
Granada, Spain
A. Carazo (*) : S. Delgado
Surgery Unit, San Cecilio University Hospital,
Granada, Spain
e-mail: [email protected]
A. Carazo : T. Caballero
Pathological Anatomy Unit, San Cecilio University Hospital,
Granada, Spain
blood samples. According to the Kleiner score, the patients
were divided into two groups: group 1 (25 patients without
steatohepatitis) and group 2 (25 patients with probable
steatohepatitis and ten patients with steatohepatitis).
Results The messenger-RNA concentration of all genes
analysed in the study was higher among the patients in
group 2. However, no differences in blood oxidative stress
markers were observed. Strong correlations were found
among the expression levels of ADIPOR1, ADIPOR2 and
GPx1. The multivariate analysis showed that the only
independent variable associated with NAFLD progression
was the increase in GPx1 expression levels.
Conclusions NAFLD progression in morbid obesity is
associated with increase in hepatic adiponectin receptor and
oxidative stress-related genes. The linear correlations suggest
that ADIPOR1, ADIPOR2 and GPx1 share key molecular
factors in the regulation of the genetic expressions.
Keywords Non-alcoholic fatty liver disease .
Non-alcoholic steatohepatitis . Morbid obesity .
Adiponectin . Adiponectin receptors . Glutathione
peroxidase . Glutathione reductase . Inducible oxide nitrite
synthase
Abbreviations
BMI
Body mass index
NAFLD
Non-alcoholic fatty liver disease
NASH
Non-alcoholic steatohepatitis
ADIPOR1 Adiponectin receptor 1
ADIPOR2 Adiponectin receptor 2
GPx1
Glutathione peroxidase 1
GRd
Glutathione reductase
Author's personal copy
OBES SURG (2011) 21:492–500
iNOS
LDL
HDL
ALT
AST
GGT
HOMA-IR
GSH
GSSG
PCR
Ct
PPIA
RPS13
bp
Inducible oxide nitrite synthase
Low-density lipoprotein
High-density lipoprotein
Alanine aminotransferase
Aspartate aminotransferase
Gamma glutamiltransferase
Homeostasis model assessment
Reduced glutathione
Oxidised glutathione
Polymerase chain reaction
Threshold cycle
Peptidylprolyl isomerase A
Ribosomal protein S13
Base pairs
Introduction
The incidence of obesity is increasing dramatically and, at
present, obesity is considered as a public health problem.
The most important pathological consequences are nonalcoholic fatty liver disease (NAFLD), type 2 diabetes
mellitus and cardiovascular disease [1]. NAFLD includes a
spectrum of hepatic abnormalities ranging from hepatic
steatosis to more severe pathologies like non-alcoholic
steatohepatitis (NASH) and cirrhosis. NAFLD prevalence
increases with adiposity up to 85% in morbid obesity,
defined as having a body mass index (BMI) of greater than
40 kg/m2 [2]. Moreover, the exact prevalence of NASH in
morbidly obese patients is unknown and could change
considerably depending on the biopsy heterogeneity [3] and
the histological definition of NASH [4].
Currently, the “two-hit (or multiple hit) hypothesis” is
broadly accepted to explain the progression of NAFLD [5].
The accumulation of lipids in the cytoplasm of hepatocytes
(the first hit) triggers a series of cytotoxic events (secondary
hits) which culminate in steatohepatitis. In this context,
insulin and leptin resistances, free radical over-production,
excess of visceral fat and adipose tissue and liver
inflammation are involved in the origin and progression
of NAFLD [6–10].
Adiponectin is a hormone that is expressed mainly by
adipocytes and which has anti-inflammatory and insulinsensitising effects. Decreasing levels of adiponectin during
obesity have been related with insulin resistance, liver
steatosis and other features of the metabolic syndrome such
as dyslipidaemia and hypertension [11]. Regarding the role
of hepatic adiponectin receptors (ADIPOR1 and ADIPOR2
isoforms) in the progression of NAFLD, contradictory
results have been published. On the one hand, falls in liver
ADIPOR2 levels in patients with NASH, compared with
controls, have been reported [12]. But, other studies have
493
found no such variations [13], or increases in both receptors
[14] or increases only in the ADIPOR2 isoform [15, 16].
Glutathione peroxidase 1 (GPx1) is a seleno-protein that
reduces hydroperoxides by means of glutathione. Its role is
mainly that of an antioxidant. GPx1 knockout mice tolerate
moderate oxidative stress [17], but are highly susceptible to
severe oxidative damage [18]. Moreover, GPx1 knockout
mice increase insulin sensitivity [19]. In contrast, GPx1
overexpressing mice are more resistant to acute oxidative
stress and develop insulin resistance and obesity [20].
