Rev Hematol Méx 2015 - Agrupación Mexicana para el Estudio de

Comentarios

Transcripción

Rev Hematol Méx 2015 - Agrupación Mexicana para el Estudio de
VOLUMEN 16, NÚM. 2, Abril-Junio 2015
Revista de
Hematología
Volumen 16
abril-junio 2015
volúmen 9
EDITORIAL
105
El seguimiento óptimo de los pacientes con enfermedades de las células plasmáticas
Morie A Gertz
ARTÍCULOS ORIGINALES
109
115
121
Epidemiología de los linfomas del Centro Estatal de Cancerología de Nayarit
Carlos S Ron-Guerrero, Ana Lucía Ron-Magaña, Carmen L Medina-Palacios, Fernando López-Flores
Variaciones en los alelos 677 C>T y 1298 A>C en el gen que codifica para la enzima 5,10 metilentetrahidrofolato reductasa (MTHFR) y su efecto en la concentración de homocisteína en mestizos mexicanos
Israel Parra-Ortega, Margarita Martínez-Arias, Karina López-Valladares, José Luis Sánchez-Huerta, Leticia
Barrera-Dávila, Vicencio Juárez-Barreto, Briceida López-Martínez
Método cromogénico modificado para medir la actividad anti-Xa en pacientes ictéricos
Diana Noemí García-de Paoletti, Mariano Eduardo Paoletti, Eduardo Armando Paoletti, Elisabeth Aloni-Risana,
Julio Guillermo Soto, Carlos Alberto Barassi, María Alejandra Pereyra, María Fernanda Cerviño, Lisbbett
Suárez-González, Daniel Mielgo
ARTÍCULOS DE REVISIÓN
128
143
152
168
Plasma rico en factores de crecimiento plaquetario. Una nueva puerta a la Medicina regenerativa
Jesús Alcaraz-Rubio, Antonio Oliver-Iguacel, Juana María Sánchez López
Cadenas ligeras: ¿totales o libres? Qué medir y por qué
Florencia Delgado
FLT3, NPM1 y C/EBPα como marcadores de pronóstico en pacientes con leucemia mieloide aguda
Francisco Alejandro Lagunas-Rangel, Víctor Alfredo Pérez-Contreras, Carlos Cortés-Penagos
Estado del arte: metformina, cáncer y leucemia
Christian Omar Ramos-Peñafiel, Adrián Santoyo-Sánchez, Irma Olarte-Carrillo, Gloria Eugenia Queipo-García,
Yonathan Garfias-Becerra, Adolfo Martínez-Tovar
IN MEMORIAM
179
Doctor Elías Jiménez Fonseca
Rafael Jiménez-Bonilla
CARTA AL EDITOR
182
Quimioterapia sin radioterapia en el tratamiento de los estadios iniciales del linfoma de Hodgkin
Guillermo J Ruiz-Arguelles
REVISTA DE HEMATOLOGÍA
Publicación de la Agrupación Mexicana para el Estudio de la Hematología, A.C.
2
2015
Revista de
H ematología
Rev Hematol Mex 2015;16:abril-junio
EDITOR
PRESIDENTE
Guillermo J. RUIZ-ARGÜELLES. Puebla, México
Dr. J. Ramón RIVAS-LLAMAS
VICEPRESIDENTE
COMITÉ EDITORIAL
Dra. Adolfina BERGES-GARCÍA
Álvaro AGUAYO. Ciudad de México, México
Javier BOLAÑOS-MEADE. Baltimore, EUA
Jorge CORTÉS. Houston, EUA
Aurora DE-LA-PEÑA. Ciudad de México, México
Sergio GIRALT. Nueva York, EUA
David GÓMEZ-ALMAGUER. Monterrey, México
Renán A. GÓNGORA-BIACHI. Mérida, México
Bertha IBARRA. Guadalajara, México
José Carlos JAIME-PÉREZ. Monterrey, México
Francesco Lo COCO. Roma, Italia
Xavier LÓPEZ-KARPOVITCH. Ciudad de México, México
Alejandro MADRIGAL. Londres, Inglaterra
Carlos MARTÍNEZ-MURILLO. Ciudad de México, México
Héctor MAYANI. Ciudad de México, México
Rubén A. MESA. Scottsdale, EUA
José María MORALEDA. Murcia, España
Rubén NIESVIZKY. Nueva York, EUA
Guillermo J. RUIZ-DELGADO. Puebla, México
Arlette RUIZ-de-SAEZ, Caracas, Venezuela
Jesús F. SAN-MIGUEL. Salamanca, España
Luz del Carmen TARIN-ARZAGA. Monterrey, México
Enrique TORRE-LÓPEZ. San Luis Potosí, México
José Francisco TOMAS. Madrid, España
Jorge VELA-OJEDA. Ciudad de México, México
Luis A. VILLELA. Monterrey, México
SECRETARIA
Dra. Nidia P. ZAPATA-CANTO
TESORERO
Dr. Ignacio AGUIRRE-AGUIRRE
VOCAL DE ACTIVIDADES ACADÉMICAS
Dr. Guillermo J. RUIZ-DELGADO
VOCAL DE MEMBRESÍA
Dr. Jorge DUQUE-RODRÍGUEZ
Coordinadora Académica
Q.F.B. Josefa Piedras-Ross
Coordinadora administrativa
Mayra OVIEDO-PELL
Revista de Hematología, año 16, número 2, abril-junio 2015, es una publicación trimestral editada por la Agrupación Mexicana para el Estudio
de la Hematología, A.C. San Francisco 1626, Desp. 406, Colonia Del Valle, Delegación Benito Juárez, CP 03100, México, DF. Tel.: 52 (55) 55241112, 52 (55) 5534-1856, www.amehac.org.
Editor responsable: Guillermo J Ruiz-Argüelles. Reserva de Derechos al
Uso Exclusivo otorgado por el Instituto Nacional del Derecho de Autor,
en trámite. ISSN, otorgado por el Instituto Nacional del Derecho de Autor, en trámite. Certificado de Licitud de Título en trámite. Certificado de
Licitud de Contenido en trámite, otorgados por la Comisión Calificadora
de Publicaciones y Revistas Ilustradas de la Secretaría de Gobernación.
Autorización como Publicación Periódica por Sepomex en trámite.
Impresa en Roma Color SA de CV. Pascual Orozco 70, colonia San Miguel Iztacalco, CP 08650, México, DF. Este número se terminó de imprimir el 10 de julio de 2015, con un tiraje de 500 ejemplares.
Las opiniones expresadas por los autores no necesariamente reflejan la
postura del editor de la publicación.
Queda estrictamente prohibida la reproducción total o parcial de los
contenidos e imágenes de la publicación sin previa autorización de la
Agrupación Mexicana para el Estudio de la Hematología, A.C.
Editada y distribuida por Edición y Farmacia SA de CV. José Martí 55,
Colonia Escandón, Delegación Miguel Hidalgo, CP 11800, México, DF.
Tel.: 5678-2811, www.nietoeditores.com.mx.
www.nietoeditores.com.mx
Volumen 16, Núm. 2, abril-junio, 2015
CONTENIDO
CONTENTS
EDITORIAL
EDITORIAL
105
105
El seguimiento óptimo de los pacientes con enfermedades de las células plasmáticas
Morie A Gertz
Optimizing the monitoring of patients with plasma
cell dyscrasias
Morie A Gertz
ARTÍCULOS ORIGINALES
ORIGINAL ARTICLES
109
109
115
121
Epidemiología de los linfomas del Centro Estatal de
Cancerología de Nayarit
Carlos S Ron-Guerrero, Ana Lucía Ron-Magaña,
Carmen L Medina-Palacios, Fernando López-Flores
Variaciones en los alelos 677 C>T y 1298 A>C en
el gen que codifica para la enzima 5,10 metilentetrahidrofolato reductasa (MTHFR) y su efecto
en la concentración de homocisteína en mestizos
mexicanos
Israel Parra-Ortega, Margarita Martínez-Arias, Karina
López-Valladares, José Luis Sánchez-Huerta, Leticia
Barrera-Dávila, Vicencio Juárez-Barreto, Briceida
López-Martínez
Método cromogénico modificado para medir la
actividad anti-Xa en pacientes ictéricos
Diana Noemí García-de Paoletti, Mariano Eduardo
Paoletti, Eduardo Armando Paoletti, Elisabeth AloniRisana, Julio Guillermo Soto, Carlos Alberto Barassi,
María Alejandra Pereyra, María Fernanda Cerviño,
Lisbbett Suárez-González, Daniel Mielgo
115
121
REVIEW ARTICLES
ARTÍCULOS DE REVISIÓN
128
128
143
152
168
Plasma rico en factores de crecimiento plaquetario.
Una nueva puerta a la Medicina regenerativa
Jesús Alcaraz-Rubio, Antonio Oliver-Iguacel, Juana
María Sánchez López
Cadenas ligeras: ¿totales o libres? Qué medir y por
qué
Florencia Delgado
FLT3, NPM1 y C/EBPα como marcadores de pronóstico en pacientes con leucemia mieloide aguda
Francisco Alejandro Lagunas-Rangel, Víctor Alfredo
Pérez-Contreras, Carlos Cortés-Penagos
Estado del arte: metformina, cáncer y leucemia
Christian Omar Ramos-Peñafiel, Adrián SantoyoSánchez, Irma Olarte-Carrillo, Gloria Eugenia
Queipo-García, Yonathan Garfias-Becerra, Adolfo
Martínez-Tovar
IN MEMORIAM
179
Doctor Elías Jiménez Fonseca
Rafael Jiménez-Bonilla
143
152
168
179
Doctor Elías Jiménez Fonseca
Rafael Jiménez-Bonilla
LETTER TO THE EDITOR
182
182
Platelet-rich plasma in growth factors. A new door
to regenerative Medicine
Jesús Alcaraz-Rubio, Antonio Oliver-Iguacel, Juana
María Sánchez López
Light chains. Total or free? Which ones should be
measured
Florencia Delgado
FLT3, NPM1 y C/EBPα as prognosis markers in
patients with acute myeloid leukemia
Francisco Alejandro Lagunas-Rangel, Víctor Alfredo
Pérez-Contreras, Carlos Cortés-Penagos
State of the art: Metformin, cancer and leukemia
Christian Omar Ramos-Peñafiel, Adrián SantoyoSánchez, Irma Olarte-Carrillo, Gloria Eugenia
Queipo-García, Yonathan Garfias-Becerra, Adolfo
Martínez-Tovar
IN MEMORIAM
CARTA AL EDITOR
Quimioterapia sin radioterapia en el tratamiento
de los estadios iniciales del linfoma de Hodgkin
Guillermo J Ruiz-Arguelles
Epidemiology of lymphomas in Nayarit, Mexico
Carlos S Ron-Guerrero, Ana Lucía Ron-Magaña,
Carmen L Medina-Palacios, Fernando López-Flores
Variations in alleles 677C>T and 1298A>C in gene
encoding 5,10-methylenetetrahydrofolate reductase and its impact on the value of homocysteine
in Mexican mestizos
Israel Parra-Ortega, Margarita Martínez-Arias, Karina
López-Valladares, José Luis Sánchez-Huerta, Leticia
Barrera-Dávila, Vicencio Juárez-Barreto, Briceida
López-Martínez
Modified chromogenic method to assess anti-Xa
activity in jaundiced patients
Diana Noemí García-de Paoletti, Mariano Eduardo
Paoletti, Eduardo Armando Paoletti, Elisabeth AloniRisana, Julio Guillermo Soto, Carlos Alberto Barassi,
María Alejandra Pereyra, María Fernanda Cerviño,
Lisbbett Suárez-González, Daniel Mielgo
Chemotherapy alone in early stage Hodgkin’s lymphoma
Guillermo J Ruiz-Arguelles
www.nietoeditores.com.mx
Editorial
Rev Hematol Mex 2015;16:105-108.
Optimizing the monitoring of
patients with plasma cell dyscrasias
Morie A Gertz
Division of Hematology, Mayo Clinic, Rochester, MN.
El seguimiento óptimo de los pacientes
con enfermedades de las células
plasmáticas
INTRODUCTION
In the United States, multiple myeloma is the 14th most common
cancer with an estimated 24,050 patients diagnosed in 2014.
Myeloma represents 1.4% of all new cancer in the United States
with a median age at diagnosis of 69 and a median age at death
of 75. The five-year survival for the years 2004 through 2010 is
44.9%. With the introduction of novel agents, deep responses
≥nCR are now approaching 60%. The assessment of patients with
multiple myeloma has utilized measurement of either the M-spike
or the quantitative heavy chain by nephelometry. These techniques,
based on 1960s technology, have major drawbacks. The half-life
of IgG is 25.8 days.1 As a consequence, confirmation of a >90%
reduction in M protein (VGPR) can take 10 weeks, even when
marked cytoreduction of the myeloma population has occurred.
This delay is not consistent with an individualized management
strategy for myeloma patients. The normal level for IgG in human
serum is 15,000 mg/L and for IgM 500 mg/L. The visual detection of
a monoclonal peak on a serum protein electrophoresis can occur
with levels as low as 2,000 mg/L. However, particularly for IgA
monoclonal proteins that migrate in the beta region, transferrin,
C3, and beta lipoprotein interfere with the estimates of the Mspike.2 At low levels, immunoglobulin levels cannot distinguish
polyclonal from the myeloma immunoglobulin.
Immunofixation is ten times more sensitive than serum protein
electrophoresis, allowing the recognition of a monoclonal band
at 200 mg/L. Unfortunately, this technique is qualitative and not
quantitative and can only determine the presence or absence of
www.nietoeditores.com.mx
Correspondence: Morie A Gertz, MD, MACP
Mayo Clinic
200 First Street, SW
Division of Hematology
Siebens 670
Roland Seidler Jr. Professor
Chair, Department of Medicine
College of Medicine
Mayo Distinguished Clinician
Rochester, MN 55905
[email protected]
This article must be quoted
Gertz MA. Optimizing the monitoring of patients
with plasma cell dyscrasias. Rev Hematol Mex
2015;16:105-108.
105
Revista de Hematología
a band. The reproducibility of a 24-hour urine
requires accurate collection, is dependent on
the level of renal function, and is a sample that
most laboratories find undesirable for processing.
Over the past decade, the introduction of the
immunoglobulin free light chain nephelometric
assay allows reproducible measurements of the
immunoglobulin free light chain down to 10
mg/L, making it 200 times more sensitive than
serum protein electrophoresis and 20-fold more
sensitive than immunofixation. The coefficient of
variation of the test is <3%.
The total kappa/lambda light chain quantification in the monitoring of patients with multiple
myeloma found that the assay was not more
sensitive than immunofixation.3 The immunoglobulin free light chain assay uses an antibody
that only recognizes the epitopes present on the
internally facing light chain that is not exposed
in an intact immunoglobulin molecule. This led
to the recognition of light chain monoclonal
gammopathy of undetermined significance. It
is found in 3.3% of patients who are routinely
screened, with a prevalence of 0.8% and a risk
of progression to multiple myeloma of 0.3%/100
person years. Light chain MGUS is a particular
risk factor for the development of AL amyloidosis
as it was found in 11 of 20 patients who ultimately developed AL.
Use in MGUS/SMM
An abnormal free light chain ratio, when combined with the size of the M-spike, by serum
protein electrophoresis (>1.5 g/dL) and immunofixation (IgG or non-IgG) will classify MGUS
patients into three distinct categories with an
annual risk of transformation of approximately
0.5% per year, 1% per year, and 2% per year.
Volumen 16, Núm. 2, abril-junio 2015
and a serum M protein of >3 g/dL is considered
high risk. The International Myeloma Working
Group has adopted iFLC/uFLC >100 as a defining
feature for active myeloma and an indication
for immediate chemotherapy in the absence of
CRAB symptoms (hypercalcemia, cast nephropathy, anemia, and bone disease).
Light chain assay as a leading indicator of
response and relapse
The short half-life of the free light chain assay
allows rapid assessment of response such that
within two weeks of therapy initiation, it is possible to estimate progression-free survival based
on the iFLC.4 Other groups have demonstrated
the predictive value of free light chains measured
after two cycles of chemotherapy. Overall survival could be estimated at the end of eight weeks.5
In one trial, 54 of 520 patients presented with
an intact immunoglobulin, myeloma progression
was heralded by a rise in the free light chains.6
The sensitivity of the free light chain assay has
eliminated the need for regular monitoring of
the 24-hour urine in patients with light chain
myeloma and has reduced the need for using
bone marrow biopsies for assessing patients with
multiple myeloma.7 In one trial of 428 patients
with a monoclonal gammopathy, discontinuation
of urine studies and reliance on an algorithm
using serum studies alone failed to detect 0.5%
of patients with urinary monoclonal proteins.8 A
review of eligibility criteria in clinicaltrials.gov
demonstrates that the immunoglobulin free light
chain has been incorporated into the eligibility
criteria for clinical trials. The frequency of nonsecretory myeloma, previously quoted as high as
5% of myeloma patients,9 has now fallen to 0.5%.