Although an excess in oxidative damage is associated with
the pathology of many human diseases, a growing body of
evidence shows that low levels of reactive oxygen and
nitrogen species are required for normal cellular functioning and intracellular signalling [19, 21]. In this context, a
recent study reported that ADIPOR2 promoter is affected
by endoplasmic oxidative stress [22]. Another recent study
reported that muscle-specific disruption of ADIPOR1
decreased muscle oxidative stress-detoxifying enzymes and
mitochondrial content [23]. In addition, ADIPOR2 overexpression in a model of diabetic and obese mice increased
the expression of hepatic antioxidant enzymes [24].
These precedents suggest a link between adiponectin
receptors and oxidative stress pathways. We hypothesised
that changes in the hepatic expression of adiponectin
receptors during the NAFLD progression may be associated
with the expression of oxidative stress-related genes.
Accordingly, we studied 60 morbidly obese patients with
NAFLD, who underwent a liver biopsy at the time of
bariatric surgery. The grade of NAFLD progression was
evaluated according to the Kleiner score [25], and the
systemic oxidative stress was evaluated by measuring
representative blood markers. Moreover, in a biopsy
sample, we studied the level of expression of adiponectin
receptors, GPx1, glutathione reductase (GRd) and inducible
oxide nitric synthase (iNOS).
Materials and Methods
Subjects
The patient cohort included 60 morbidly obese subjects
who underwent bariatric surgery at the San Cecilio
University Hospital (Granada, Spain). Exclusion criteria
for the study included primary liver disorders other than
fatty liver that could account for steatosis, including alpha1-antitrypsin deficiency, infectious hepatitis or Wilson’s
disease, which were identified by specific disease markers.
The maximal alcohol consumption of the study participants
was 30 g per week in men and 20 g in women. The ethics
committee of the hospital approved the study, and all
subjects provided written informed consent.
Author's personal copy
494
Biological Samples
Liver biopsies were obtained at the moment of bariatric
surgery. Blood samples were collected before the surgery
and after 10 h fasting. Additionally, 1 year after the bariatric
surgery, blood samples but not liver biopsies were
collected. For biochemical parameter determinations, blood
samples were processed and analysed by routine methods
within 24 h at the Clinical Analysis Laboratory of the San
Cecilio University Hospital (Granada, Spain). For each
patient, glucose (milligrammes per decilitre), insulin
(microunits per millilitre), triglycerides (milligrammes per
decilitre), total cholesterol (milligrammes per decilitre),
LDL cholesterol (milligrammes per decilitre), HDL cholesterol (milligrammes per decilitre), alanine aminotransferase
(ALT; units per litre), aspartate aminotransferase (AST;
units per litre) and GGT (units per litre) were determined.
The model assessment (HOMA-IR) index was calculated to
evaluate the insulin resistance.
Adiponectin Determinations
Adiponectin plasma levels were measured using the
LINCOplex kit with the Luminex 100 Integrated System
2.3 software on the Bio-PlexTM 200 System (BIO-RAD).
The assays were performed according to the manufacturer’s
instructions.
Determination of Oxidative Stress Parameters
Nitrite levels Plasma samples were deproteinised, and
supernatants were used to measure the amount of nitrite,
via the Griess reaction at 550 nm in a microplate reader
(TRIAD series, Dynex Technologies). Nitrite concentrations were calculated according to a standard curve and
expressed in nanomoles per millilitre.
GPx, GRd activities The erythrocytes were lysed, and
supernatants were used. Glutathione peroxidase (GPx) and
glutathione reductase (GRd) activities were measured
following the oxidation of NADPH for 3 min at 340 nm
in a UV-spectrophotometer (Biomate, Thermo Spectronic).
The activities of both enzymes are expressed in nanomoles
per milligramme haemoglobin (HB).
GSH and GSSG assays The erythrocytes were lysed and the
supernatants incubated with ophthalaldehyde. The fluorescence of the samples was then measured in a plate-reader
spectrofluorometer (TRIAD Series, Dynex Technologies). A
standard curve of known reduced glutathione (GSH) concentration was prepared and processed with the samples. For
oxidised glutathione (GSSG) concentration measurement, the
supernatants were pre-incubated with N-ethylmaleimide and
OBES SURG (2011) 21:492–500
then alkalinized with NaOH. The fluorescence was
measured, and the GSSG concentrations were calculated
according to a standard curve. The levels of GSH and
GSSG are expressed in nanomoles per milligramme
haemoglobin.
Anatomopathological Study
All biopsies were evaluated by a single experienced
pathologist using the scoring system validated by Kleiner
et al. [25]. This histology scoring system quantifies
necroinflammatory and steatotic changes (steatosis, lobular
inflammation and ballooning) and produces NAFLD
activity scores that range between 0 and 8. Scores greater
or equal to 5 were diagnosed as NASH; scores of 3 and 4
were classified as probable NASH, while scores of 1 and 2
were diagnosed as not NASH.
Hepatic Gene Expression
Total RNA was purified in a fraction of each liver biopsy.
Five hundred nanogrammes of RNA was retrotranscribed to
cDNA using the qScript Flex cDNA Synthesis Kit (Quanta)
according to the manufacturer’s instructions. The quantification of mRNA concentration for each gene was
performed in a fraction of cDNA volume by Real-time
PCR (Mx3000P Stratagene) using the SYBR green supermix (Quanta). The primers (Table 1) were tested previously
to evaluate their specificity and sensitivity. Unspecific
amplifications were not detected in the test. The annealing
temperature (specific for each gene) ranged from 58°C to
62°C. Each determination was carried out in duplicate, and
the mathematical relation between the threshold cycle (Ct)
level and the initial DNA quantity was evaluated by a
standard curve. Finally, the results were normalised using
the expression level of two hepatic housekeeping genes:
PPIA and RPS13 [26, 27]. For each gene, the mRNA
concentration was expressed in femtogrammes of mRNA
by picogrammes (fg of mRNA/pg) of housekeeping
mRNAs average.
Statistical Studies
Statistical analyses were performed using the Statistical
Package for Social Sciences (SPSS-12.0, SPSS Inc.,
Chicago, IL). The results are reported as mean±standard
error mean. Unvaried unadjusted analyses were performed
with the independent-samples t test to compare normally
distributed variables, while the Mann–Whitney U test was
used for variables not normally distributed. The linear
correlations were calculated by Pearson’s correlation
coefficient. The criterion for statistical significance was
P<0.05.
Author's personal copy
OBES SURG (2011) 21:492–500
Table 1 Primer sequences for
the amplification of cDNA by
real-time PCR
495
Gene
Sense primer
Antisense primer
Amplicon
ADIPOR1
ADIPOR2
GPx1
GRd
iNOS
PPIA
RPS13
ccatgcactttactatcgctgagggctttg
ttcctaccttgcactatgtcatctcggagg
tggacaattgcgccatgtgtgctgctc
aacaacatcccaactgtggtcttcagccac
gatgaggaccacatctaccaggag
ccatggcaaatgctggacccaacacaaatg
ggtgttgcacaagtacgttttgtgacaggc
ctgaaggttggagactccatagaagtggac
gaaacgaaactcctggaggtttgagacacc
tgatgcccaaactggttgcacgggaag
gtagggtgaatggcgactgtgttgtcaaag
ccataggaaaagactgcaccgaag
tcctgagctacagaaggaatgatctggtgg
tcatatttccaattgggagggaggactcgc
233
251
265
314
284
256
251
Results
Baseline Characteristics
Sixty morbidly obese patients with NAFLD were included
in this study (18 men and 42 women). According to the
anatomopathological Kleiner score, 25 of these patients
were without NASH, 25 were with probable NASH, and
ten were with NASH. The patients were divided into two
groups, 25 patients without NASH (group 1) and 35
patients with probable NASH or with NASH (group 2).
Table 2 shows BMI, blood biochemical parameters and
plasmatic levels for adiponectin in both groups of patients.
In group 2, significant increases were found only for AST
and ALT.
Plasmatic Oxidative Stress Parameters
Table 3 shows plasma nitrite concentration, erythrocyte
glutathione peroxidase and reductase specific activity and
erythrocyte concentration of oxidised and reduced glutathione in relation to the progression of NAFLD. These
variables are representative markers of systemic oxidative
stress. In this respect, there were no significant differences
between the two groups of patients.
Hepatic Gene Expression and Linear Correlations
Table 4 shows the hepatic mRNA concentrations of
ADIPOR1, ADIPOR2, GPx, GRd and iNOS in relation to
the progression of NAFLD. The mean expression level of
all these genes increased significantly in the group 2
patients. Concerning the relative concentration of adiponectin receptor isoforms, ADIPOR2 was significantly more
abundant than ADIPOR1 in group 2 (P<0.000) but not in
group 1.