Use in solitary plasmacytoma
In smoldering multiple myeloma, the light chain
ratio also predicts the risk of progression. An
iFLC/uFLC ratio >8 with >10% plasma cells
106
An abnormal involved serum free light chain
value in the presence of solitary plasma-
Editorial
cytoma is an important risk factor for the
development of multiple myeloma with 64%
of patients having an abnormal serum free
light chain ratio at diagnosis.10 In a cohort of
116 patients, the risk of progression at five
years was 44% in patients with an abnormal
free light compared to 26% in those with a
normal free light ratio. 11
Amyloidosis
The light chain has revolutionized the diagnosis,
staging, and monitoring of patients with immunoglobulin light chain amyloidosis. Unlike
multiple myeloma, only 40% of patients with
amyloidosis have a detectable immunoglobulin
heavy chain in the serum. The quantity of heavy
chain is small, rarely >3 g/dL, with a median <1
g/dL. Prior to the light chain assay, it was difficult
to assess hematologic response. An immunoglobulin free light chain abnormality is found in
98% of patients with amyloidosis, and changes
in the light chain have become integrated into
the hematologic response criteria. Light chain
measurements are also part of the staging system
of AL. A dFLC of >180 mg/L, when combined
with the cardiac biomarkers NT-proBNP and
troponin, create a reliable separation of patients into four groups with markedly different
median survivals. The light chain levels are also
prognostic for survival, reflecting the size of
the plasma cell clone responsible for amyloid
protein synthesis.
Cast nephropathy
Immunoglobulin free light chains in the serum
are predictive for the risk of development of myeloma cast nephropathy. It would be uncommon
to see cast nephropathy develop if the involved
free light chain is <500 mg/L, and patients who
have a normal free light chain level have no risk
of cast nephropathy.12
Other plasma cell disorders
The serum immunoglobulin free light chain was
measured in 83 patients with newly diagnosed
POEMS syndrome. Sixty-seven percent showed
an elevated serum free lambda light chain level.
Patients with POEMS frequently have a component of polyclonal hyperglobulinemia, making
the measurement of the involved serum free light
chain a useful adjunct in assessment.13 The free
light chain assay has been used in Waldenström
macroglobulinemia, to predict response and
progression earlier than changes in the IgM or
the M-spike.14 The serum free light chain correlates with tumor burden markers and is capable
of differentiating IgM MGUS from Waldenström
macroglobulinemia.15
Cost effective use
Although a valuable test, it is relatively expensive
compared to traditional measures. Although, in
large statistical models the ratio has been promoted as the ideal method of monitoring, I actually
find the ratio to be confusing. Small changes
in the uninvolved immunoglobulin light chain
can cause large swings in the ratio, which can
be misleading. Renal failure impacts the level
of the immunoglobulin light chain. However,
when measured serially over time, the involved
free light chain level can be utilized to monitor
the disease process. When resources are an
issue, I believe it is justified to serially measure
only the involved free light chain and ignore the
uninvolved free light chain. This decreases the
cost of the assay by 50%.
CONCLUSION
The introduction of the immunoglobulin free light
chain test has eliminated the need for 24-hour
urine protein electrophoresis.16 It is important in
assessing prognosis and risk of transformation in
107
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
MGUS and smoldering myeloma. The free light
chain assay is now standard for clinical trials in
multiple myeloma and has redefined patients
who are asymptomatic but for whom immediate
therapeutic intervention is indicated.17 The use of
the light chain assay will identify patients at risk
for the development of light chain amyloidosis;
and in AL, it is part of the staging and response
criteria. Nonsecretory and oligosecretory disease
is now rare. The assay is an important indicator of
early response and relapse. It should be routine
in all patients with a plasma cell disorder.
REFERENCES
1.
Mankarious S, Lee M, Fischer S, et al. The half-lives of IgG
subclasses and specific antibodies in patients with primary
immunodeficiency who are receiving intravenously administered immunoglobulin. J Lab Clin Med 1988;112:634640.
2.
Calderon B. Heavy/light chain assay for monitoring IgA
multiple myeloma: digging out the IgA from the beta
region. Clin Chem 2015;61:317-318.
3.
Zamora-Ortiz G, Velazquez-Sanchez-de-Cima S, Hernandez-Reyes J, et al. Poor performance of the total kappa/
lambda light chain quantification in the diagnosis and
follow-up of patients with multiple myeloma. Rev Invest
Clin 2014;66:314-318.
4.
5.
6.
108
Vij R, Wang M, Jagannath S, et al. Serum free light chain
reduction correlates with response and progression-free
survival following carfilzomib therapy in relapsed/refractory multiple myeloma. Leuk Lymphoma 2015:1-12.
Yagci M, Karakaya F, Suyani E, Haznedar R. Serum free light
chain response after 2 courses of induction chemotherapy
predicts prognosis in myeloma patients. Clin Lymphoma
Myeloma Leuk 2015;15:98-102.
Brioli A, Giles H, Pawlyn C, et al. Serum free immunoglobulin light chain evaluation as a marker of impact from
intraclonal heterogeneity on myeloma outcome. Blood
2014;123:3414-3419.
7.
Dispenzieri A, Kyle R, Merlini G, et al. International
Myeloma Working Group guidelines for serum-free light
chain analysis in multiple myeloma and related disorders.
Leukemia 2009;23:215-224.
8.
Katzmann JA, Dispenzieri A, Kyle RA, et al. Elimination of
the need for urine studies in the screening algorithm for
monoclonal gammopathies by using serum immunofixation and free light chain assays. Mayo Clinic Proceedings
2006;81:1575-1578.
9.
Terpos E, Apperley JF, Samson D, et al. Autologous stem
cell transplantation in multiple myeloma: improved survival
in nonsecretory multiple myeloma but lack of influence of
age, status at transplant, previous treatment and conditioning regimen. A single-centre experience in 127 patients.
Bone Marrow Transplant 2003;31:163-170.
10. Fouquet G, Guidez S, Herbaux C, et al. Impact of initial FDGPET/CT and serum-free light chain on transformation of
conventionally defined solitary plasmacytoma to multiple
myeloma. Clin Cancer Res 2014;20:3254-3260.
11. Dingli D, Kyle RA, Rajkumar SV, et al. Immunoglobulin free
light chains and solitary plasmacytoma of bone. Blood
2006;108:1979-1983.
12. Hutchison CA, Cockwell P, Cook M. Diagnostic accuracy of
monoclonal antibody based serum immunoglobulin free
light chain immunoassays in myeloma cast nephropathy.
BMC Clin Pathol 2012;12:12.
13. Wang C, Su W, Zhang W, et al. Serum immunoglobulin free
light chain and heavy/light chain measurements in POEMS
syndrome. Ann Hematol 2014;93:1201-1206.
14. Leleu X, Xie W, Bagshaw M, et al. The role of serum immunoglobulin free light chain in response and progression
in waldenstrom macroglobulinemia. Clin Cancer Res
2011;17:3013-3018.
15. Leleu X, Moreau AS, Weller E, et al. Serum immunoglobulin
free light chain correlates with tumor burden markers
in Waldenstrom macroglobulinemia. Leuk Lymphoma
2008;49:1104-1107.
16. Jenner E. Serum free light chains in clinical laboratory
diagnostics. Clin Chim Acta 2014;427:15-20.
17. Rajkumar SV, Dimopoulos MA, Palumbo A, et al. International Myeloma Working Group updated criteria for the diagnosis of multiple myeloma. Lancet Oncol 2014;15:e538e548.
Artículo original
Rev Hematol Mex 2015;16:109-114.
Epidemiología de los linfomas del
Centro Estatal de Cancerología de
Nayarit
RESUMEN
Antecedentes: los linfomas son un grupo heterogéneo de malignidades; su incidencia ha aumentado 2 a 3% en las últimas décadas en
todo el mundo. El desarrollo molecular y de la inmunogenética ha
repercutido positivamente en la clasificación y pronóstico de estas
enfermedades.
Carlos S Ron-Guerrero1
Ana Lucía Ron-Magaña2
Carmen L Medina-Palacios3
Fernando López-Flores4
Centro Estatal de Cancerología de Nayarit, México.
Hospital Civil de Guadalajara Fray Antonio Alcalde.
3
Facultad de Medicina, Universidad Autónoma de
Nayarit.
4
Epidemiología de los Servicios de Salud de Nayarit,
México.
1
2
Objetivo: describir aspectos epidemiológicos y analizar la tendencia de
los linfomas de pacientes atendidos en el Centro Estatal de Cancerología
de los Servicios de Salud de Nayarit.
Material y método: estudio retrospectivo y analítico en el que se revisaron los expedientes de pacientes con linfoma, de enero de 2011
a diciembre de 2014; los datos se resumieron mediante las medidas
de tendencia central, desviación estándar y porcentajes, además, se
calculó la supervivencia de los pacientes y la mortalidad acumulada
con el método de Kaplan y Meier.
Resultados: se obtuvieron 81 casos con linfoma, incidencia de
3.4/100,000/año, 47.7% ocurrió en los varones y 54.3% en las mujeres. Se estimó la supervivencia libre de enfermedad a 60 meses en
73% de los adultos. La edad promedio para ambos géneros fue de 57.8
± 15.6 años, correspondiendo para las mujeres 59.3 ± 16.18 años y
para los hombres 55.51 ± 14.54 años. En relación con los linfomas
de células B grandes, en hombres afectó a 16 de 30 con edad media
de 57.7 ± 12.9 años y en las mujeres afectó a 14 de 30 con edad
media de 56.2 ± 17.2 años. La supervivencia libre de enfermedad a
60 meses fue de 70%.
Conclusiones: los linfomas ocurrieron en la misma frecuencia que lo
comunicado en la bibliografía mundial; sin embargo, en nuestra casuística fueron más comunes en mujeres. Las edades medias también fueron
ligeramente menores en ambos géneros. La supervivencia y curación
fueron las mismas que lo reportado en la bibliografía mundial cuando
se administra rituximab.
Palabras clave: linfomas, epidemiología, Nayarit.
Recibido: 10 de diciembre 2014
Aceptado: 30 de enero 2015
Correspondencia: Dr. Carlos S Ron Guerrero
Epidemiology of lymphomas in Nayarit,
Mexico
ABSTRACT
Background: Lymphomas are a heterogeneous group of malignancies,
its incidence has increased from 2-3% in recent decades worldwide.
www.nietoeditores.com.mx
Av. Enfermería s/n
63170 Tepic, Nayarit, México
[email protected]
Este artículo debe citarse como
Ron-Guerrero CS, Ron-Magaña AL, Medina-Palacios
CL, López-Flores F. Epidemiología de los linfomas
del Centro Estatal de Cancerología de Nayarit. Rev
Hematol Mex 2015;16:109-114.
109
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
The molecular and immuno-genetic development has a positive impact
on the classification and prognosis of these diseases.
Objective: To describe and analyze the epidemiological trend of lymphoma patients treated at the Cancer Center of State Health Services
of Nayarit, Mexico.
Material and method: A retrospective and analytical study in which
records of lymphoma patients were reviewed from January 2011 to
December 2014 and data were summarized using measures of central
tendency, standard deviation and percentages, and also the survival of
patients and the cumulative mortality were calculated with the method
of Kaplan and Meier.
Results: Eighty-one cases with lymphoma, incidence of 3.4/100,000/
year; 39 were males. Diffuse large B-cell lymphoma was the most common (n=30). The average age with standard deviation for both genders
was 57.8 ± 15.6 years, corresponding to women 59.3 ± 16.18 years
and for men 55.51 ± 14.54 years. Regarding the diffuse large B-cell
lymphoma (DLBCL), there was slight predominance in males (16/30),
average age of 57.7 ± 12.9 years, as women (14/30), average age of 56.2
± 17.2 years. Disease-free survival at 60 months was estimated of 70% .
Conclusions: Lymphomas are presented at the same frequency as
that reported in the literature; however, in our study they were more
common in women. The middle ages are also slightly younger in both
genders. Survival and cure were the same as reported in the literature,
when rituximab is used.
Key words: lymphomas, epidemiology, Nayarit, Mexico.
ANTECEDENTES
Los linfomas son un grupo heterogéneo de malignidades, que derivan de las células B, células
T o de las células NK. Ocupan el quinto lugar de
los tumores malignos más frecuentes en Estados
Unidos, con 74,490 nuevos casos en 2009.1 La
incidencia de los linfomas ha aumentado estadísticamente en las últimas décadas, de 2 a 3%
por año. Aproximadamente 85% de los casos
son linfomas no Hodgkin y 15% corresponde a
linfomas de Hodgkin.
Los linfomas no Hodgkin, con una ocurrencia
estimada de 65,980 nuevos casos cada año,
representan 4% de todos los casos nuevos de
cáncer en Estados Unidos.1 La incidencia es
110
mayor en hombres y se incrementa con la edad.
Los factores que contribuyen a esa incidencia en
aumento de los linfomas incluyen la población
con síndrome de inmunodeficiencia humana,
quienes están en mayor riesgo de padecer un
linfoma. Sin embargo, esa población explica en
50% el aumento de los linfomas; otras razones
de ese aumento de los linfomas se desconocen o
se entienden escasamente. Las toxinas del medio
ambiente probablemente son factores causales
importantes. Los linfomas no Hodgkin también
afectan a pacientes con estados inmunodepresores y con enfermedades autoinmunitarias.2,3
La infección por el virus de Epstein-Barr está
implicada en la mayor parte de las enfermedades
linfoproliferativas; además del VIH, otros virus
y gérmenes están implicados, como el virus
Ron-Guerrero CS y col. Epidemiología de los linfomas en Nayarit
linfotrópico de células T humano tipo I, virus de
la hepatitis C, Helicobacter pylori, herpes virus
humano tipo 8, Borrelia burgdorferi, Chlamydia
psittaci y Campylobacter jejuni.4,5
tajes. Además, se calculó la supervivencia de los
pacientes y la mortalidad acumulada mediante
el método de Kaplan y Meier.
RESULTADOS
El avance en las técnicas diagnósticas moleculares ha incrementado la precisión del diagnóstico
y la identificación de subtipos con diferentes
respuestas terapéuticas. Por ejemplo, en el
linfoma difuso de células B grandes, solamente
una tercera parte de los pacientes se curan con
ciclofosfamida, hidroxidaunorubicina, vincristina (Oncovin®) y prednisona (CHOP), y cerca
de la mitad se curan cuando se agrega rituximab
(CHOP-R).6 Sin embargo, el seguimiento a largo
plazo mostró que la supervivencia a 5 y 10 años
no era diferente a la del tratamiento con CHOP
sin rituximab.7
El objetivo de este artículo es conocer el comportamiento local de la supervivencia y las
características epidemiológicas de los pacientes
con linfoma atendidos en el Servicio de Hematología del Centro Estatal de Cancerología de
los Servicios de Salud de Nayarit, México, en
un periodo de cuatro años.
MATERIAL Y MÉTODO
Estudio en el que se revisaron los expedientes
del Servicio de Hematología del Centro Estatal
de Cancerología de Nayarit, del 1 de enero de
2011 al 31 de diciembre de 2014, y se analizaron
todos los expedientes de los pacientes de todas
las edades y géneros que habían ingresado con
el diagnóstico de linfoma. Luego se agruparon
en dos: mayores de 18 años (adultos) y de 18
años o menos (niños), se separaron por género,
tipo y subtipo de linfoma.
Análisis estadístico
Los datos se resumieron mediante las medidas de
tendencia central, desviación estándar y porcen-
Se identificaron 81 linfomas, 75 linfomas no
Hodgkin y 6 linfomas de Hodgkin. Se encontraron 71 linfomas de células B y 10 de células
T (Cuadro 1).
De los linfomas, 69 correspondieron a pacientes mayores de 18 años y 22 a menores de 18
años. Con incidencia de 20.2 linfomas por año,
corresponde a una incidencia de 3.4 linfomas
por 100,000 habitantes por año.
Treinta y siete linfomas correspondieron a
hombres y 44 a mujeres. El linfoma difuso de
células B grandes (LDCBG) fue el más frecuente
(n=30), le siguió el linfoma difuso de células B
pequeñas con 18 pacientes, 8 fueron linfomas
foliculares. No fue posible identificar el subtipo
de 7 linfomas. El resto (n=18) correspondió a
otros linfomas (Figura 1).
La distribución de los linfomas por género fue
de 37 en hombres contra 44 en las mujeres. La
edad promedio en los adultos en ambos géneros
fue de 57.8 ± 15.6 años; en las mujeres fue de
59.3 ± 16.18 años y en los hombres de 55.51
± 14.54 años.
En relación con los linfomas difusos de células
B grandes hubo ligero predominio en hombres
Cuadro 1. Distribución de los linfomas
Tipo de linfoma
No Hodgkin
De Hodgkin
De células B
De células T
Núm.
75
6
71
10
111
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
8
7
7
3
1
2
2
2
1
Li
n
LD
CB
fo LD G
m
a CB
fo
lic P
L ula
no r
id
en
LC
CT
LP
M C
AL B
T
ga
LN s
H
-T
Li
n f Bu r
ob ki
la tt
sto
m
LN a
H
-A
35
30
30
25
18
20
15
10
5
0
Figura 1. Distribución de los linfomas no Hodgkin.
LDCBG: linfoma difuso de células B grandes; LDCBP:
linfoma difuso de células B pequeñas; L no iden:
linfomas no identificados; LCCT: linfoma cutáneo de
células T; LPCB: linfoma plasmocitoide de células
B; MALT gas: linfoma asociado con mucosa gástrica
(maltoma); LNH-L: linfoma no Hodgkin linfoblástico;
LNH-A: linfoma no Hodgkin angiocéntrico.
(16 de 30), con edad promedio de 57.7 ± 12.9
años; en cuanto a las mujeres (14 de 30) la edad
promedio fue de 56.2 ± 17.2 años (Cuadro 2).
Los linfomas afectaron más a adultos que a niños;
por cada cuatro linfomas tres correspondieron a
un adulto contra un niño, relación de 3:1.
Los resultados en relación con la supervivencia de
todos los pacientes adultos con linfoma atendidos
en el Centro de Nayarit, independientemente del
tipo y subtipo, se estimaron mediante la curva de
supervivencia de Kaplan y Meier; se obtuvo una
mediana del tiempo de supervivencia a cinco
años de 73% (Figura 2), correspondiendo a 80% a
cinco años de supervivencia libre de enfermedad
para los pacientes adultos con linfoma difuso de
células B pequeñas, y supervivencia global de
48% (Figura 3). Mientras que para los pacientes
con linfoma de células B grandes la supervivencia
libre de enfermedad a cinco años fue de 70% y
la global de 48% (Figura 4).