We also analysed the correlations between the hepatic
gene expressions in all patients and, separately, in each
group of patients. These correlations are represented in
Figs. 1 and 2. Note that the iNOS levels were previously
transformed by logarithmic function to normalise the
distribution. Interestingly, we found a good linear correla-
bp
bp
bp
bp
bp
bp
bp
tion between the expressions of both adiponectin receptors
and GPx1 (Fig. 1). These correlations persisted even when
patients were classified by the Kleiner score. ADIPOR1
levels showed a weak correlation with GRd and iNOS
expressions only for all patients (Fig. 1). Moreover,
ADIPOR2 levels correlated more strongly with GRd and
iNOS expressions for all patients and for group 1 but not
for group 2 (Fig. 1). There was also a linear correlation
between the two adiponectin receptors for all patients and
for both groups of patients (Fig. 2). Furthermore, GPx1
correlated with GRd expression for all patients and for
group 1 but not for group 2 patients (Fig. 2).
Multivariate Analysis
The multivariate analysis showed that the only independent
variable associated with the progression of NAFLD was an
increase in the GPx1 expression level (OR, 1.095; 95% CI
1.019–1.178; P=0.014).
BMI and Plasmatic Level Variations After Bariatric Surgery
Table 5 shows BMI, biochemical parameters, leptin and
adiponectin plasmatic levels and systemic oxidative stress
markers, before bariatric surgery and 1 year after the
surgery, in 42 patients (16 from group 1 and 26 from group
2). Only significant differences are represented. As a result
of the great loss in body fat mass, the majority of
parameters measured in blood samples became normal.
There was also observed to be an increase in adiponectin
level and changes in two systemic oxidative stress markers.
Discussion
At present, the two-hit hypothesis is broadly accepted to
explain the origin and progression of NAFLD during
obesity [5]. Several main processes have been implicated
in the pathology of NAFLD, such as insulin resistance,
leptin resistance, excess of visceral fat, free radical overproduction or reduced levels of adiponectin [6–11].
Nevertheless, the precise molecular mechanisms that induce
Author's personal copy
496
Table 2 Patient characteristics
Group 1, 25 patients without
NASH. Group 2, 35 patients
with probable NASH and
NASH. Data are means±SEM.
Significant P values are depicted
in bold
OBES SURG (2011) 21:492–500
Characteristics
Group 1
Group 2
P Value
Age (years)
Gender: men, n (%); women, n (%)
BMI (kg/m2)
AST (U/l)
ALT (U/l)
GGT (U/l)
Total-cholesterol (mg/dl)
LDL-cholesterol (mg/dl)
HDL-cholesterol (mg/dl)
Triglycerides (mg/dl)
Glucose (mg/dl)
Insulin
HOMA-IR
Adiponectin (ng/ml)
43.5±2.4
8 (32.0%); 17 (68.0%)
50.8±1.8
27.6±4.1
24.9±4.1
37.3±8.8
156.9±6.1
89.4±6.2
40.7±2.2
151.5±18.4
128.4±7.9
12.7±2.2
3.6±0.5
36.8±6.8
44.5±1.6
10 (28.5%); 25 (71.5%)
52.2±1.3
41.5±3.5
34.4±2.4
37.8±4.9
174.3±9.3
100.1±7.6
41.2±3.1
200.3±25.8
139.5±9.0
12.6±1.3
4.4±0.5
35.5±5.8
0.640
0.783
0.520
0.018
0.038
0.957
0.154
0.305
0.904
0.161
0.382
0.967
0.277
0.885
the evolution from a liver with steatosis to one with
steatohepatitis remain unclear. Another poorly understood
aspect is the role of adiponectin receptors during NAFLD
progression. Two papers have reported that the abrogation
or over-expression of adiponectin receptors in mice is
associated with a respective decrease or increase in
oxidative stress-detoxifying enzymes [23, 24]. The aim of
our study was to analyse, in a cohort of morbidly obese
patients with NAFLD, the hepatic expression level of
adiponectin receptors and oxidative stress-related genes
and to analyse these expression levels in the context of
NAFLD progression.
We observed changes in the expression levels of all
genes analysed, in relation to NAFLD progression (Table 4)
but the blood parameters showed differences only in ALT
and AST levels (Tables 2 and 3). In our morbidly obese
cohort, the liver injury was probably not sufficiently
advanced to significantly change the blood parameters,
but the emergence of NASH was enough to modify the
hepatic gene expression profile.
In this article, we report an increase in the hepatic
expression levels of both adiponectin receptors in relation
to NAFLD progression in morbid obesity. In addition, we
report a good correlation between the hepatic expression
levels of ADIPOR1 and ADIPOR2, suggesting the existence of common factors in the genetic regulation of both
receptors. Furthermore, in the group 2 patients, the relative
concentration of ADIPOR2 increased with respect to that of
ADIPOR1 (Table 4). This suggests that the molecular
mechanisms implicated in the adiponectin receptor overexpression, during NAFLD progression, preferably stimulate the ADIPOR2 gene.
Contradictory data have been published concerning the
role of hepatic adiponectin receptor expression during the
development of NAFLD in human obese cohorts.
Decreases in hepatic ADIPOR2 mRNA levels in relation
to NAFLD development have been reported in two
articles. ADIPOR2 decreased in morbidly obese patients
with NASH respect to morbidly obese controls with simple
steatosis [12] and in moderately obese patients with NAFLD
with respect to lean persons without steatosis [28]. However,
other articles have reported increases in adiponectin receptors
in obese patients with NASH [14–16]. Our results are in
agreement with the latter articles. In our opinion, these
Table 3 Blood oxidative stress markers
Blood oxidative stress markers
Group 1
Group 2
P Value
Nitrite (nmol/mL)
GPx specific activity
GRd specific activity
Total-gluthatione (nmol/mg HB)
GSH (nmol/mg HB)
GSSG (nmol/mg HB)
8.4±1.0
31.0±2.2
2.4±0.1
4.0±1.6
2.1±0.3
1.9±0.2
10.0±0.7
27.3±1.2
2.3±0.1
4.9±1.8
2.8±0.3
2.2±0.1
0.181
0.118
0.500
0.722
0.114
0.151
Group 1, 25 patients without NASH. Group 2, 35 patients with
probable NASH and NASH. Data are means±SEM
Table 4 Hepatic mRNA concentration means
Hepatic mRNA concentration
Group 1
Group 2
P Value
ADIPOR1
ADIPOR2
GPx1
GRd
iNOS
14.4±1.2
17.2±2.2
47.7±3.3
15.7±1.9
22.5±8.4
21.1±0.9
30.3±1.4
76.7±2.9
20.6±0.8
51.2±7.9
<0.000
<0.000
<0.000
0.024
0.015
Group 1, 25 patients without NASH. Group 2, 35 patients with
probable NASH and NASH. Data are means±SEM
Author's personal copy
OBES SURG (2011) 21:492–500
497
Fig. 1 Correlations between
the hepatic mRNA levels of
adiponectin receptors and the
oxidative stress-related genes.
Closed points represent patients
without NASH (group 1). Open
points represent patients with
probable NASH or NASH
(group 2). Only the Pearson’s
coefficient and the linear fitting
of significant correlations are
shown. RT Pearson’s coefficient
of total patients, R1 Pearson’s
coefficient of group 1, R2
Pearson’s coefficient of group 2.
*P<0.050, **P<0.010,
***P<0.001
contradictory data are a consequence of biological differences between the patient cohorts and also result from
methodological differences in measuring the mRNA concentration. The selection of an adequate housekeeping gene
for the normalisation of data may be a significant factor in
determining the quality of results [26, 27].
A recent paper reported increases in hepatic ADIPOR1
and ADIPOR2 mRNA levels in obese patients with
Fig. 2 Correlations between the hepatic mRNA levels of both
adiponectin receptors and between GPx1 and Grd. Closed points
represent patients without NASH (group 1). Open points represent
patients with probable NASH or NASH (group 2). Only the Pearson’s
coefficient and the linear fitting of significant correlations are shown.
RT Pearson’s coefficient of total patients, R1 Pearson’s coefficient of
group 1, R2 Pearson’s coefficient of group 2. *P<0.050, **P<0.010,
***P<0.001
Author's personal copy
498
Table 5 BMI and plasmatic
levels before the bariatric
surgery and one year after the
surgery
Only significant differences are
shown. N=42 patients. Data are
means±SEM
OBES SURG (2011) 21:492–500
BMI (kg/m2)
AST (U/L)
ALT (U/L)
GGT (U/L)
Total-cholesterol (mg/dl)
HDL-cholesterol (mg/dl)
Triglycerides (mg/dl)
Glucose (mg/dl)
Glucose (mg/dl)
Insulin
HOMA-IR
Adiponectin (μg/mL)
Total-glutathione (nmol/mg HB)
GPx specific activity
elevated HOMA-IR (mean value, 7.3) with respect to obese
patients with a reduced HOMA-IR (mean value, 1.7) [29],
suggesting a certain link between systemic insulin resistance and the hepatic expression of adiponectin receptors.
Moreover, in our cohort, there were not enough patients at
the extremes of the HOMA-IR to perform a study of this
kind, and there were no significant differences in relation to
the HOMA-index or the fasting insulin level.