DISCUSIÓN
En 2008, Globocan reportó una incidencia
mundial de los linfomas no Hodgkin de 5.1 por
100,000 habitantes por año.8
Los datos estadísticos de cáncer publicados
periódicamente en Estados Unidos informan
que los linfomas no Hodgkin ocupan el séptimo
lugar de todos los cánceres en hombres adultos,
Cuadro 2. Distribución de los linfomas en adultos por género
y mediana de edad
Linfomas
112
Número Edad promedio
± desviación
estándar
Todos los linfomas
Mujeres
Hombres
81
44
37
57.8±15.6
59.3±16.8
55.51±14.5
Linfoma difuso de células B
grandes
Mujeres
Hombres
Linfoma difuso de células B
pequeñas
Mujeres
Hombres
Linfoma folicular
30
14
16
56.95±15.05
56.18±17.23
57.72±12.98
18
10
8
59.78±16.98
64.7±21.56
54.87±12.40
8
32.83±9.54
Supervivencia acumulada
1.0
0.8
0.6
0.4
0.2
0.0
0
20
40
60
80
Tiempo en meses
Función de supervivencia
100
120
Censurado
Figura 2. Curva de supervivencia, 73% a cinco años
en pacientes adultos con cualquier tipo de linfoma.
Ron-Guerrero CS y col. Epidemiología de los linfomas en Nayarit
Neoplasias Malignas de 2002 dio a conocer que
la tasa de los linfomas no Hodgkin fue de 3.6.
La incidencia calculada en nuestros pacientes
con linfomas no Hodgkin fue de 3.4 casos por
100,000 habitantes por año.
Supervivencia acumulada
1.0
0.8
0.6
0.4
0.2
0.0
0
10
20
30
Tiempo en meses
Función de supervivencia
40
50
Censurado
Figura 3. Curva de supervivencia libre de enfermedad,
80% a cinco años en pacientes adultos con linfoma
difuso de células B pequeñas. Supervivencia global
de 48%.
Supervivencia acumulada
1.0
0.8
0.6
0.4
0.2
0.0
0
10
20
30
40
50
Tiempo en meses
Función de supervivencia
Censurado
Figura 4. Curva de supervivencia libre de enfermedad,
70% a cinco años en pacientes con linfoma difuso
de células B grandes. Supervivencia global de 48%.
mientras que en las mujeres ocupan el sexto lugar.9 El registro de la Organización Mundial de
la Salud, a través del organismo Globocan, en
2002, informó que la tasa ajustada en el mundo
en los varones era de 5.6 y en las mujeres de
3.3. En México, el Registro Histopatológico de
Los linfomas no Hodgkin son más frecuentes en
los varones y se incrementan con la edad, sobre
todo a partir de los 50 años. En niños y jóvenes
son más raros y agresivos que en los adultos.
La incidencia en los niños es poco frecuente y
tiene predominio extranodal, 50 a 70% tiene
inmunofenotipo B y se cura 70 a 90% de los
casos. En los adultos la incidencia es alta, tiene
predominio nodal, 70 a 90% corresponde a
inmunofenotipo B, el curso clínico es variable
y la tasa de curación es de alrededor de 30%.10
Nuestro estudio mostró 90% con inmunofenotipo de células B y 10% de células T.
La Sociedad Americana de Cáncer reporta que
el promedio de edad al diagnóstico de linfoma
difuso de células B grandes es de 65 años, de
60 a 70 años en el caso de los linfomas foliculares, de 60 años en los sujetos con linfomas de
células del manto, de 61 años en el caso de los
linfomas MALT, con predominio en las mujeres
y, respecto a los linfomas de la zona marginal, el
promedio de edad es de 60 años, con relación
similar hombre a mujer.11 El promedio de edad
al diagnóstico de estos linfomas es de 62.2 años.
Nosotros encontramos, igual a lo comunicado
en la bibliografía mundial, que los linfomas no
Hodgkin también son más frecuentes en los
adultos (75%), en comparación con los niños
(25%). Sin embargo, en relación con el género,
encontramos que en las mujeres con linfoma no
Hodgkin ocurrieron en 44 y en los varones en 37
de todos los casos con linfoma, con promedio
de edad al diagnóstico de 57.8 años. El subtipo
más frecuente fue el linfoma difuso de células
B grandes con 30 casos, le siguió el linfoma difuso de células B pequeñas con 18 casos, luego
hubo 8 casos de linfoma folicular; en 7 casos no
113
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
pudo identificarse el subtipo del linfoma y los 18
restantes fueron otros subtipos de linfoma, como
de Burkitt, angioinmunoblásticos, linfoblásticos,
enfermedad de Castleman, de células B del
manto, primarios de bazo, cutáneos de células
B, cutáneos de células T y de MALT. Morton y
colaboradores reportaron el siguiente patrón
de incidencia: el linfoma difuso de células B
grandes predomina en hombres, a diferencia del
linfoma de la zona marginal. El linfoma folicular
es ligeramente más frecuente en hombres que en
mujeres, mientras que el linfoma linfocítico de
células pequeñas-leucemia linfocítica crónica
(SLL/CLL, por sus siglas en inglés), afecta casi dos
veces más a varones que a mujeres.12
En nuestra revisión, igualmente encontramos que
el linfoma difuso de células B grandes ocurrió
con mayor frecuencia, la misma reportada por la
Sociedad Europea de Oncología Médica, ambas
con 37% de los casos. Sin embargo, Labardini
reportó una frecuencia de 48%.13
El tratamiento de primera línea que prescribimos
fue el esquema CHOP; sin embargo, a mediados
de 2012 en nuestro centro se tuvo acceso a rituximab, mismo que ahora se agrega al esquema
CHOP cuando el inmunofenotipo del linfoma
está compuesto por células B CD20+. La supervivencia libre de enfermedad de nuestros pacientes
con linfoma no Hodgkin, independientemente
del subtipo, se calculó en 73% a 60 meses. Esos
mismos reportes se encuentran en la bibliografía
mundial, que indica que la supervivencia libre
de recaída a 60 meses con CHOP sin rituximab
es de alrededor de 65%, mientras que con rituximab es de 75%.14
114
REFERENCIAS
1.
Jamal A. Siegel R, Ward E, et al. Cancer statistics, 2009. CA
Cancer J Clin 2009;59:225-249.
2.
KnowlesDM. Immunodeficiency-associated lymphoproliferative disorders. Mod Pathol 1999;12:200-217.
3.
Zintzaras E, Voulgarelis M, Moutsopoulos HM. The risk of
lymphoma development autoimmune diseases: a metaanalysis. Arch Intern Med 2005;165:2337-2344.
4.
Dohden K, Kaiszaki Y, Hosokawa O, et al. Regression of
rectal mucosa-associated lymphoid tissue lymphoma
but persistence of Helicobacter pylori infection of gastric
mucosa after administration of levofloxacin: report a case.
Dis Colon Rectum 2004;47:1544-1546.
5.
Engels EA, Chatterjee N, Cerhan JR, Davis S, et al. Hepatitis
C virus infection and non-Hodgkin lymphoma: results of
NCI-SEER multi-center case-control study. Int J Cancer
2004;111:76-80.
6.
Savage Kl, Johnson NA, Ben-Neriah S, et al. MYC gene
rearrangements are associated with a poor prognosis in
diffuse large B-cell lymphoma patients treated with R-CHOP
chemotherapy. Blood 2009;114:3533-3537.
7.
Coiffier B, Thieblemontc C, Vardan E, et al. Longterm outcome of patients of NLH-98-5 trial. Blood
2010;116:2040-2045.
8.
Blinder V, Fisher SG. The role of environmental factors in
the etiology of lymphoma. Cancer Invest 2008;26:306-316.
9.
Siegel R, Naishadham D, Jemal A. Cancer Statistics, 2013.
CA Cancer J Clin 2013;63:11-30.
10. Globocan 2008http://www-dep.iarc.fr.
11. American Cancer Society. Cancer & Figures 2015. Atlanta,
Ga: American Cancer Society 2015.
12. Morton LM, Wang SS, Devesa SS, et al. Lymphoma incidence patterns by WHO subtype in the United States,
1992-2001. Blood 2006;107:265-276.
13. Labardini-Méndez J, Cervera-Ceballos E, Corrales-Alfaro
C y col. Linfoma no Hodgkin Onco-guía. Cancerología
2001;6:139-152.
14. Coiffier B, Lepage E, Briere J, et al. CHOP chemotherapy
plus rituximab compared with CHOP alone in elderly
patients with diffuse large B-cel lymphoma. N Engl J Med
2002;346:235-242.
Artículo original
Rev Hematol Mex 2015;16:115-120.
Variaciones en los alelos 677
C>T y 1298 A>C en el gen que
codifica para la enzima 5,10
metilentetrahidrofolato reductasa
(MTHFR) y su efecto en la
concentración de homocisteína en
mestizos mexicanos
Israel Parra-Ortega1
Margarita Martínez-Arias1
Karina López-Valladares1
José Luis Sánchez-Huerta1
Leticia Barrera-Dávila1
Vicencio Juárez-Barreto2
Briceida López-Martínez1
Laboratorio Clínico.
Servicio de Medicina Transfusional.
Hospital Infantil de México Federico Gómez.
1
2
RESUMEN
Antecedentes: algunos estudios han descrito la coexistencia en forma
heterocigota de las mutaciones C677T y A1298C en el gen que codifica
para la enzima MTHFR, que juega un papel importante en la patogenia
de algunas enfermedades, como la predisposición a trombosis.
Objetivo: identificar la frecuencia de las mutaciones C677T y A1298C
en un grupo de mestizos mexicanos.
Material y método: estudio transversal descriptivo, en el que se incluyeron 207 voluntarios aparentemente sanos (disponentes sanguíneos) en
los que se investigaron, mediante la reacción en cadena de la polimerasa
en tiempo real, las mutaciones C677T y A1298C en el gen que codifica
para la enzima MTHFR para obtener la frecuencia de las variaciones
alélicas y comparar las concentraciones de homocisteína sérica.
Resultados: de los 207 sujetos sanos estudiados, se identificaron sólo
28 (13.5%) con genotipo normal y 179 (86.5%) con genotipo mutado;
las combinaciones identificadas fueron: 14 (7%) con 677 normal/1298
heterocigotos, 74 (36%) con 677 heterocigotos/1298 normal, 67 (32%)
con 677 homocigoto mutado/1298 normal, 23 (11%) con 677 heterocigoto/1298 heterocigoto, uno (0.5%) con 677 homocigoto mutado/1298
heterocigotos. Las diferencias entre las medias de homocisteína para
todos los grupos de mutaciones fue estadísticamente significativa, p
< 0.05.
Conclusiones: la frecuencia de la coexistencia en estado heterocigoto
compuesto de los polimorfismos C677T y A1298C en la enzima 5,10
metilentetrahidrofolato reductasa en mestizos mexicanos no es infrecuente porque ocurrió en 11% de los sujetos estudiados. La experiencia
obtenida en este grupo de estudio confirma la asociación de las variaciones alélicas en MTHFR y el aumento de homocisteína.
Palabras clave: alelos 677 C>T, 1298 A>C, gen que codifica para la
enzima 5,10 metilentetrahidrofolato reductasa, homocisteína.
www.nietoeditores.com.mx
Recibido: 3 de diciembre 2014
Aceptado: 29 de enero 2015
Correspondencia: Dra. Briceida López Martínez
Subdirección de Servicios Auxiliares de
Diagnóstico
Hospital Infantil de México Federico Gómez
Dr. Márquez 162
06727 México, DF
[email protected]
Este artículo debe citarse como
Parra-Ortega I, Martínez-Arias M, López-Valladares
K, Sánchez-Huerta JL y col. Variaciones en los alelos
677 C>T y 1298 A>C en el gen que codifica para
la enzima 5,10 metilentetrahidrofolato reductasa
(MTHFR) y su efecto en la concentración de homocisteína en mestizos mexicanos. Rev Hematol Mex
2015;16:115-120.
115
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
Variations in alleles 677C>T
and 1298A>C in gene encoding
5,10-methylenetetrahydrofolate
reductase and its impact on the value of
homocysteine in Mexican mestizos
ABSTRACT
Background: Some studies describe the coexistence in heterozygous
form of C677T and A1298C mutations in the gene encoding the MTHFR
enzyme, that plays an important role in pathogenesis of some diseases
such as predisposition to thrombosis.
Objective: To investigate the frequency of mutations in a group of
Mexican mestizos.
Material and method: A descriptive cross-sectional study including 207
apparently healthy volunteers (blood disponentes), in which, by polymerase chain reaction in real time, it was researched C677T and A1298C
mutations in the gene encoding the enzyme MTHFR for frequency
included allelic variations and comparing the serum homocysteine.
Results: Of the 207 healthy individuals studied, we identified only
28 (13.5%) with a normal genotype and 179 (86.5%) with a mutated
genotype; combinations identified were: 14 (7%) with 677 normal/1298
heterozygotes, 74 (36%) heterozygous 677/1298 normal, 67 (32%)
mutated homozygous 677/1298 normal, 23 (11%) heterozygous
677/1298 heterozygous, one (0.5%) mutated homozygous 677/1298
heterozygotes. The differences between the means of homocysteine ​​for
all groups of mutations were considered significant, p <0.05.
Conclusions: The frequency of coexistence compound heterozygote state
of polymorphisms C677T and A1298C 5,10 methylenetetrahydrofolate
reductase in Mexican mestizos is not uncommon, as it was presented in
11% of those studied. The experience gained in this group of patients
confirms the association of allelic variations in MTHFR and increased
homocysteine.
Key words: alleles 677C>T and 1298A>C, gene encoding 5,10-methylenetetrahydrofolate reductase, homocysteine.
ANTECEDENTES
La hiperhomocisteinemia es un factor de riesgo
independiente de aterosclerosis y aterotrombosis.1 La homocisteína se forma a partir del
116
metabolismo de la metionina2 por medio de
reacciones de transmetilación.3 Las principales
enzimas implicadas en este sistema me­tabólico
son la cistationina β sintetasa, la metionina
sintetasa y la metilentetrahidrofolato reductasa
Parra-Ortega I y col. Variaciones en los alelos 677 C>T y 1298 A>C
(MTHFR),3-8 las vitaminas B6 y B12 participan en
forma de coenzimas y el ácido fólico como sustrato.9 Se han reportado variaciones genéticas
que afectan a las enzimas descritas,6-8 ya sea
en su funcionalidad, cantidad o en ambas, lo
que resulta en el aumento de la concentración
de homocisteína en el plasma y los tejidos.
El polimorfismo más frecuente es el 677 C>T
en el gen que codifica para la enzima 5,10
metilentetrahidrofolato reductasa (MTHFR),10
que disminuye la actividad enzimática. La
existencia del polimorfismo A1298C en la
misma enzima disminuye la actividad de la
enzima y, por tanto, aumenta la concentración
de homocisteína.11-13
En la población caucásica se ha descrito la
incidencia de polimorfismos C677T en MTHFR en aproximadamente 40% para los estados
heterocigotos y de 10% para los homocigotos.14
En México existen diversas publicaciones del
polimorfismo C677T de MTHFR; en 1999, Mutchinick y colaboradores3 realizaron un estudio
de la frecuencia de ese polimorfismo y en 2001,
Ruiz-Argüelles y su grupo publicaron la primera
evidencia de la alta prevalencia del polimorfismo C677T de MTHFR en pacientes mexicanos
con estados hipercoagulables.6 La coexistencia
de los polimorfismos C677T/A1298C en el gen
que codifica para MTHFR se ha descrito en
algunos estudios14,15 y su papel en la patogenia
de algunas enfermedades no se ha identificado
con certeza. Posterior al hallazgo de la coexistencia de los polimorfismos C677T/A1298C en
el gen que codifica para MTHFR como único
marcador asociado con el evento trombótico
en nueve pacientes pediátricos,16 planteamos
el objetivo de identificar la frecuencia de la
coexistencia de los polimorfismos C677T y
A1298C en el gen que codifica para la enzima
MTHFR en un grupo de mestizos mexicanos
sanos y su relación con la concentración de
homocisteína.
MATERIAL Y MÉTODO
Estudio transversal descriptivo en el que se incluyeron 207 voluntarios aparentemente sanos, 46
del sexo femenino, con edad media de 33 años,
límites de 18 y 59 años, a los que se les realizó
el protocolo de evaluación para ser disponentes
sanguíneos, siguiendo los protocolos de selección y clasificación del servicio de Medicina
Transfusional del Hospital Infantil de México
Federico Gómez. A todos los voluntarios, previa
autorización, se les tomó una muestra de 3 a 5
mL de sangre periférica anticoagulada con EDTA,
para la extracción de ácido desoxirribonucleico
(ADN). La extracción se realizó con base en la
metodología que utiliza perlas magnéticas y el
equipo MagNA Pure Compact Roche DiagnosticMR, la reacción en cadena de la polimerasa en
tiempo real (PCR-RT). Con el uso de sondas FRET
(transferencia de energía fluorescente mediante
resonancia) investigamos las mutaciones C677T
y A1298C en el gen que codifica para la enzima
MTHFR con los diseños comerciales: LightMix®
for the detection of human MTHFR C677T, número de catálogo 40-0095-16 y LightMix® for the
detection of human MTHFR A1298C, número
de catálogo 40-0269-16 de TibMolBiol®. Para la
medición de homocisteína se utilizó un inmunoensayo automatizado para la determinación
cuantitativa de L-homocisteína total en plasma
humano citratado por turbidimetría de partículas
de látex en los sistemas de analítico ACL TOP 500
de IL Diagnostic®.