Free radical over-production has been related with the
pathology of NAFLD [10]. Oxidative stress is not only a
cause of cellular damage but is also a symptom of
dysfunction in the mitochondrion and the endoplasmic
reticulum [30, 31]. Mitochondrial dysfunction during
obesity is closely related to hypercaloric diets [31].
Oxidative stress triggers inflammatory pathways [32] and,
reciprocally, is generated by the inflammatory process. In
fact, iNOS activity is a major source of the nitric oxide
produced by macrophages during inflammation and is one
of the most important enzymes involved in the oxidative
stress pathway [33]. In animal models, iNOS plays a crucial
role in the development of NASH [34]. Moreover, iNOS
polymorphisms have been related with the risk of NAFLD
in a human cohort [35]. To the best of our knowledge, our
study provides the first report of an increase in hepatic
iNOS expression levels with NAFLD progression in
morbid obesity (Table 4). Our results suggest that, in our
patient cohort, NAFLD progression is accompanied by free
radical over-production in the liver. In this context, the
increase in GRd and GPx1 expression in group 2 (Table 4)
could be interpreted as a stimulation of the stressdetoxifying mechanism in response to a deterioration in
the liver redox status.
Nevertheless, systemic oxidative stress markers did not
present significant differences with NAFLD progression
(Table 3), and at 1 year after the bariatric surgery, only
Before
After
P Value
51.5±1.3
29.8±3.3
31.0±3.1
37.7±8.0
183.1±8.9
36.0±1.6
182.1±18.1
119.0±6.5
119.0±6.5
10.6±1.0
3.4±0.4
39.9±6.0
4.9±0.5
27.9±2.0
31.3±0.9
20.4±1.0
19.3±1.5
17.5±2.1
137.5±6.0
50.6±2.3
88.0±6.6
104.3±2.5
104.3±21.5
4.9±0.6
1.0±0.1
60.0±2.1
6.3±0.5
22.5±1.3
<0.000
0.007
0.001
<0.000
<0.000
<0.000
<0.000
0.037
0.001
0.008
0.001
0.002
0.051
0.026
moderate change was detected in systemic oxidative stress
markers (Table 5). Our results suggest that, in our cohort,
the increase in hepatic oxidative stress-related genes during
NAFLD progression had a slight effect on systemic
oxidative stress markers, which are probably strongly
influenced by other tissues and organs, such as white
adipose tissue.
In accordance with our initial hypothesis, correlations
were found between the expression levels of both adiponectin receptors and the oxidative stress-related genes
measured in the study: GPx1, GRd and iNOS (Fig. 1).
Interestingly, we recorded a strong correlation between both
adiponectin receptors and GPx1, reaching a maximum for
ADIPOR1 among the patients in group 1 (Pearson’s
coefficient of 0.828). These data suggest that ADIPOR1,
ADIPOR2 and GPx1 share key molecular factors in the
regulation of the genetic expressions. Moreover, the
Pearson’s coefficient of these correlations decreased in the
group 2 patients. The onset of liver inflammation probably
causes an alteration in different cellular pathways, which
impacts on the control of many genetic expressions. In
addition, the multivariate analysis showed that the only
independent factor for NAFLD progression was the
increase in GPx1 liver expression. This finding highlights
the weight of GPx1 gene induction in the mechanisms that
may control the progression of NAFLD.
Adiponectin receptors were initially described in 2003
[36]. T-cadherin has also been proposed as a third
adiponectin receptor [37], but its biological relevance
remains controversial [24]. In the liver, ADIPOR1 inhibits
glucose production and increases insulin sensitivity by
activating the AMPK pathway, whereas ADIPOR2
increases glucose uptake by the activation of the PPAR-α
pathway [24]. Moreover, various aspects of adiponectin
receptor signalling remain unclear, such as the connexion
Author's personal copy
OBES SURG (2011) 21:492–500
with cellular oxidative stress pathways. Regarding the
mechanisms responsible for regulating adiponectin receptor
expression, very little has been published. Hepatic, adipose
and muscular adiponectin receptor levels are regulated in
response to changes in nutritional conditions [38–41],
probably to modify glucose metabolism and insulin
sensibility. Nevertheless, there are contradictory data
between different rodent models [39–41]. Currently, the
role of adiponectin receptors under physiological and
pathological variations remains unknown. Two recent
articles studied the promoter activity of adiponectin
receptors in cellular models. ADIPOR1 promoter is
activated by FOXO1 [29], connecting with inflammatory
pathways, whereas ADIPOR2 promoter is repressed by
ATF3 [22], showing a connexion with endoplasmic
oxidative stress pathways.