Los datos de la concentración de plasma de homocisteína se analizaron utilizando el programa
IBM SPSS Statistics ver. 22.0.0.0 para Mac OSX.
Se realizó un análisis estadístico descriptivo
para todas las variables, se realizó prueba de
normalidad a las variables con la prueba de
Kolmogorov-Smirnov, prueba de t de Student
para calcular el nivel de probabilidad entre
grupos y se compararon las diferencias entre las
117
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
medias con ANOVA multivariado para todos los
grupos de mutaciones; se consideró significativo
un valor de p menor a 0.05.
RESULTADOS
De los 207 voluntarios aparentemente sanos estudiados, se identificaron sólo 28 (13.5%) con un
genotipo normal (677CC/1298AA) y 179 (86.5%)
con un genotipo mutado; las combinaciones identificadas fueron: 14 (7%) con 677 normal/1298
heterocigotos (677CC/1298AC), 74 (36%) 677
heterocigoto/1298 normal (677CT/1298AA),
67 (32%) 677 homocigoto mutado/1298
normal (677TT/1298AA), 23 (11%) 677 heterocigoto/1298 heterocigoto (677CT/1298AC), uno
(0.5%) 677 homocigoto mutado/1298 heterocigoto (677TT/1298AC). Figura 1 y Cuadros 1 y 2
Cuadro 1. Variaciones identificadas en los alelos 677 C>T
y 1298 A>C en el gen que codifica para la enzima 5,10
metilenetetrahidrofolato reductasa (MTHFR)
Genotipo en 677 de
MTHFR
Genotipo en 1298
de MTHFR
Núm. (%)
n=207
Normal
Normal
Heterocigoto
Homocigoto mutado
Heterocigoto
Homocigoto mutado
Normal
Heterocigoto
Normal
Normal
Heterocigoto
Heterocigoto
28 (13.5)
14 (7)
74 (36)
67 (32)
23 (11)
1 (0.5)
de los genotipos: 677CT/1298 AA y 677TT/1298
AA (p=0.019), 677TT/1298 AA y 677CT/1298
AC (p=0.019), 677TT/1298 AA y 677CT/1298
AC (p=0.004), 677CT/1298 AC y 677TT/1298
AA (p=0.004). Cuadro 3
CONCLUSIONES
Las diferencias de la concentración de homocisteína entre los diferentes grupos resultó
significativa (p=0.022). Las diferencias estadísticamente significativas en las comparaciones
entre grupos ocurrieron en las comparaciones
35,00
32,96
29,38
Homocisteína
30,00
25,72
25,00
20,00
15,00
La frecuencia identificada en este grupo de
pacientes sugiere que la coexistencia en estado
heterocigoto compuesto de los polimorfismos
C677T y A1298C en la enzima 5,10 metilentetrahidrofolato reductasa en mestizos mexicanos
no es infrecuente, porque ocurrió en 11% de los
sujetos estudiados. En un estudio previo describimos un grupo de pacientes pediátricos que
tuvieron un evento trombótico, en el que sólo
se identificó la coexistencia de estas mutaciones
como marcador genético de trombofilia; sin embargo, su existencia en pacientes con estados de
trombofilia no excluye la investigación de más
factores genéticos y adquiridos asociados.5-10
10,00
67
7
67
7
CC
/1
29
8
AA
CC
/1
29
67
8
7C
AC
T/
12
98
67
AA
7T
T/
12
98
67
7C
AA
C/
12
98
67
CC
7C
T/
12
98
AC
5,00
Figura 1. Concentración de homocisteína en los
diferentes grupos de genotipos encontrados de 5,10
metilentetrahidrofolato reductasa (MTHFR).
118
Los resultados obtenidos al comparar la concentración de homocisteína y el genotipo en
los alelos 677 C>T y 1298 A>C en gen que
codifica para la enzima 5,10 metilentetrahidrofolato reductasa (MTHFR) en mestizos mexicanos
muestran un valor significativo (p>0.05).
Las características poblacionales que tiene la
región centro de nuestro país y la alta frecuencia
Parra-Ortega I y col. Variaciones en los alelos 677 C>T y 1298 A>C
Cuadro 2. Concentración de homocisteína en los diferentes grupos de genotipos encontrados de 5,10 metilentetrahidrofolato
reductasa
95% del intervalo de
confianza para la media
Genotipo MTHFR
Media
Desviación
estándar
Error estándar
Límite
inferior
Límite superior
Mínimo
Máximo
677CC/1298 AA
677CC/1298 AC
677CT/1298 AA
677TT/1298 AA
677TT/1298 CC
677CT/1298 AC
14.92
13.25
14.44
16.82
21.20
13.22
4.27
3.38
3.93
4.49
3.30
1.23
1.38
0.69
0.71
0.91
12.20
9.69
13.02
15.38
11.23
17.63
16.80
15.86
18.25
15.22
7.82
9.29
8.83
10.56
21.20
7.63
22.31
17.40
25.72
32.96
21.20
17.79
Cuadro 3. Comparación de p en la diferencia de los grupos de genotipos de 5,10 metilentetrahidrofolato reductasa (MTHFR)
Genotipo MTHFR
677CC/1298 AA
677CC/1298 AC
677CT/1298 AA
677TT/1298 AA
677CT/1298 AC
677CC/1298 AC
677CT/1298 AA
677TT/1298 AA
677CT/1298 AC
0.385
0.740
0.198
0.988
0.740
0.465
0.019
.300
0.198
0.051
0.019
0.004
0.283
0.988
.300
0.004
-
Se consideró estadísticamente significativo un valor de p menor de 0.05.
de las variaciones alélicas en MTHFR hace imperativo el análisis de los mecanismos bioquímicos
en las diversas enfermedades en las que esas
variaciones tienen una implicación directa en los
pacientes mexicanos.17-21 Se han descrito 29 alteraciones genéticas en MTHFR y su relación con
el aumento de homocisteína no se ha definido
claramente en los diferentes grupos étnicos.22-25
En diferentes padecimientos se ha investigado la
participación de las variaciones alélicas en MTHFR y el aumento de homocisteína con resultados
que no revelan una asociación franca.26-29 Además, la distribución geográfica de los genotipos
identificados en algunos estudios30-32 expone la
necesidad de considerar más aún el análisis y
la generación de información respecto de las
variaciones alélicas en MTHFR. La experiencia
obtenida en este grupo de pacientes confirma la
asociación de las variaciones alélicas en MTHFR
y el aumento de homocisteína.
REFERENCIAS
1.
De Veber G, Andrew M, Adams C, et al. Cerebral sinovenous
thrombosis in children. N Engl J Med 2001;345:417-423.
2.
Schmidt B, Andrew M. Neonatal thrombosis: report of a
prospective Canadian and international registry. Pediatrics
1995;96:939-943.
3.
Mutchinick OM, López MA, Luna L, Waxman J, et al. High
prevalence of the thermolabile methylenetetrahydrofolate reductase variant in Mexico: a country with a very
high prevalence of neural tube defects. Mol Gen Metab
1999;461-467.
4.
Ruiz-Argüelles GJ. Trombofilia. En: Ruiz-Argüelles GJ, editor:
Fundamentos de Hematología. 3a ed. Ciudad de México:
Editorial Médica Panamericana, 2003;424-436.
5.
Ruiz-Argüelles GJ, González-Estrada S, Garcés-Eisele J,
Ruiz-Argüelles A. Primary thrombophilia in Mexico: A
prospective study. Am J Hematol 1999;60:1-5.
6.
Ruiz-Argüelles GJ, Garcés-Eisele J, Reyes-Núñez V,
Ramírez-Cisneros F. Primary thrombophilia in Mexico II:
Factor V G1691A (Leiden), prothrombin G20210A and
methylenetetrahydrofolate reductase C677T polymorphism in thrombophilic Mexican mestizos. Am J Hematol
2001;66:28-31.
119
Revista de Hematología
7.
Ruiz-Argüelles GJ, López-Martínez B, Cruz-Cruz D, ReyesAulis MB. Primary thrombophilia in Mexico III. A prospective study of the sticky platelet syndrome. Clin Appl Thromb
Hemost 2002;8:273-277.
20. Djordjevic V, Stankovic M, Brankovic-Sreckovic V, Rakicevic
L, Radojkovic D. Genetic risk factors for arterial ischemic
stroke in children: A possible MTHFR and eNOS gene-gene
interplay? J Child Neurol 2009;24:823-827.
8.
Ruiz-Argüelles GJ, Poblete-Naredo I, Reyes-Núñez V,
Garcés-Eisele J, et al. Primary thrombophilia in Mexico
IV: Leiden, Cambridge, Hong Kong, Liverpool and HR2
haplotype polymorphisms in the factor V gene of a group
of thrombophilic Mexican mestizos. Rev Invest Clin Mex
2004;56:600-604.
21. Sucker C, Kurschat C, Farokhzad F, Hetzel GR, et al. The TT
genotype of the C677T polymorphism in the methylenetetrahydrofolate reductase as a risk factor in thrombotic
microangiopathies: results from a pilot study. Clin Appl
Thromb Hemost 2009;15:283-288.
9.
Ruiz-Argüelles GJ, López-Martínez B, Valdés-Tapia P,
Gómez-Rangel JD, et al. Primary thrombophilia in Mexico
V: A comprehensive prospective study indicates that most
cases are multifactorial. Am J Hematol 2005;78:21-26.
10. Ruiz-Argüelles GJ, González-Carrillo ML, Estrada-Gómez R,
Valdés-Tapia P, et al. Trombofilia primary en México. Parte
VI: Falta de asociación estadística entre las condiciones
trombofílicas heredadas. Gac Méd Méx 2007;4:317-322.
11. Sibani S, Christensen B, O’Ferrell E, et al. Characterization
of six novel mutations in the methylenetetrahydrofolate
reductasa (MTHFR) gene in patients with homocystinuria.
Hum Mutat 2000;15:280-287.
12. Van der Put NJM, Gabreels F, Stevens EMB, Smeitink JAM,
et al. A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for
neural tube defects? Am J Hum Genet 1998;62:1044-1051.
13. Malinow MR, Nieto FJ, Kruger WD, et al. The effects of folic
acid supplementation on plasma total homocysteine are
modulated by multivitamin use and methylenetetrahydrofolate reductasa genotypes. Arterioscler Thromb Vasc Biol
1997;17:1157-62.
14. Weisberg I, Tran P, Christensen B, Sibani S, Rozen R. A second
genetic polymorphism in MTHFR associated with decreased
enzyme activity. Mol Genet Metab 1998;64:169-172.
15. Friedman G, Goldschmidt N, Friedlander Y et al. A common
mutation A1298C in human methylenetetrahydrofolate reductase gene: association with plasma total homocysteine
and folate concentrations J Nutr 1999;129: 1656-1661.
16. Parra-Ortega I, López-Martínez B, González-Ávila I, Rodríguez-Castillejos C y col. Coexistencia de las mutaciones
C677T y A1298C en la enzima 5,10 metilentetrahidrofolato
reductasa en pacientes pediátricos con trombosis. Bol Med
Hosp Infant Mex 2009;66:229-233.
17. Parra Ortega I, Estrada Gómez R, Guzmán García MO.
La mutación 677 C> T en la 5,10 metilentetrahidrofolato
reductasa y el aumento de homocisteína en pacientes
mexicanos. Med Int Méx 2007;23:15-18.
18. Reyes-Engel A, Muñoz E, Gaitan MJ, et al. Implications on
human fertility of the 677C T and 1298A C polymorphisms of the MTHFR gene: consequences of a possible
genetic selection. Mol Hum Reprod 2002;8:952-957.
19. Ozyurek E, Balta G, Degerliyurt A, Parlak H, et al. Significance of factor V, prothrombin, MTHFR, and PAI-1 genotypes
in childhood cerebral thrombosis. Clin Appl Throm Hemost
2007;13:154-160.
120
Volumen 16, Núm. 2, abril-junio 2015
22. Sibani S, Leclerc D, Weisberg IS, et al. Characterization of
mutations in severe methylenetetrahydrofolate reductase
deficiency reveals an FAD-responsive mutation. Hum Mutat
2003;21:509-520.
23. Melo SS, Persuhn DC, Meirelles MS, et al. G1793A polymorphisms in the methylenetetrahydrofolate gene: effect
of folic acid on homocysteine levels. Mol Nutr Food Res
2006;50:769-574.
24. Rozen R. Genetic predisposition to hyperhomocysteinemia:
deficiency of methylenetetrahydrofolate reductase (MTHFR). Thromb Haemost 1997;78:523-526.
25. Boccia S, Hung R, Ricciardi G, et al. Meta- and pooled
analyses of the methylenetetrahydrofolate reductase
C677T and A1298C polymorphisms and gastric cancer risk:
A huge-GSEC review. Am J Epidemiol 2008;167:505-516.
26. Zidan HE, Rezk NA, Mohammed D. MTHFR C677T and
A1298C gene polymorphisms and their relation to homocysteine level in Egyptian children with congenital heart
diseases. Gene 2013;529:119-124.
27. Franco Brochado MJ, Domenici FA, Candolo Martinelli AD,
Zucoloto S, et al. Methylenetetrahydrofolate reductase gene
polymorphism and serum homocysteine levels in nonalcoholic fatty liver disease. Ann Nutr Metab 2013;63:193-199.
28. Messedi M, Frigui M, Chaabouni KH, Turki M, et al.
Methylenetetrahydrofolate reductase C677T and A1298C
polymorphisms and variations of homocysteine concentrations in patients with Behcet’s disease. Gene
2013;527:306-310.
29. Van der Valk RJ, Kiefte-de Jong JC, Sonnenschein-van der
Voort AM, et al. Neonatal folate, homocysteine, vitamin B12
levels and methylenetetrahydrofolate reductase variants
in childhood asthma and eczema. Allergy 2013;6:788-795.
30. Yang B, Liu Y, Li Y, et al. Geographical distribution of MTHFR
C677T, A1298C and MTRR A66G gene polymorphisms in
China: findings from 15357 adults of Han nationality. PLoS
One 2013;8:e57917.
31. Wilcken B, Bamforth F, Li Z, Zhu H, et al. Geographical and
ethnic variation of the 677C>T allele of 5,10 methylenetetrahydrofolate reductase (MTHFR): findings from over
7000 newborns from 16 areas world wide. J Med Genet
2003;40:619-625.
32. Guéant-Rodriguez RM, Guéant JL, Debard R, et al. Prevalence of methylenetetrahydrofolate reductase 677T and
1298C alleles and folate status: a comparative study in
Mexican, West African, and European populations. Am J
Clin Nutr 2006;83:701-707.
Original article
Rev Hematol Mex 2015;16:121-127.
Modified chromogenic method to
assess anti-Xa activity in jaundiced
patients
ABSTRACT
Objective: To propose a modification of the chromogenic conventional
method (Rorachrom Heparin Stago’s Method) to be used in patients
with jaundice.
Material and method: An analytic epidemiological study was made. We
compared the values of anti-Xa activity in 40 patients with jaundice and
without jaundice using a modified chromogenic conventional method.
The Pearson coefficient correlation was calculated.
Diana Noemí García-de Paoletti1,2
Mariano Eduardo Paoletti 1,2,3
Eduardo Armando Paoletti1
Elisabeth Aloni-Risana2
Julio Guillermo Soto2
Carlos Alberto Barassi1
María Alejandra Pereyra1
María Fernanda Cerviño1,2
Lisbbett Suárez-González3
Daniel Mielgo4
Universidad Fasta, Buenos Aires, Argentina.
Laboratorio, Clínica 25 de Mayo, Buenos Aires,
Argentina.
3
Hospital Interzonal de Agudos Dr. Allende, Mar del
Plata, Buenos Aires, Argentina.
4
Clínica de la Madre y el Niño, Buenos Aires, Argentina.
1
2
Results: The absorbance of each reading was concurrent with the
concentration of low molecular weight heparin added in each tube is
not modified by the value of bilirubin with the pNA. The adaptation
mentioned could be used in jaundice newborn achieving a more exact
measurement of blood level of heparin.
Conclusions: The modified chromogenic conventional method is an
excellent tool to have into consideration to measure anti-Xa in patients
with jaundice.
Key words: anti-Xa activity, jaundice, modified chromogenic method.
Método cromogénico modificado para
medir la actividad anti-Xa en pacientes
ictéricos
RESUMEN
Objetivo: proponer una modificación del método convencional cromogénico para usarse en pacientes ictéricos.
Material and método: estudio epidemiológico analítico en el que
comparamos los valores de la actividad anti-Xa en 40 pacientes con y
sin ictericia usando un método cromogénico modificado. Se calculó
el coeficiente de Pearson.
Resultados: la absorbancia de cada lectura fue concurrente con la
concentración de heparina de bajo peso molecular agregada en cada
tubo y no se modificó por la concentración de bilirrubina con el pNA.
Conclusiones: el método cromogénico modificado es una excelente
herramienta a tener en cuenta para medir la actividad anti-Xa en pacientes con ictericia.
Palabras clave: actividad anti-Xa, ictericia, método cromogénico
modificado.
www.nietoeditores.com.mx
Received: December 1st, 2014
Accepted: February 4, 2015
Correspondence: Dra. Diana García
Clínica del Niño y la Madre
Avenida Colón 2749
7600 Mar del Plata, Buenos Aires, Argentina
[email protected]
This article must be quoted
García-de Paoletti DN, Paoletti ME, Paoletti EA,
Aloni-Risana E, et al. Modified chromogenic method
to assess anti-Xa activity in jaundiced patients. Rev
Hematol Mex 2015;16:121-127.
121
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
BACKGROUND
The indication of pharmacological thromboprophylaxis fixed-dose with low molecular weight
heparin (LMWH) is a standard treatment of
numerous clinical conditions and/or surgical
procedures with the objective of reducing the
venous thromboembolic disease (VTD). LMWH
typically does not require laboratory monitoring
except in newborn, children, high-risk pregnant,
renal failure and obese patients.1-4
The recommended method to check the anticoagulant response of LMWH is the measurement
of the activity anti-Xa activity whose peak occurs
4 hour after administration by subcutaneous via.
The measurement of the activity anti-Xa using the
chromogenic conventional method is often undervalued by the interference with elevated bilirubin
levels in newborns with jaundice, for example.
The objective of our work is to propose a modification of the chromogenic conventional method
(Rotachrom Heparin Stago’s Method)5 to be used
in patients with jaundice.
MATERIAL AND METHOD
An analytic epidemiologic study was done. We
analyzed the Pearson correlation coefficient (r)
which measures the intensity of the linear relationship between the two quantitative variables.
Firstly, we determined and compared the values
of anti-Xa activity in anicteric (without jaundice)
patients using conventional and modified chromogenic method.
Secondly, we determined the values of antiXa activity using only modified chromogenic
method in patients with jaundice.
Finally, we compared the values of anti-Xa activity using modified chromogenic method in both
122
kinds of patients: without (anicteric) and with
jaundice (icteric).
Setting/participants
This study was made with sample blood obtained
from 40 anicteric and icteric newborns (total bilirubin 80mg/L at 200mg/L) patients from CEDEAC
Laboratory and 25 de Mayo Clinic at Mar del
Plata, City of Buenos Aires Province, Argentina.
The blood was collected in plastic tubes with
sodium citrate at 3.2% (relationship between
anticoagulant/blood 1/9, respectively) to determine and compare the anti-Xa activity in both
groups using conventional and modified chromogenic method. Most of them were newborn
with jaundice and thrombosis. In such cases
the blood collection was made 4 hours after the
enoxaparin injection.
Measurement
Immediately after the blood collection, the blood
sample was centrifuged at 2000 G for 10 minutes
to avoid the release of platelet factor 4 (PF4),
which is a potent inhibitor of heparin. It was established as activity range of anti-Xa prophylactic
between 0.2 and 0.6 U/mL, and as therapeutic
activity range between 0.6 and 1.0 U/mL.4
If we have into account that the presentation of
1mg of is equivalent to 113 IU anti-Xa; we can
say a vial of enoxaparin 20mg contains 0.2 mL,
which is equivalent enoxaparin to 2260 UI antiXa and a vial of enoxaparin 40 mg contains 0.4
mL, which is equivalent to 4250 UI anti-Xa. The
dosages were performed in citrated plasmas and
added different concentrations of enoxaparin
used by us in our centers. To obtain the curves,
we diluted 10 mL of enoxaparin 20 mg with 14
mL of saline solution. The final concentration of
this dilution was 8.0 UI of anti-Xa. Then, we took
0.1 mL of the before dilution of the enoxaparin 20
García-de Paoletti DN, et al. Anti-Xa activity in jaundiced patients
(8.0 UI anti-Xa) and added to 0.9 mL of plasma
to be analyzed. When we worked with values of
the curve greater than 0.8 UI anti-Xa, we made
lower dilutions.
Variables
We performed correlation analysis that studies
the relationship between two quantitative variables: anti-Xa activity in anicteric and icteric
patients.
Chromogenic method
We used the conventional chromogenic method
of Stago: Rotachrom heparin and modified the
conventional method to compare the results of
anti-Xa in icteric and anicteric serum.
Conventional chromogenic method
After the diazotation and coupling the diazoic
red colorant is obtained. In the azoic colorants
the azo group is the principal chromophore.
According to the chromophore we obtain differences in colour and intensity and in acid
environment are precipited.
To measure concentration through the light
absorption, they were dissolved by HOK alkalization.
The diazotation reaction takes place between
an aromatic primary amine in the presence of
NaNO2 and in strong acid medium to form
diazonium salt intermediates for the formation
of azo pigments.
The amount of NaNO2 is stechiometric; acid
medium should be in excess to prevent partial
diazotation and condensation.
Samples + excess of factor Xa + specific chromogen (MAPA-Gly-Arg-pNA). The liberation of
pNA is inversely proportional to the concentration of anti-Xa present in patient’s plasma. The
acid medium stops the reaction. We read at 405
nm. The curves are made with known data in
IU of anti-Xa with LMWH used for the patients
and Stago controls with different concentrations
of anti-Xa.
If the diazotation occurs successfully, the amine
must be in aqueous acidic solution.
Colouring property is contingent on the presence
of molecules of chromophore groups (colour
carriers) attached to the azo group (-N = N-).
Coupling reaction: diazonium salts react with
compound couplers to form AZO derivatives,
such as phenol and naphthol ethers.
Modified chromogenic method
The coupling reaction is carried out at room
temperature or 10-20ºC.
Diazotation is carried in acidified pNA liberated in Chromogenic Rotachrom method and
subsequent coupling. Giving a pink colour
allowing its reading at 540nm, without overlapping with the bilirubin. The pNA is released
in the reaction is inversely proportional to the
heparin activity.
The diazonium salt is not isolated and should
be used quickly as diazotation reactions are
exothermic and the diazonium salts decompose
if the system is not cooled and does not react
on time. To obtain diazotation it is necessary to
maintain the temperature between 0-5ºC.
Phenols are dissolved in weak alkaline environment and become phenoxides, since phenols are
not reactive enough to attack the diazonium salts.
Neither amines nor phenols react moderately in
an alkaline medium because the diazonium ion
becomes diazohidroxide Ar-N-N-OH.
123
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
Reaction scheme
1) Diazotation reaction (Figure 1),6 2) Coupling
reaction (Figure 2).7
The red dye is a red precipitate in acid medium.
The pH has to be changed to alkaline medium
to be a real solution and coloured.
Experimental procedure
The reagents are prepared and the reaction
is made with stechiometric concentrations to
continue with the reactions made with the kit
of Rotachrom Heparin chromogenic method.
Protocol work
a) Diazotation cooling the solution of amine
in an acidic medium obtained in the kit,
in an ice water bath. The solution is kept
at 0ºC (≤ 10ºC) slowly adding with the
micropipette and stirring a solution of
sodium nitrite to complete, add two or
three minutes to finish the reaction.
H2N
NaNO2 N
NO2
N
CH3COOH
Para-nitroaniline (pNA)
NO2
Nitrobencen diazonio
Figure 1. Diazotation reaction.
NO2
N
OH
O2N
N
N
NaOH
N
1-[(-Nitrophenyl )
Diazenil]
Naphthalene n-2
RED DYE
OH
Figure 2. Coupling reaction.
124
b) Coupling: Add slowly the diazonium salt
solution to the alkaline solution of 2-Naphtol
solution in ice water bath and with constant
stirring. A red precipitate occurs during the
addition. When the addition is completed,
stir for a minute to finish the reaction.
c) After that add 10 µL of solution of 15%
KOH to dissolve the precipitate and get a
real solution in red colour to be measured
in the spectrophotometer to 540nm.
Red colour is inversely proportional to anti-Xa
concentration.
The modified method with a diazotization reaction to paranitroaniline (pNA) and coupling to
give a color which allows reading at 540 nm and
avoiding interference with bilirubin.
Analyses of statistical method
This study was designed to calculate the coefficient of correlation of Pearson (r) between the
determination of anti-Xa factor in anicteric and
icteric patient using conventional and chromogenic method, respectively.
The Pearson correlation coefficient (r) measures
the intensity of the linear relationship between
the two quantitative variables. This coefficient (r)
varies between -1 and +1. It´s the same to say
-1≤ r ≤ +1. If r =±1; there is a perfect relationship
between x and y. We mean, all the points (x and
y) they are in a perfect straight line. If we obtain a
positive value of r indicates that as you increase
the variable makes it the other or to measure that
decrease also makes it the other. A negative correlation coefficient indicates that as one variable
increases decreases the other and vice versa the
opposite. R equal to zero indicates that there is
no linear correlation between the variables.
After the determination of the coefficient of
correlation of Pearson we determined if such
García-de Paoletti DN, et al. Anti-Xa activity in jaundiced patients
coefficient is statistically different to zero. For
this, we applied the test based on the distribution
of the t student.
We calculated the confidence of interval. After
that we proceeded to make the inverse calculate
to obtain the confidence intervals of correlation
coefficient r that were our main finding before
the logarithmic transformation (Figure 3).
This test was made to prove if the difference in the
measures is zero (anicteric-icteric). The value of
r should be different to zero to be sure this job is
statistically suitable. Our results reject the null hypothesis which says that the correlation between
the two variables is zero. The r was 0.9608273.
Also we presented an estimated value and 95
percent confidence interval for the coefficient
of correlation of Pearson. Finally we demonstrated that there is strong evidence that the both
samples came from the same population by the
Kolmogorov-Smirnov test.
RESULTS
Descriptive data
The curves done with different concentration
of LMWH used in plasma samples taken for
ict
0.8
0.4
0.0
0.0
0.2
0.4
0.6
0.8
ani
1.0
patients have shown a linear order. The absorbance of each reading was concurrent with the
concentration of LMWH added in each tube is
not modified by the value of bilirubin with the
pNA. The adaptation mentioned could be used
in jaundice newborn achieving a more exact
measurement of blood level of heparin (Tables
1-3, Figures 4-5).
DISCUSSION
Current use of LMWH in neonates as an anticoagulant of choice was the starting point to
think about a modification of the conventional
chromogenic method, which is used to measure
values of anti-Xa. The main problem seen was
the interference of bilirubin in icteric newborn
using this conventional method. That is why we
proposed modify this method.
First of all, we did not realise differences between the values of anti-Xa in anicteric patients
using the conventional and modified chromogenic method. Secondly, we did not observe
differences between the values of anti-Xa using
modified chromogenic method in anicteric and
icteric patients.
CONCLUSION
The modified chromogenic method above explained can be used in icteric patients achieving
a more accurate measurement of the heparinemia.
Funding
This work was entirely self-funded.
Figure 3. Intervals of correlation coefficent r.
125
Volumen 16, Núm. 2, abril-junio 2015
Revista de Hematología
Table 1. Determination of anti-Xa in anicteric patients using conventional and modified method
Patients
Conventional method
Modified method
Patients
Conventional method
Modified method
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
0.3
0.1
0.3
1
0.6
0.55
0.7
0.4
0.8
0.66
0.8
0.9
0.3
0.7
0.8
0.2
0.4
0.7
0.2
0.2
0.3
0.08
0.33
0.98
0.55
0.56
0.69
0.38
0.78
0.7
0.78
0.88
0.3
0.7
0.78
0.15
0.42
0.7
0.23
0.22
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
0.4
0.8
0.5
1.6
0.8
0.2
0.4
0.8
0.4
0.2
0.4
0.8
0.4
0.2
0.8
0.4
0.2
0.35
0.78
0.35
0.4
0.85
0.48
1.5
0.82
0.22
0.4
0.82
0.42
0.22
0.39
0.81
0.39
0.22
0.75
0.38
0.22
0.39
0.81
0.39
Table 2. Values of anti-Xa using modified chromogenic method in patients with jaundice
126
Patients
Modified chromogenic method
Patients
Modified chromogenic method
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
0.28
0.1
0.3
1
0.5
0.55
0.7
0.4
0.75
0.76
0.8
0.85
0.2
0.65
0.8
0.15
0.4
0.65
0.2
0.2
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
0.5
0.8
0.45
0.2
0.8
0.22
0.38
0.8
0.4
0.24
0.35
0.78
0.35
0.18
0.78
0.35
0.2
0.35
0.8
0.4
García-de Paoletti DN, et al. Anti-Xa activity in jaundiced patients
Table 3. Values of anti-Xa using modified chromogenic method in anicteric and icteric patients
Anicteric
Icteric
Patients
Anicteric
Icteric
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
0.3
0.08
0.33
0.98
0.55
0.56
0.69
0.38
0.78
0.7
0.78
0.88
0.3
0.7
0.78
0.15
0.42
0.7
0.23
0.22
0.28
0.1
0.3
1
0.5
0.55
0.7
0.4
0.75
0.76
0.8
0.85
0.2
0.65
0.8
0.15
0.4
0.65
0.2
0.2
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
0.4
0.85
0.48
0.6
0.82
0.22
0.4
0.82
0.42
0.22
0.39
0.81
0.39
0.22
0.75
0.38
0.22
0.39
0.81
0.39
0.5
0.8
0.45
0.2
0.8
0.22
0.38
0.8
0.4
0.24
0.35
0.78
0.35
0.18
0.78
0.35
0.2
0.35
0.8
0.4
Values of anti Xa
Values of anti Xa
Patients
Number of anicteric patients
Conventional method
Number of patients
Modified method
Figure 4. Values of anti-Xa in anicteric patients using
conventional and modified chromogenic method.
Anicteric patients
Figure 5. Values of anti-Xa using modified chromogenic method in anicteric and icteric patients.
REFERENCES
1. Kitchen S, Iampietro R, Woolley AM, Preston FE. Anti-Xa
monitoring during treatment with low molecular weight
heparin or danaparoid: inter-assay variability. Thromb
Haemost 1999; 82:1289-1293.
2. Depasse F, Gilbert M, Goret V, Rolland N, Samama MM. Anti-Xa monitoring: inter-assay variability. Thromb Haemost
2000;84:1122-1123.
3. Kovacs MJ, Keeney M. Inter-assay and instrument variability
of anti-Xa results. Thromb Haemost 2000;84:138.
4. Greaves M. Control of Anticoagulation Subcommittee of the
Scientific and Standardization Committee of the Internatio-
Icteric patients
nal Society of Thrombosis and Haemostasis. Limitations of
the laboratory monitoring of heparin therapy. Scientific and
Standardization Committee Communications: on behalf of
the Control of Anticoagulation Subcommittee of the Scientific and Standardization Committee of the International
Society of Thrombosis and Haemostasis. Thromb Haemost.
2002;87:163-164.
5. Instructions of preparation of Kit made by Stago.
6. Lide, David R. Handbook of chemistry and physics. 84th ed.
Florida: CRC Press, 2003-2004.
7. Mc-Murray J. Reacciones de copulación de las sales de
diazonio. Química orgánica. 6th ed. México: Thomson
International Group, 2004;920-921.
127
Artículo de revisión
Rev Hematol Mex 2015;16:128-142.
Plasma rico en factores de
crecimiento plaquetario. Una nueva
puerta a la Medicina regenerativa
Jesús Alcaraz-Rubio1
Antonio Oliver-Iguacel2
Juana María Sánchez-López1
1
Unidad de Hematología, Unión Murciana de Hospitales, Murcia, España.
2
Unidad de Neuroendocrinología, Hospital Rúber,
Madrid, España.
RESUMEN
El uso del plasma rico en factores de crecimiento plaquetario se ha
convertido en una técnica cada vez más utilizada en diversas áreas
de la Medicina. Desde sus orígenes de uso en Medicina deportiva e
implantología dental a mediados del decenio de 1980, progresivamente
se ha ampliado su campo de utilización en especialidades clínicas tan
diversas como Otorrinolaringología, Cirugía Plástica, Dermatología,
Cirugía General, Oftalmología, Obstetricia y Ginecología y Neurocirugía, entre otras. El poder del trofismo celular sobre ciertos tejidos,
atribuido a los factores de crecimiento, ha hecho que actualmente
se hable de una nueva disciplina médica: Medicina regenerativa. No
sólo se ha experimentado un auge cada vez más creciente en distintas
especialidades médicas, sino que paralelamente se han incrementado
de manera exponencial los tipos de metodología de obtención así como
las formas de aplicación incluso contra una misma enfermedad. Tanto
es así que actualmente su utilización ha sobrepasado la capacidad
científica de producir evidencia para la correcta aplicación clínica.
El objetivo de esta revisión es realizar una visión objetiva de lo que
se denomina plasma rico en factores de crecimiento plaquetario, más
comúnmente conocido como plasma rico en plaquetas (PRP), los métodos más aceptados por la bibliografía científica de producción, así
como las principales aplicaciones clínicas en las que se ha observado
mayor evidencia científica y los usos donde, si bien aún carecen de
base científica sólida, son interesantes desde el punto de vista clínico
y preclínico.
Palabras clave: plasma rico en plaquetas, Medicina regenerativa.
Platelet-rich plasma in growth factors. A
new door to regenerative Medicine
ABSTRACT
The use of platelet-rich plasma growth factors has become increasingly
used in various areas of Medicine. Since its origins of use in sports
medicine and dental implantology in the mid-1980s, has been progressively expanded its field of application in clinical specialties as diverse
as Otorhinolaryngology, Plastic Surgery, Dermatology, General Surgery,
Ophthalmology, Obstetrics and Gynecology and Neurosurgery, among
others. The power of cellular trophism on certain tissues, attributed to
growth factors, has made that currently there is talk of a new medical
discipline such as regenerative medicine, not only there has been increasingly booming in various medical specialties, but that at the same
128
Recibido: 10 de diciembre 2014
Aceptado: 26 de febrero 2015
Correspondencia: Dr. Jesús Alcaraz Rubio
Carretera de Águilas
Buzón 252-B
30800 Lorca, Murcia, España
[email protected]
Este artículo debe citarse como
Alcaraz-Rubio J, Oliver-Iguacel A, Sánchez-López JM.
Plasma rico en factores de crecimiento plaquetario.