In this paper, we report increases in adiponectin
receptor expression levels during NAFLD progression.
Furthermore, we report an increase in the gene expression for iNOS expression and antioxidant enzymes.
Interestingly, we found a good correlation between the
hepatic expressions of both adiponectin receptors and
GPx1. Although our results may not be generalisable to
overweight or obese subjects that would not meet the
criteria for gastric bypass surgery, we believe our work
useful for future studies of the molecular mechanism
underlying the expression of adiponectin receptors and
for future research to elucidate the role of adiponectin
signalling during NAFLD progression.
Acknowledgments This work was supported in part by a grant from
Ciberehd (Ciberehd is funded by the Instituto de Salud Carlos III) and
by a grant from Junta de Andalucía (CTS-4357).
Conflicts of Interest None
References
1. Fabbrini E, Sullivan S, Klein S. Obesity and nonalcoholic fatty
liver disease: biochemical, metabolic, and clinical implications.
Hepatology. 2010;51:679–89.
2. Marceau P, Biron S, Hould FS, et al. Liver pathology and
metabolic syndrome X in severe obesity. J Clin Endocrinol Metab.
1999;84:1513–7.
3. Arun J, Jhala N, Lazenby AJ, et al. Influence of liver biopsy
heterogeneity and diagnosis of nonalcoholic steatohepatitis in
subjects undergoing gastric bypass. Obes Surg. 2007;17:155–
61.
4. Machado M, Marques-Vidal P, Cortez-Pinto H. Hepatic histology
in obese patients undergoing bariatric surgery. J Hepatol.
2006;45:600–6.
5. Day CP, James OF. Steatohepatitis: a tale of two “hits”?
Gastroenterology. 1998;114:842–5.
6. Koda M, Kawakami M, Murawaki Y, et al. The impact of visceral
fat in nonalcoholic fatty liver disease: cross-sectional and
longitudinal studies. J Gastroenterol. 2007;42:897–903.
499
7. Wei Y, Rector RS, Thyfault JP, et al. Nonalcoholic fatty liver
disease and mitochondrial dysfunction. World J Gastroenterol.
2008;14:193–9.
8. Tilg H, Moschen AR. Insulin resistance, inflammation, and nonalcoholic fatty liver disease. Trends Endocrinol Metab.
2008;19:371–9.
9. Marra F, Bertolani C. Adipokines in liver diseases. Hepatology.
2009;50:957–69.
10. Narasimhan S, Gokulakrishnan K, Sampathkumar R, et al.
Oxidative stress is independently associated with non-alcoholic
fatty liver disease (NAFLD) in subjects with and without type 2
diabetes. Clin Biochem. 2010;43:815–21.
11. Kadowaki T, Yamauchi T, Kubota N, et al. Adiponectin and
adiponectin receptors in insulin resistance, diabetes, and the
metabolic syndrome. J Clin Invest. 2006;116:1784–92.
12. Kaser S, Moschen A, Cayon A, et al. Adiponectin and its
receptors in non-alcoholic steatohepatitis. Gut. 2005;54:117–21.
13. Ma H, Gomez V, Lu L, et al. Expression of adiponectin and its
receptors in livers of morbidly obese patients with non-alcoholic
fatty liver disease. J Gastroenterol Hepatol. 2009;24:233–7.
14. Nannipieri M, Cecchetti F, Anselmino M, et al. Pattern of
expression of adiponectin receptors in human liver and its relation
to nonalcoholic steatohepatitis. Obes Surg. 2009;19:467–74.
15. Vuppalanchi R, Marri S, Kolwankar D, et al. Is adiponectin
involved in the pathogenesis of nonalcoholic steatohepatitis? A
preliminary human study. J Clin Gastroenterol. 2005;39:237–42.
16. Lemoine M, Ratziu V, Kim M, et al. Serum adipokine levels
predictive of liver injury in non-alcoholic fatty liver disease. Liver
Int. 2009;29:1431–8.
17. Ho YS, Magnenat JL, Bronson RT, et al. Mice deficient in cellular
glutathione peroxidase develop normally and show no increased
sensitivity to hyperoxia. J Biol Chem. 1997;272:16644–51.
18. Cheng WH, Ho YS, Valentine BA, et al. Cellular glutathione
peroxidase is the mediator of body selenium to protect against
paraquat lethality in transgenic mice. J Nutr. 1998;128:1070–6.
19. Loh K, Deng H, Fukushima A, et al. Reactive oxygen species
enhance insulin sensitivity. Cell Metab. 2009;10:260–72.