Una nueva puerta a la Medicina regenerativa. Rev
Hematol Mex 2015;16:128-142.
www.nietoeditores.com.mx
Alcaraz-Rubio J. Plasma rico en factores de crecimiento plaquetario
time has increased exponentially the types of methodology of obtaining
as well as the forms of application even for a same pathology. So much
so that its currently use has exceeded greatly the scientific capacity to
produce evidence for proper clinical application. The objective of this
review is to perform an objective vision about what is known as plasma
rich in platelet growth factors, more commonly known as platelet-rich
plasma (PRP), the most accepted by the scientific production literature
methods, as well as the main clinical applications where scientific
evidence and those applications has been where, even though they
still lack solid scientific basis, are interesting from the clinical and preclinical point of view.
Key words: plasma rich in platelet, regenerative Medicine.
Fisiología de la plaqueta y factores de
crecimiento
Las plaquetas son fragmentos celulares anucleados que derivan del citoplasma de los
megacariocitos de la médula ósea. Tradicionalmente su función más conocida es en el
proceso de hemostasia primaria, porque son
indispensables para la formación del coágulo; sin
embargo, también juegan un papel importante
en la inflamación, la inmunidad, la progresión
tumoral y por supuesto, la trombosis. Por microscopia electrónica se observa que las plaquetas
contienen diversos organelos: mitocondrias,
peroxisomas, ribosomas, así como glucógeno y
gránulos; estos últimos se dividen en tres tipos:
1) alfa: que contienen fibrinógeno, factor de vonWillebrand, factor de crecimiento derivado de
las plaquetas, factor de crecimiento ectodérmico,
factor de crecimiento endotelial vascular, factor
de crecimiento insulínico tipo 1, así como otros
factores de crecimiento (Cuadro 1); 2) densos o
delta: que contienen ADP, ATP, serotonina, adrenalina, noradrenalina y dopamina y 3) lambda:
que son lisosomas que ayudan a disolver el
coágulo una vez que ha cumplido su función.1-3
Además de las funciones clásicas descritas de
las plaquetas, los descubrimientos recientes
en cuanto a su capacidad de síntesis proteica, conteniendo copias de ARNm de casi una
tercera parte de las proteínas conocidas en el
genoma humano, a pesar de carecer de núcleo, han cambiado totalmente la percepción
que se tenía de las mismas, se reconoce su
capacidad de poder sintetizar proteínas ante
cambios en su ambiente. Además, también se
investigan algunas funciones no genómicas
de estos factores, como su efecto en las vías
de señalización que involucran la activación
plaquetaria y su papel en la síntesis de novo
de factores pro y antiinflamatorios. La enorme
cantidad de factores de crecimiento contenidos en los gránulos alfa plaquetarios, la
capacidad de síntesis de novo de proteínas, así
como su actividad microbicida y moduladora
de la inflamación favorecen la proliferación
e inmunomodulación celular y la síntesis de
matriz extracelular, promoviendo la cicatrización, la reparación de heridas y otras lesiones
tisulares. Estas funciones precisamente han
llevado a proponer el uso del plasma rico en
plaquetas autólogo para la reparación y regeneración de diversos tejidos.1
Los principales factores de crecimiento plaquetario de los que más se conoce su función son:
129
Revista de Hematología
Factor de crecimiento de origen plaquetario
(PDGF)
Su principal función es promover indirectamente la angiogénesis a través de los macrófagos,
por un mecanismo de quimiotaxis. Activa los
macrófagos, tiene una importante actividad
mitógena en las células mesenquimales, así
como en las neuronas, células de la microglía,
promoviendo la proliferación y remielinización
de los oligodendrocitos y facilita la formación
de colágeno tipo 1.
Factor de crecimiento de transformación-beta
(TGF-beta)
Su misión fundamental es la de quimiotaxis.
Induce la proliferación y diferenciación de células mesenquimales. Promueve la síntesis de
colágeno por los osteoclastos. Es proangiogénico
tisular; inhibe la formación de osteoclastos como
la proliferación de células epiteliales en presencia de otros factores. Induce la diferenciación de
células madre troncales neuronales.
Factor de crecimiento fibroblástico (FGF)
Activa la proliferación y diferenciación de
osteoclastos, fibroblastos e inducción de fibronectina por éstos y células madre troncales
neuronales. Inhibe la acción osteoclástica.
Tiene una importante actividad proangiogénica por acción quimiotáctica en las células
endoteliales.
Factor de crecimiento insulínico tipo 1 (IGF-1)
Induce la proliferación y diferenciación de
células mesenquimales y de revestimiento; asimismo, tiene un potente efecto mitótico en las
celularidad progenitora troncal neuronal. Facilita
la síntesis de osteocalcina, fosfatasa alcalina y
colágeno tipo 1 por los osteoblastos.
130
Volumen 16, Núm. 2, abril-junio 2015
Factor de crecimiento endotelial vascular (VEGF)
Activa la quimiotaxis y diferenciación de células
endoteliales, promueve la hipermeabilidad de
los vasos sanguíneos.
Factor de crecimiento ectodérmico (EGF)
Tiene gran capacidad proapoptótosica, de quimiotaxis y diferenciación de células epiteliales,
renales, neuronales, gliales y fibroblastos.
Factor neurotrófico derivado del cerebro (BDNF)
Induce la proliferación, diferenciación y quimiotaxis de celularidad neuronal, microglial y
oligodendrocitaria, así como la remielinización
de las mismas.
Factor de crecimiento de hepatocitos (HGF)
Tiene como principal función la proliferación y
diferenciación celular, quimiotaxis, angiogénesis
y síntesis de matriz extracelular.
En el Cuadro 1 se resumen los tipos de factores
de crecimiento que se pueden obtener en el
plasma rico en plaquetas, así como su función
fisiológica principal en los tejidos. En el Cuadro
2 se reflejan las concentraciones normales de
factores de crecimiento que se pueden encontrar en el plasma sanguíneo humano de sangre
periférica en comparación con el promedio del
conseguido en un plasma rico en plaquetas de
calidad.
Definición de plasma rico en plaquetas
El plasma rico en plaquetas es una concentración autóloga de plaquetas humanas en un
volumen pequeño de plasma que representa
un aumento de plaquetas respecto de las concentraciones basales normales, por lo que es
Alcaraz-Rubio J. Plasma rico en factores de crecimiento plaquetario
Cuadro 1. Resumen de las proteínas contenidas en los gránulos plaquetarios alfa
Contenido
Función
Quimiocinas, citocinas
Factor plaquetario 4
B-tromboglobina
RANTES
Proteína inflamatoria de macrófagos 1-alfa
Interleucina 1 y 8
Regulación de la inflamación, quimiotaxis
Proteínas adhesivas
Trombospondina 1 y 2
Fibrinógeno
Fibronectina
Interacciones celulares y coagulación
Factores de crecimiento
Factor de crecimiento derivado de plaqueta (PDGF)
Factor de crecimiento transformante B (TGF-B)
Factor de crecimiento epidérmico o epitelial (EDGF)
Factor de crecimiento vascular endotelial (VEGF)
Factor de crecimiento similar a insulina-1 (IGF-1)
Factor de crecimiento de hepatocitos (HGF)
Factor neutrófico derivado del cerebro (BDNF)
Proliferación y diferenciación celular, quimiotaxis, angiogénesis, síntesis de matriz extracelular
Inmunoglobulinas
Ig-A, Ig-E, Ig-M e Ig-G
Inmunológica
Factores de la coagulación V y VIII
Factor de von-Willebrand
Inhibidor del activador del plasminógeno
P-selectina
Producción de trombina
Adherencia plaquetaria al colágeno subendotelial
Inhibición de la fibrinólisis
Interacción leucocito-plaqueta
RANTES: regulated on activation normal T-cell expressed and secreted.
Cuadro 2. Concentraciones de factores de crecimiento y conteo celular en sangre periférica y plasma rico en plaquetas
Sangre periférica
Plasma rico en plaquetas
PDGF-AB (10-50 pg/mL)
TGF-B1 (10-70 pg/mL)
VEGF (15-85 pg/mL)
IGF-1 (0.5-19.5 pg/mL)
Plaquetas (150,000-350,000/mm3)
Leucocitos (3,200-9,000/mm3)
Granulocitos
Mononucleares
CD 34+
45 pg/mL
35 pg/mL
55 pg/mL
13 pg/mL
265,000/mm3
5,600/mm3
60% (3,330/mm3)
35% (1,960/mm3)
0.5/mm3
360 pg/mL
320 pg/mL
560 pg/mL
175 pg/mL
1,250,000/mm3
20.000/mm3
24% (480/mm3)
70% (14,000/mm3)
175/mm3
una fuente de fácil acceso a los factores de
crecimiento contenidos en ellas. Tiene un pH
entre 6.5 y 6.7. Proviene de la propia sangre del
paciente, por lo que está libre de enfermedades
trasmisibles y no puede ocasionar reacciones de
hipersensibilidad. El conteo de plaquetas de un
plasma rico en plaquetas óptimo es discutible.
Según la Agencia Española de Medicamentos
y Productos Sanitarios (AEMPS), debe contener
una cifra de plaquetas superior a las concentra-
131
Revista de Hematología
ciones séricas basales consideradas normales;
es decir, entre 200,000 y 450,000 plaquetas/
mm3, pero cada vez más los autores dedicados
a esta materia consideran un plasma rico en
plaquetas de calidad cuando la cantidad de
plaquetas obtenida en el producto final supera
1,000,000/mm3.4,5
Métodos de obtención
Los métodos de obtención y preparación del
plasma rico en plaquetas son muy diversos, dependen de si se utiliza un único procedimiento o
doble de centrifugación, el tiempo de la misma,
así como el tipo de filtro utilizado, de los que
en la actualidad se dispone de más de 40 en el
mercado.
132
Volumen 16, Núm. 2, abril-junio 2015
No se ha hallado una clara correlación entre la
capacidad de mayor concentración plaquetaria
y las concentraciones de factores de crecimiento
plaquetarios determinados en el producto final
con independencia del tipo de filtro y procedimiento utilizado para su elaboración. Tampoco
se ha observado diferencia en el producto final
obtenido con independencia del tipo de procedimiento y filtro utilizado en relación con la
edad y sexo del paciente. Según los estudios
realizados más recientes, los plasmas ricos en
leucocitos contienen mayores concentraciones
de factores de crecimiento tipo VEGF y TGF-B,
mientras que en los plasmas ricos en plaquetas
sin aprovechamiento de la capa leucocitaria se
lograría concentrar mayor cantidad de factores
de crecimiento tipo factor de crecimiento de
origen plaquetario e IGF-1.6
En cuanto a la temperatura, según la mayoría
de expertos consultados, para la producción
de un plasma rico en plaquetas adecuado la
temperatura óptima de preparación durante
el procedimiento debe ser de 16 a 22ºC. Este
intervalo de temperatura es el que más capacidad de concentración plaquetaria y factores de
crecimiento produce, porque mantiene mayor
supervivencia de la plaqueta, independientemente del tipo de procedimiento y filtro
utilizados con media de conteo plaquetario de
1,150,000/mm3 (intervalo: 750,000-1,500,000/
mm3), así como concentraciones de factores de
crecimiento plaquetarios y plasmáticos entre
cinco y siete veces mayor a las concentraciones
normales halladas en sangre periférica.6
En cuanto a la parte celular contenida en el
plasma rico en plaquetas, en los plasmas ricos
en plaquetas ricos en leucocitos con aprovechamiento de la fracción Buffy-Coat del centrifugado
final, la concentración leucocitaria se incrementa tres y cinco veces más que en sangre
periférica con predominio de mononucleares
(90% del total leucocitario, hasta 15% de ellas
con marcaje positivo para CD 34).
Según el tipo de filtro o pipeteado y procedimiento de centrifugación utilizado, se pueden
obtener diferentes componentes plasmáticos;
por ejemplo: plasma rico en plaquetas y factores de crecimiento plasmático, plasma rico en
plaquetas y escaso en factores de crecimiento
plasmático, plasma rico en factores de crecimiento plasmático y escaso en plaquetas o
plasma rico en plaquetas y leucocitos.
De todos los métodos de obtención, cuatro
procedimientos destacan sobre los demás,
porque son los más estandarizados y utilizados por la mayoría de autores. Dos de ellos
utilizan un doble sistema de centrifugación,
mientras que en los otros dos el procedimiento
de centrifugación es único. En el Cuadro 3 se
especifican estos cuatro métodos y el sistema
de centrifugación utilizado en cada uno de
Según lo anterior, sería posible la preparación de
lo que se denomina un plasma rico en plaquetas
a la carta, según la fracción plasmática y celular
que se quiera potenciar en función de la aplicación clínica que se le quiera dar.7
Alcaraz-Rubio J. Plasma rico en factores de crecimiento plaquetario
Cuadro 3. Métodos de obtención de plasma rico en plaquetas y conteo promedio plaquetario
Procedimiento
Autores
Centrifugado
Recentrifugado
de plasma
Conteo promedio de
plasma rico en plaquetas
1
García y col. (2005)
1,800 rpm durante 8 min
ininterrumpidamente
1,800 rpm durante
8 min
191%
2
Anitua y Andía (2000)
1,800 rpm durante 8 min
ininterrumpidamente
No
90%
3
Okuda y col. (2003)
Kawase y col. (2003)
2,400 rpm durante10 min
ininterrumpidamente
3,600 rmp durante
15 min
32%
4
Deobarrio y col. (2000)
Camargo y col. (2002)
5,600 rpm durante 6 min
ininterrumpidamente
No
5%
ellos y el promedio de concentración plaquetaria final obtenido.7,8
Al comparar estos cuatro métodos de obtención de plasma rico en plaquetas podemos
observar que el mayor número de plaquetas
obtenido equivalente a un promedio de 191%
respecto al conteo basal en sangre total corresponde al protocolo de obtención de García y
colaboradores (2005), seguido de la técnica
estandarizada de Anitua y Andía (2000), con
un promedio de conteo plaquetario respecto
al basal en sangre periférica de 90%. En tercer lugar se encontraría el procedimiento de
centrifugación de Okuda y colaboradores y
Kawase y su grupo (2003), con 32% de conteo
plaquetario final obtenido respecto al basal y,
por último, en torno a 5% estaría el protocolo de obtención de plasma rico en plaquetas
diseñado por Camargo y su grupo (2002) y
Deobarrio y colaboradores (2000).9
La activación del plasma rico en plaquetas
requiere reemplazo del calcio e iniciación de
la cascada de la coagulación sanguínea. Para
autores como Anitua, esto se logra agregando
cloruro cálcico a 1% (1 cc); otros, como Marx,
usan conjuntamente con esta solución trombina
bovina (1.5 cc); a diferencia de Anitua que no
describe su uso, porque existen ciertas controversias con la utilización de la misma porque se han
detectado anticuerpos antitrombina en pacientes
que han sido tratados activando el plasma rico
en plaquetas con este procedimiento.10
Administrar una mayor cantidad de solución
activadora, lejos de ser benéfico, es contraproducente, debido a que un mayor volumen de esta
solución no acelerará el proceso de activación de
la coagulación, sino que reducirá su velocidad
de formación o la inhibirá totalmente, diluyendo
la concentración de fibrinógeno, factor importante en la formación del coágulo.7,10
Por último, la administración de plasma rico en
plaquetas sistémica o endovenosa no precisa
de activación previa del producto final obtenido, porque su entrada en el torrente sanguíneo
produce la activación natural a través del propio
calcio iónico sérico.
Marco legal de aplicación del plasma rico en
plaquetas
En la actualidad, el concentrado final de plasma
rico en plaquetas carece de ficha técnica para
su aplicación.
La prescripción de este concentrado autólogo
deben realizarla médicos, odontólogos o podólogos dentro de su campo de acción clínica.
Aunque la preparación sea por un tercero, el
133
Revista de Hematología
responsable último que garantice las características del mismo será la persona prescriptora.
Previo a la obtención del producto, el paciente
debe pasar por un control analítico serológico,
bioquímico y hematológico para verificar la
idoneidad o no del tratamiento. Al respecto,
países como Argentina disponen de una normativa concreta para la obtención de plasma rico
en plaquetas, así como las distintas fracciones
plasmáticas por parte exclusiva y legal de un
hemoterapeuta o especialista en Hematología
y hemoterapia, aplicando la misma normativa
como a cualquier tipo de hemoderivado durante
una autotransfusión.
Durante el proceso de obtención, si bien existen numerosos protocolos, la normativa vigente
distingue entre procedimiento de obtención
abierto, donde hay una exposición directa de la
sangre o cualquiera de sus componentes durante
el proceso de manipulación al medio ambiente,
en cuyo caso, y siguiendo la normativa de cada
comunidad autónoma, todo el procedimiento
debe realizarse de forma estéril y bajo una campana de flujo laminar; o procedimiento cerrado,
utilizando unos filtros específicos con obligado
marcado CE, en cuyo caso deben seguirse las
normas del fabricante en concreto.
Campos de aplicación del plasma rico en
plaquetas
Son numerosos y cada vez más crecientes los
campos donde se está aplicando el plasma rico
en plaquetas y sus distintas fracciones. Vamos a
repasar por especialidades las aplicaciones donde parece que hay más consenso, con hincapié
en aquéllas en las que hay evidencia científica
de mayor soporte; tarea, por otro lado, no exenta
de dificultad debido a la gran controversia existente entre la comunidad médica, incluso para
una misma aplicación clínica y la ausencia de
estudios de peso científico en forma de ensayos
134
Volumen 16, Núm. 2, abril-junio 2015
clínicos adecuadamente diseñados para tal
efecto; si bien, como veremos, la mayor parte de
indicaciones se basa en series de casos clínicos
e, incluso, casos clínicos aislados de difícil reproducción por los autores como para diseñar
estudios de mayor fuerza científica.