20. McClung JP, Roneker CA, Mu W, et al. Development of insulin
resistance and obesity in mice overexpressing cellular glutathione
peroxidase. Proc Natl Acad Sci U S A. 2004;101:8852–7.
21. Ristow M, Zarse K, Oberbach A, et al. Antioxidants prevent
health-promoting effects of physical exercise in humans. Proc Natl
Acad Sci U S A. 2009;106:8665–70.
22. Koh IU, Lim JH, Joe MK, et al. AdipoR2 is transcriptionally
regulated by ER stress-inducible ATF3 in HepG2 human
hepatocyte cells. FEBS J. 2010;277:2304–17.
23. Iwabu M, Yamauchi T, Okada-Iwabu M, et al. Adiponectin and
AdipoR1 regulate PGC-1alpha and mitochondria by Ca(2+) and
AMPK/SIRT1. Nature. 2010;464:1313–9.
24. Yamauchi T, Nio Y, Maki T, et al. Targeted disruption of AdipoR1
and AdipoR2 causes abrogation of adiponectin binding and
metabolic actions. Nat Med. 2007;13:332–9.
25. Kleiner DE, Brunt EM, Van Natta M, et al. Design and validation
of a histological scoring system for nonalcoholic fatty liver
disease. Hepatology. 2005;41:1313–21.
26. de Jonge HJ, Fehrmann RS, de Bont ES, et al. Evidence based
selection of housekeeping genes. PLoS ONE. 2007;2:e898.
27. Tatsumi K, Ohashi K, Taminishi S, et al. Reference gene selection
for real-time RT-PCR in regenerating mouse livers. Biochem
Biophys Res Commun. 2008;374:106–10.
28. Shimizu A, Takamura T, Matsuzawa N, et al. Regulation of
adiponectin receptor expression in human liver and a hepatocyte
cell line. Metabolism. 2007;56:1478–85.
29. Felder TK, Hahne P, Soyal SM, et al. Hepatic adiponectin
receptors (ADIPOR) 1 and 2 mRNA and their relation to insulin
resistance in obese humans. Int J Obes Lond. 2010;34:846–51.
Author's personal copy
500
30. Ozcan U, Cao Q, Yilmaz E, et al. Endoplasmic reticulum stress
links obesity, insulin action, and type 2 diabetes. Science.
2004;306:457–61.
31. Mantena SK, Vaughn DP, Andringa KK, et al. High fat diet
induces dysregulation of hepatic oxygen gradients and mitochondrial function in vivo. Biochem J. 2009;17:183–93.
32. Martinon F. Signaling by ROS drives inflammasome activation.
Eur J Immunol. 2010;40:616–9.
33. Kanwar JR, Kanwar RK, Burrow H, et al. Recent advances on the
roles of NO in cancer and chronic inflammatory disorders. Curr
Med Chem. 2009;16:2373–94.
34. Fujita K, Nozaki Y, Yoneda M, et al. Nitric oxide plays a crucial
role in the development/progression of nonalcoholic steatohepatitis in the choline-deficient, l-amino acid-defined diet-fed rat
model. Alcohol Clin Exp Res. 2010;34:18–24.
35. Yoneda M, Hotta K, Nozaki Y, et al. Influence of inducible nitric
oxide synthase polymorphisms in Japanese patients with nonalcoholic fatty liver disease. Hepatol Res. 2009;39:963–71.
OBES SURG (2011) 21:492–500
36. Yamauchi T, Kamon J, Ito Y, et al. Cloning of adiponectin
receptors that mediate antidiabetic metabolic effects. Nature.
2003;423:762–9.
37. Hug C, Wang J, Ahmad NS, et al. T-cadherin is a receptor for
hexameric and high-molecular-weight forms of Acrp30/adiponectin. Proc Natl Acad Sci U S A. 2004;101:10308–13.
38. Rasmussen MS, Lihn AS, Pedersen SB, et al. Adiponectin
receptors in human adipose tissue: effects of obesity, weight loss,
and fat depots. Obes Silver Spring. 2006;14:28–35.
39. Barnea M, Shamay A, Stark AH, et al. A high-fat diet has a tissuespecific effect on adiponectin and related enzyme expression.
Obes Silver Spring. 2006;14:2145–53.
40. Bullen Jr JW, Bluher S, Kelesidis T, et al. Regulation of adiponectin
and its receptors in response to development of diet-induced obesity
in mice. Am J Physiol Endocrinol Metab. 2007;292:1079–86.
41. Beylot M, Pinteur C, Peroni O. Expression of the adiponectin
receptors AdipoR1 and AdipoR2 in lean rats and in obese Zucker
rats. Metabolism. 2006;55:396–401.