Reumatología, Traumatología y Medicina
deportiva
Éste es, sin duda, el campo de mayor proyección
en cuanto a la prescripción de plasma rico en
plaquetas, incluso sobrepasa en gran medida la
evidencia científica clínica existente. El plasma
rico en plaquetas ha demostrado in vitro que regula las citocinas que intervienen en procesos de
neovascularización, proliferación de tenocitos,
fibroblastos, miocitos y condrocitos, así como el
reclutamiento de células inflamatorias con efecto
inhibitorio de citocinas proinflamatorias (IL-1)
con actividad antiinflamatoria y regenerativa.
Epicondilitis. La epicondilitis es una tendinopatía
limitante, con clara tendencia a la cronificación
y con respuesta aleatoria parcial al tratamiento
convencional con infiltraciones de corticoesteroides y rehabilitación. Los estudios del uso de
plasma rico en plaquetas en este tipo de pacientes como única infiltración resultaron en mejoría
funcional y analgésica significativa en 85% de
los casos sin comunicar efecto adverso alguno.
De todas maneras, se necesita mayor profundización, debido a que los estudios existentes
incluyen un escaso número de pacientes.11,12
Fascitis plantar. Al igual que en el resto de las
tendinopatías con tendencia a la cronificación, se
revisó un estudio de una serie de casos de pacientes con fascitis plantar resistente a tratamiento con
antiinflamatorios no esteroides, inmovilización,
fisioterapia e infiltración con corticoesteroides,
a quienes se les infiltró plasma rico en plaquetas
con mejoría significativa funcional y disminución
del dolor en 90% de ellos. También en este caso
Alcaraz-Rubio J. Plasma rico en factores de crecimiento plaquetario
son necesarios más estudios para objetivar el
beneficio en esta enfermedad.13,14
Osteoartritis de rodillas. Es una aplicación relativamente reciente que aglutina en este momento
la mayor parte de la investigación clínica actual.
Los estudios de series de casos de pacientes en
comparación con infiltración simple de ácido
hialurónico documentan incluso 35% de respuesta al plasma rico en plaquetas infiltrado,
contra 10% al ácido hialurónico. Si bien estos
estudios incluyen pocos pacientes, la importancia estriba en que por vez primera se especifican
las concentraciones de factores de crecimiento
contenidas en el plasma rico en plaquetas infiltrado, subrayando la importancia de reducir la
fracción leucocitaria para no potenciar el efecto
proinflamatorio del producto final obtenido. En
estos últimos años, las series de casos clínicos
más extensas comunicaron su éxito al momento
de aplicar infiltraciones de plasma rico en plaquetas; quizá la serie más numerosa es la de un
grupo español que incluyó 261 pacientes con
tres infiltraciones de plasma rico en plaquetas
separaradas 15 días entre sí, con seguimiento
de un año, con mejoría funcional en 67% de
los pacientes, sobre todo los más jóvenes y los
que tenían una evolución más incipiente de la
enfermedad.15-20
Otras aplicaciones. Se ha visto que el plasma rico
en plaquetas es útil en la tendinopatía aquílea
crónica, sobre todo cuando se prescriben previamente infiltraciones con ozono,21-23 tendinopatía
rotuliana,16-18 en la reparación del manguito de
los rotadores,24-26 en la reparación del ligamento
cruzado anterior,18 ya sea junto con plastia de
isquio-tibiales o injerto con hueso-tendón-hueso,
en la reparación meniscal de la articulación de
la rodilla,16,17 en la reconstrucción del labrum
glenoideo o de la cadera y finalmente en lesiones musculares parciales y totales, realizando
en este caso la reparación abierta y reforzando
con plasma rico en plaquetas posteriormente.27,28
En el Cuadro 4 se resumen las diferentes
aplicaciones del plasma rico en plaquetas en
Traumatología y Ortopedia, así como los distintos estudios que lo avalan.
Odontología y Cirugía maxilofacial
Es quizás otro de los campos en el que el
plasma rico en plaquetas ha experimentado
un desarrollo más visible. No obstante, existe
una fuerte controversia y discusión en cuanto
a la utilidad del plasma rico en plaquetas en la
recuperación del lecho alveolar dentario junto
a plastia de hueso liofilizado; se incrementa
el reborde alveolar, mejora la cicatrización
de los tejidos blandos y se facilita una mayor
cohesividad del injerto particulado, lo que lo
haría útil en implantología dental. Otros autores
son más pesimistas al momento de reproducir
estos resultados debido a las grandes diferencias de factores de crecimiento presentes en
el plasma rico en plaquetas, según el método
de obtención del producto final aplicado.29-32
Este hecho llevó a pensar que a mayor concentración de esos factores, más eficaz sería
la regeneración, promoviéndose la utilización
de sistemas que obtenían mayor concentración
de factores de crecimiento, sistemas que fueron
homologados y que se utilizaron sin pensar en
la concentración obtenida de producto final.
Lejos de conseguir el efecto deseado, in vitro
se observó completamente lo contrario cuando
la concentración de factores sobrepasó cierto
nivel. De ahí la fuerte polémica surgida en su
uso alimentado en muchos casos por la falta de
sistematización en la obtención del plasma rico
en plaquetas, que puede ser incorrecta.
Ginecología
Se han usado geles de plasma rico en plaquetas
para el tratamiento de heridas quirúrgicas en
diversas cirugías mayores, con efectos positivos
en aspectos como disminución del dolor poso-
135
Revista de Hematología
Volumen 16, Núm. 2, abril-junio 2015
Cuadro 4. Aplicaciones del plasma rico en plaquetas en Traumatología y Cirugía ortopédica y evidencia científica
Estudio
Tendinopatía crónica
Lesión crónica superior a seis semanas 97% buenos resultados
8% malos resultados
Epicondilitis resistente
Resultados
Tasa de éxito 79%
Dolor crónico en el epicondilo lateral 60% de mejoría a 8 semanas, 81% a 6
meses y 93% a 12 meses
Tendinopatía aquílea
El plasma rico en plaquetas no generó
daños y la recuperación fue más rápida
Tendinitis rotuliana
Progreso de un paciente con rotura
aquílea
Plasma rico en plaquetas vs infiltración
salina
Tendinitis crónica resistente, plasma rico
en plaquetas vs infiltración salina
Regeneración y regreso más rápido a
la actividad
Mismos resultados aunque menos
inconvenientes
Sin diferencias significativas
Estudio en animales
Respuesta inmunogénica mayor sin
marcadores anormales
Incremento de las concentraciones de
colágeno I y II
Plasma en tendón rotuliano de ratas
Tendinitis del codo
Fascitis plantar
20 atletas con tendinitis rotuliana crónica (tres infiltraciones de plasma rico
en plaquetas)
Tendón rotuliano de 31 pacientes durante seis meses
Plasma rico en plaquetas vs otros
tratamientos
Infiltraciones de plasma rico en plaquetas vs infiltraciones de corticoesteroides
El plasma rico en plaquetas fue más
eficaz en estados degenerativos
79% de buenos resultados con plasma
rico en plaquetas vs 51% con corticoesteroides
Uso del plasma rico en plaquetas en Aumenta la angiogénesis, se acelera
epicondilitis
la cicatrización y hay mayor calidad
histológica
Infiltraciones de plasma rico en plaque- Beneficios a largo plazo
tas vs infiltraciones de corticoesteroides
Crónica
6/9 alivio sintomático a 8 semanas y
78% de alivio completo de los síntomas al año
Mejor tratamiento para evitar recaídas
PRP vs otros tratamientos
Fascitis plantar crónica
136
70% total recuperación a seis meses,
del resto, 80% con disminución del
dolor
Mejores resultados y mejor calidad
Método seguro y reduce el dolor
Acortamiento del retorno a la actividad
en 27%
No hay consenso, transformación más
rápida del LCA con plasma rico en
plaquetas
11 deportistas de élite con desgarros Retorno a la competición más rápida y
musculares
se acortó 30% la recuperación
20 deportistas profesionales
Buenos resultados
8 jugadores de futbol americano y 6 Retorno a la competición más rápido
de baloncesto
Plasma rico en plaquetas en animales Acorta el periodo de recuperación del
músculo
Autores
Gandia y col.
Edwards y
Calandruccio
Mishard y Pavelko
Sánchez y col.
Filardo y col.16
De Vos y col.
De Jonge y col.
Taylor y col.
Kajikawa y col.
Kon y col.15
Filardo y col.23
Van Ark y col.17
Gosens y Perbons
Lyras y col.
Coombes y col.
Barret y Erredge13
Glazer y col.14
Martinelli y col.
Lesiones ligamentarias Reconstrucción de LCA
agudas
Reconstrucción del LCA
Sampson y col.20
Lesiones musculares
Wright-Carpenter
Ventura y col.18
Sánchez y col.
Cugat y col.
Hammond y col.
Alcaraz-Rubio J. Plasma rico en factores de crecimiento plaquetario
peratorio con menor requerimiento analgésico
convencional. En un estudio de control de casos,
la aplicación de geles con factor de crecimiento
de origen plaquetario recombinante en dehiscencias de cirugía abdominal mostró un tiempo de
cierre significativamente más corto, en comparación con los controles, sin efectos colaterales
de importancia.33,34
Asimismo, el plasma rico en plaquetas se ha
usado in vitro como “tapón” en el tratamiento
de la ruptura prematura de membranas fetales,
para sellar de manera impermeable los defectos
en membranas biológicas.35
Sin embargo, no se ha informado el efecto del
plasma rico en plaquetas en aspectos como la
infección o la hemorragia trans y posoperatoria.
Cirugía cardiovascular
Si bien se ha prescrito para facilitar la cicatrización de heridas quirúrgicas cardiovasculares,
existen estudios que no han demostrado un
efecto significativo en el tratamiento de éstas.36
Cirugía plástica
En un estudio de serie de casos, se observó
que la aplicación de un colgajo cutáneo sobre un lecho quirúrgico donde se administró
previamente plasma rico en plaquetas redujo
cualitativamente el volumen de sangrado capilar del lecho quirúrgico, disminuyó la necesidad
de drenajes o vendajes compresivos y el dolor
posoperatorio.37
Hay pocos estudios que demuestren firmemente
la utilidad del plasma rico en plaquetas en el
tratamiento de quemaduras. Los estudios experimentales demostraron que la aplicación de un
gel de plasma rico en plaquetas en quemaduras
estimula una intensa reacción inflamatoria, con
incremento significativo de las proteínas de
matriz extracelular, proliferación de fibroblastos,
colágeno y tejido de granulación. Sin embargo,
no se ha documentado una verdadera aceleración en la epitelización de las heridas.
Por tanto, aún no hay evidencia científica fuerte
para recomendar el plasma rico en plaquetas en
el tratamiento de quemaduras. Hay variables,
como tipo de cicatrización, extensión de la
quemadura, espesor de la misma, tiempo de
aplicación o tasa de infección que aún precisan
mayor estudio.38
Cirugía general
Se ha postulado que el uso de fibrina rica en plasma rico en plaquetas como pegamento para la
colocación de mallas en la corrección de hernias
inguinales mejora la tolerancia al material, el
dolor posoperatorio y disminuye la cantidad de
material de sutura para la fijación de las mismas;
no obstante, aún se necesitan estudios mejor
diseñados para perfilar esta aplicación clínica.39
Asimismo, su uso parece estar bien fundamentado científicamente en las úlceras diabéticas
y en las úlceras por presión; acelera significativamente el cierre de las mismas y disminuye el
dolor sin efectos secundarios significativos.40,41
Oftalmología
Estudios experimentales in vitro demostraron
que el plasma rico en plaquetas incrementa
la migración de fibroblastos y queratinocitos
conjuntivales. Paralelamente, algunos estudios
clínicos han objetivado efectos positivos del plasma rico en plaquetas en úlceras corneales, así
como la queratoconjuntivitis seca del síndrome
de Sjögren, contra el que actualmente no existe
un tratamiento satisfactorio.42,43
En el caso de las quemaduras oculares, la inyección subconjuntival de plasma rico en plaquetas
137
Revista de Hematología
en una serie de pacientes mostró significativamente una epitelización más rápida de la córnea
y conjuntiva; no obstante, esto no ha podido
demostrarse posteriormente.44
Otorrinolaringología
Los estudios preclínicos y clínicos de su prescripción en la timpanoplastia tipo 1 de pacientes con
perforación timpánica señalan que podría ser
útil en el cierre del defecto; no obstante, aún se
requieren estudios de mayor evidencia científica
para corroborar este hecho, al no contar esos
estudios con grupos control.45,46
Dermatología
Los estudios experimentales demostraron que
las células de las papilas dérmicas expuestas a
plasma rico en plaquetas incrementan significativamente su proliferación, lo que se relacionó
con aumento de la señalización de Akt y ERK,
así como regulación positiva del factor de crecimiento fibroblástico 7 y la B-catenina, que son
reconocidos factores de crecimiento del cabello.
Aunque aún se necesitan estudios científicos de
mayor potencia, el plasma rico en plaquetas abre
un abanico de posibilidades en el tratamiento
de la psoriasis, vitíligo, alopecia, liquen plano
y otras aplicaciones cosméticas.37,47
Neurología y Neurocirugía
Los estudios experimentales preclínicos demostraron la capacidad de cicatrización y
neurorregeneración con recuperación funcional al aplicar conjuntamente plasma rico en
plaquetas y sutura de los bordes del nervio
lesionado, debido a un incremento significativo
de axones en el segmento distal; sin embargo,
estos estudios aún son experimentales, si bien
se ha documentado algún caso clínico aislado
con resultados positivos. Este hecho abre una
puerta a la posibilidad de neuroestimulación
138
Volumen 16, Núm. 2, abril-junio 2015
en pacientes con tara neurológica sobre todo de
origen hipóxico isquémico que siguen programas
de neurorrehabilitación activa. Aún se necesitan
ensayos clínicos adecuadamente fundamentados
en este sentido para valorar el potencial beneficio clínico que el plasma rico en plaquetas
puede aportar en este campo.48,49
Otras aplicaciones
Desde el punto de vista de la experimentación,
la evidencia científica respecto del papel estimulante del plasma rico en plaquetas en la
proliferación de diversas líneas celulares epidérmicas y mesenquimales ha llevado a utilizarlo
como soporte para el cultivo y expansión clonal
in vitro de las mismas en el laboratorio.
En el Cuadro 5 se resumen las diferentes aplicaciones clínicas que tiene en la actualidad el
plasma rico en plaquetas, así como la evidencia
científica existente en cada caso.
Efectos colaterales de la aplicación de plasma
rico en plaquetas
La utilización de esta técnica, siempre que se
haga siguiendo la normativa vigente en cuanto
a control de calidad y trazabilidad, está exenta
prácticamente de efectos colaterales, porque
se trata de un producto autólogo. Los efectos
comunicados en la mayoría de los casos son banales: pequeño hematoma o eritema en el lugar
de la punción o infiltración, así como febrícula
durante las primeras 24 a 48 horas debido a los
mediadores de la inflamación, controlable con
antipiréticos convencionales.
Un hecho que tradicionalmente se le ha atribuido al plasma rico en plaquetas es su posibilidad
de producir un efecto oncogénico, mediante
la actividad de los factores de crecimiento de
poder activar ciertas vías antiapoptósicas de
clonas tumorales en pacientes predeterminados
Alcaraz-Rubio J. Plasma rico en factores de crecimiento plaquetario
Cuadro 5. Aplicaciones del plasma rico en plaquetas en distintos campos de la Medicina y evidencia científica
Área clínica
Aplicaciones
Evidencias científicas
Padecimientos músculo-esqueléticos Tendinopatías
Meniscopatía
Lesiones ligamentarias
Fracturas óseas
Fascitis
Desgarros musculares
Osteoartritis
Estudios preclínicos y clínicos
(casos-control)
Heridas quirúrgicas
Cirugía ginecológica (abdominales)
Estudios clínicos (series de casos)
Cirugía cardiovascular (esternales y accesos vasculares)
Cirugía plástica (colgajo cutáneo) Quemaduras
Cutáneas y corneales
Úlceras crónicas
Diabéticas
Vasculares
Por presión
Oftalmología
Úlceras corneales
Ojo seco
Timpanoplastia
Otorrinolaringología
Cirugía estética y Dermatología
Neurología y Neurocirugía
Estudios clínicos (casos clínicos
aislados)
Estudios clínicos (casos-control)
Estudios preclínicos y clínicos
(series de casos)
Estudios preclínicos y clínicos (serie
de casos clínicos)
Líneas de expresión facial
Estudios preclínicos y clínicos (serie
Implantes de cabello
de casos clínicos)
Sutura de nervios periféricos y neurorrehabili- Estudios preclínicos y clínicos
tación
(casos clínicos aislados)
para ello. Este hecho sólo ha podido corroborarse in vitro explicado por la estimulación del
antiportador Na+/K+ que teóricamente podría
acelerar un proceso maligno localmente presente e incluso inducirlo de novo; si bien en
la práctica médica no existe evidencia alguna
que permita pensar que los procedimientos
de aplicación de los factores de crecimiento
pudieran constituir un peligro de degeneración
neoplásica ni influir en la progresión tumoral
o la diseminación metastásica en pacientes
previamente no diagnosticados de proceso
oncológico maligno.50
Contraindicaciones del plasma rico en
plaquetas
Según la mayoría de los autores consultados, se
desaconseja el plasma rico en plaquetas en los
pacientes con trastornos de la coagulación, he-
mostasia o en tratamiento con anticoagulantes
orales o antiagregantes, recuentos plaquetarios
en sangre total menores de 100,000/mm 3,
embarazo, infección activa o tumores por el
efecto de progresión del proceso inflamatorio
mediado por la infección, así como de diseminación teórica tumoral en pacientes ya
diagnosticados que producirían los factores
de crecimiento.
CONCLUSIÓN
Sin duda, nos encontramos ante una nueva
era de tratamiento en el campo novedoso de
la Medicina regenerativa con un abanico de
posibilidades de aplicaciones clínicas extraordinarias, creciente, pero que precisa un proceso de
sistematización científica y médica que permita
encauzarlo de manera segura y eficaz en las aplicaciones en que realmente exista una evidencia
139
Revista de Hematología
científica de peso suficiente para su administración. Para ello, hay dos requerimientos: primero,
el consenso de los autores que se dedican a la
producción y aplicación de este tratamiento
con el fin de estandarizar los procedimientos de
obtención más eficaces y que permitan la adecuada trazabilidad o seguimiento del producto
final obtenido, según la aplicación clínica que
se le pretenda dar y, por otro lado, el diseño de
ensayos clínicos que reproduzcan y establezcan
pautas de administración adecuadas a tal efecto.
Volumen 16, Núm. 2, abril-junio 2015
Para establecer una ficha técnica se necesitan
estudios científicos adecuados bajo la forma
de ensayos clínicos que permitan estandarizar
las técnicas de obtención dependiendo de la
composición celular y proteica del producto
final conseguido y que sea reproducible por
todos los autores, así como pautas concretas
de administración para cada aplicación clínica
donde sea factible su prescripción en la Medicina regenerativa.
Agradecimientos
Hoy día, aún estamos lejos de conseguirlo,
debido a que para las aplicaciones clínicas vigentes la evidencia científica existente es débil,
basada en series de casos clínicos o estudios de
control de casos en los supuestos más positivos.
La existencia creciente de diversos protocolos de
obtención, el bajo control sobre el componente
del producto final obtenido y la variedad de
aplicaciones clínicas dificultan llegar a algún
tipo de consenso acerca de la técnica o procedimientos de obtención más fiables y adecuados
y, en segundo lugar, la elaboración de ensayos
clínicos adecuados que permitan probarlos en
los diferentes padecimientos susceptibles de ello.
Según lo publicado al respecto, el plasma rico
en plaquetas es una técnica bien tolerada,
considerada desde hace dos años medicamento, su prescripción está restringida a médicos,
odontólogos y podólogos; en la actualidad carece de ficha técnica y no puede considerarse
tratamiento estándar contra ninguna entidad
médica en que se pretenda administrar, si bien
se acepta que pueda prescribirse como tratamiento coadyuvante junto a los convencionales
para lograr la mejoría clínica y funcional del
paciente.
Se precisan estudios básicos y de Medicina
traslacional que permitan comprender mejor
los mecanismos fisiopatogénicos que subyacen
a sus efectos regenerativos.
140
A mi mujer y a mi hijo, por su paciencia y dedicación, por su estímulo y ánimo, sin los que no
hubiera sido posible la ejecución de este artículo.
REFERENCIAS
1. Klinger, MH. The storage lesion of platelets: ultrastructural
and functional aspects. Ann Hematol 1996;73:103-112.
2. González-Villalva A. Sangre. Capítulo 6. En: Fortoul y
Castell. Histología y biología celular. México: McGraw-Hill
Interamericana, 2010;147-154.
3. Benito L. Aspectos estructurales y vías metabólicas. En:
Bioquímica. Benito L, editor. 2a ed. Madrid: Editorial McGraw Hill Interamerica, 1991;2:1207-1226.
4. Beca T, Hernández G, Morante S, Bascones A. Plasma
rico en plaquetas. Una revisión bibliográfica. Av Periodon
Implantol 2007;19:39-52.
5. Alsousou J, Thompson M, Hulley P, Noble A, Willett K.
The biology of platelet-rich plasma and its applications in
trauma and orthopaedic surgery: a review of literature. J
Bone Joint Surg Br 2009;91:987-996.
6. Weibrich G, Kleis WK, Hafner G, Hitzler WE J Craniomaxillofac Surg 2002;30:97-102. Growth factors level in plateletsrich plasma and correlations with donor age, sex and
platelets count. J Craniomaxillofac Surg 2002;30:97-102.
7. Anitua E, Prado R, Sánchez M, Orive G. Platelet-rich
plasma: preparation and formulation. Oper Tech Orthop
2012;22:25-32.
8. Everts PA, Brown Mahoney C, Hoffmann JJ, Schönberger JP,
et al. Platelet-rich plasma preparation using three devices:
implications for platelet activation and platelet growth
factors release. Growth Factors 2006;24:165-171.
9.
Appel TR, Pötzsch B, Müller J, von Lindern JJ, et al. Comparison of three different preparations of platelet concentrates for growth factor enrichment. Clin Oral Implants Res
2002;13:522-528.
Alcaraz-Rubio J. Plasma rico en factores de crecimiento plaquetario
10. Scherer SS, Tobalem M, Vigato E, Heit Y, et al. Nonactivated
versus thrombin-activated platelets on wound healing and
fibroblast-to-myofibroblast differentation in vivo and in
vitro. Plast Reconstr Surg 2012;129:46-54.
26. Gamradt S, Rodeo S, Russell F. Platelet rich plasma in rotator
cuff repair. Techniques in Orthopaedics 2007;22:26-33.
11. Peerbooms J, Sluimer J, et al. Positive effect of an autologous platelet concentrate in lateral epicondylitis in a
double-blind randomized controlled trial. Am J Sport Med
2008;36:1171-1178.
28. Dimauro I, Grasso L, Fittipaldi S, Fantini C, et al. Platelet-rich
plasma and skeletal muscle healing: a molecular analysis
of the early phases of the regeneration process in an experimental animal model. PLoS One 2014;23:102993.
12. Peerbooms J, Sluimer J, Bruijn D, Gosens T. Positive effect of
an autologous platelet concentrate in lateral epicondylitis
in a double-blind randomized controlled trial: platelet-rich
plasma versus corticosteroid injection with 1 year follow
up. Am J Sport Med 2010;38:255-226.
13. Barret S, Erredge S. Growth factors for chronic plantar
fasciitis. Podiatry Today 2004;17:37-42.
14. Glazer JL. An approach to the diagnosis and treatment of
plantar fascitis. Phys Sportsmed 2009;37:74-79.
15. Kon E, Filardo G, Delcogliano M, Presti ML, et al. Platelet
rich plasma: new clinical application: a pilot study for
treatment of jumper’s knee. Injury 2009;40:598-603.
16. Filardo G, Kon E, Della Villa S, Vicentelli F, et al. Use of platelet-rich plasma for the treatment of refractory jumper’s
knee. Int Orthop 2010;34:909-915.
17. Van Ark M, Zwerver J, van den Akker-Scheek I. Injection
treatments for patellar tendinopathy. Br J Sports Med
2011;45:1068-1076.
18. Ventura A, Terzaghi C, Borgo E, Verdoia C, et al. Use of
growth factors in ACL surgery. J Orthopaed Traumatol
2005;6:76-70.
19. Saito M, Takahashi KA, Arai Y, Inoue A, et al. Intrarticular
administration of platelet-rich plasma with biodegradable
gelatin hydrogel microspheres prevents osteoarthritis progression in the rabbit knee. Clin Exp Rheumatol 2009;201207.
20. Sampson S, Reed M, Silvers H, Meng M, et al. Injection of
platelet-rich plasma in patients with primary and secondary
knee osteoarthritis: a pilot study. Am J Phys Med Rehabil
2010;89:961-969.
21. Kvist M, Józsa L, Järvininen MJ, Kvist H. Chronic Achilles
paratenonitis: a histological and histochemical study.
Pathology 1987;19:1-11.
22. Puddu G, Ippolito E, Postacchini F. A classification of Achilles
tendon disease. Am J Sports Med 1976;4:145-150.
23. Filardo G, Presti ML, Kon E, Marcacci M. Nonoperative
biological treatment approach for partial Aquilles tendon
lesion. Orthopedics 2010;33:120-123.
24. Castricini R, Longo UG, De Benedetto M, Panfolini N, et al.
Platelet-rich plasma augmentation for arthroscopic rotator
cuff repair: a randomized controlled trial. Am J Sports Med
2011;39:258-265.
25. Jo CH, Kim JE, Yoon KS, Lee JH, et al. Does platelet-rich
plasma accelerate recovery after rotator cuff repair? A
prospective cohort study. Am J Sports Med 2011;39:20822090.
27. Huard J, Li Y, Fu FH. Muscle injures and repair: current
trends in research. J Bone Joint Surg Am 2002;84:822-832.
29. Marx R, Garg A. The biology of platelets and the mechanism
of platelet-rich plasma. En: Dental and Craneofacial Applications of PRP. Marx R, Garg A, ed. Chicago: Quintessence
Publishing Co, Inc., 2005;3-65.
30. Luces G, García LA. Uso del plasma rico en plaquetas para la
regeneración tisular en la terapia periodontal. Universidad
Central de Venezuela. Caracas: Tesis monográficas, 2006.
31. Spector M. Basic principles of tissue engineering. Tissue
engineering: applications in maxillofacial surgery and
periodontics. Illinois: Editorial Quintessense Books, 1999.
32. Marx RE. Platelet-rich plasma: a source of multiple autologous growth factors for bone grafts. Tissue engineering:
applications in maxillofacial surgery and periodontics.
Illinois: Editorial Quintessense Books, 1999.
33. Fannig J, Murrain L, Flora R, Hutchings T, et al. Phase I/II
prospective trial of autologous platelets tissue graft in gynecologic surgery. J Minim Invasive Gynecol 2007;14:633637.
34. Shackelford DP, Fackler E, Hoffman MK, Atkinson S. Use of
topical recombinant human platelet-derived growth factor
BB in abdominal wound separation. Am J Obstet Gynecol
2002;186:701-704.
35. Sipurzynski-Budrass S, Marcher S, Haeusler M, Lanzer G.
Succefull treatment of premature rupture of membranes
after genetic amniocentesis by intra-amniotic injection of
platelets and cryoprecipitate (amniopatch): a case report.
Vox Sang 2006;91:88-90.
36. Gómez-Caro A, Ausin P, Boada M. Platelet rich plasma
improves the healing process after airway anastomosis.
Interac Cardiovasc Thor Surg 2012;13:552-556.
37. Man D, Plosker H, Winland-Brown JE. The use of autologous
platelet-rich plasma (platelet gel) and autologous plateletpoor plasma (fibrin glue) in cosmetic surgery. Plast Reconstr
Surg 2001;107:229-237.
38. Pallua N, Woler T, Markowicz M. Platelet-rich plasma in
burns. Burns 2010;36:4-8.
39. De Hingh IH, Nienhuijs SW, Overdevest EP, Scheele K, Everts
PA. Mesh fixation with autologous platelet-rich fibrin sealant
in inguinal hernia repair. Eur Surg Res 2009;43:306-309.
40. Villela DL, Santos VL. Evidence on the use of platelet-rich
plasma for diabetic ulcer: a systematic review. Growth
Factors 2010;28:111-116.
41. Dougherty EJ. An evidence-based model comparing the
cost-effectiveness of platelet-rich plasma gel to alternative
therapies for patients with nonhealing diabetic foot ulcers.
Adv Skin Wound Care 2008;21:568-575.
141
Revista de Hematología
42. Alio JL, Abad M, Artola A, Rodriguez-Prats JL, et al. Use
of autologous platelet-rich plasma in the treatment of
dormant corneal ulcers. Ophtalmology 2007;114:12861293.
43. Ortuño-Prados VJ, Alio JL. Tratamiento de úlcera corneal
neutrófica con plasma rico en plaquetas y Tutopatch®. Arch
Soc Esp Oftalmol 2011;86:121-123.
44. Márquez-de-Aracena R, Montero-de-Espinosa I, Muñoz
M, Pereira G. Aplicación subconjuntival de concentrado de
plaquetas plasmáticas en el tratamiento de quemaduras
oculares. Resultados preliminares. Arch Soc Esp Oftalmol
2007;82:457-482.
45. Henderson JL, Cupp CL, Ross EV, Shick PC, et al. The effects
of autologous platelet gel on wound healing. Ear Nose
Throat J 2003;82:598-602.
46. Navarrete-Álvaro ML, Ortiz N, Rodriguez L, Boemo R, et
al. Pilot study on the efficiency of the bioestimulation
142
Volumen 16, Núm. 2, abril-junio 2015
with autologous plasma rich in platelet growth factors in
otorhinolaryngology: otologic surgery (tympanoplasty type
I). ISRN Surg 2011:2011/451020.
47. Li ZJ, Choi HI, Choi DK, Sohn KC, et al. Autologous plateletrich plasma: a potential therapeutic tool for promoting hair
growth. Dematol Surg 2012;38:1040-1046.
48. Cho HH, Jang S, Lee SC, Jeong HS, et al. Effect of neuralinduced mesenchymal stem cells and platelet-rich plasma
of facial nerve regeneration in an acute nerve injury model.
Laryngoscope 2010;120:907-913.
49. Sariguney Y, Yavuzer R, Elmas C, Yenicesu I, et al. Effect of
platelet-rich plasma on peripheral nerve regeneration. J
Reconstr Microsurg 2008;24:159-167.
50. Harguindey S, Orive G, Pedraz JL. Integración multidisciplinaria de campos oncológicos a través de mecanismos
cruciales y vías comunes. De etiopatogénesis a tratamiento.
Oncología 2002;25:295-316.
Artículo de revisión
Rev Hematol Mex 2015;16:143-151.
Cadenas ligeras: ¿totales o libres?
Qué medir y por qué
Florencia Delgado
Directora de Asuntos Científicos en Latinoamérica,
The Binding Site, Inc., San Diego, CA, Estados Unidos.
RESUMEN
Encontrar el esquema diagnóstico más eficiente para asegurar la mayor sensibilidad y especificidad posible en la detección de proteínas
monoclonales en pacientes con mieloma múltiple puede presentar
algunas controversias. Es el caso de los inmunoensayos para la cuantificación de cadenas ligeras que sigue generando debate actualmente, aun cuando las evidencias clínicas son muy fuertes. Existen dos
tipos de ensayo comercialmente disponibles en la actualidad para la
determinación de cadenas ligeras κ y λ. Un tipo de inmunoensayo
cuantifica las cadenas ligeras totales κ y λ (libre y unidas a las cadenas
pesadas). Otro tipo de inmunoensayo cuantifica solamente las formas
libres de κ y λ en forma específica, sin reaccionar con las formas
unidas. El uso actual del ensayo de cadenas totales ocurre a pesar
de las recomendaciones internacionales que indican que el método
no es suficientemente sensible para su uso en la rutina clínica. Por
ende, las muestras que contengan grandes cantidades de cadenas
ligeras libres pueden ser completamente ignoradas usando la técnica
de cadenas ligeras totales. Varios estudios compararon la sensibilidad
de los métodos de cadenas ligeras totales y libres, con el fin de evaluar el efecto clínico. El objetivo de este artículo es aclarar algunos
conceptos de los fundamentos del ensayo de cadenas ligeras libres en
suero, distinguiéndolo del ensayo de cadenas ligeras totales en suero
y comparar la utilidad clínica de ambas pruebas.
Palabras clave: inmunoensayos para cadenas ligeras en suero, mieloma
múltiple, diagnóstico.
Light chains: Total or free? Which ones
should be measured
ABSTRACT
Finding the most efficient diagnostic scheme that ensures the highest
possible sensitivity and specificity for detection of monoclonal proteins
in patients with multiple myeloma may present some controversy. This
is the case of immunoassays for the quantification of light chains, which
are still generating discussion although clinical endorsements are very
strong. There are two types of assays commercially available currently
that measure κ and λ light chains in serum. One type measures total
(free and bound to heavy chains) light chains. The other type measures
only free light chains. The current use of total light chain assay occurs
in spite of international warnings that indicate the method is not sensitive enough for routine clinical use. Indeed, samples containing large
amounts of free light chains may be completely missed using the total
light chain technique. Different studies had compared the sensitivity
www.nietoeditores.com.mx
Recibido: 22 de enero 2015
Aceptado: 25 de marzo 2015
Correspondencia: Florencia Delgado PhD
The Binding Site Inc., 5889
92121 Oberlin Drive, San Diego, CA, USA
[email protected]
Este artículo debe citarse como
Delgado F. Cadenas ligeras: ¿totales o libres? Qué
medir y por qué. Rev Mex Hematol 2015;16:143-151.
143
Revista de Hematología
Volumen 16, Núm. 2, abril-junio 2015
between methods, both total and free light chain assays, in order to
evaluate the clinical impact. The aim of this review article is to clarify
some concepts about the foundations of the free light chain assay,
distinguishing it from the total light chain assay and to compare the
clinical utility of both tests.
Key words: immunoassays for serum light chains, multiple myeloma,
diagnosis.
GAMMAPATÍAS MONOCLONALES
Las gammapatías monoclonales tienen su
origen en clones de células plasmáticas con
proliferación descontrolada que producen
inmunoglobulinas idénticas en exceso, lo que
se observa generalmente como un “pico” en la
zona gamma de las electroforesis de proteínas
en suero. Este pico monoclonal, paraproteína o
proteína M, que por lo general, aunque no universalmente se observa en estos pacientes, puede
corresponder a un exceso de inmunoglobulina
intacta, a un exceso exclusivo de cadenas ligeras
κ o λ producidas sin una cadena pesada asociada, o a ambas, tanto la inmunoglobulina intacta
como su cadena ligera asociada, secretada de
manera libre. Las gammapatías monoclonales
más frecuentes incluyen: gammapatía monoclonal de significado incierto, mieloma múltiple y
amiloidosis.1
Cualquiera que sea el caso en cada una de estas enfermedades, la evaluación de la proteína
monoclonal circulante es un pilar fundamental
para diagnóstico, pronóstico y seguimiento y se
ha convertido en una herramienta valiosa para
el médico porque representa el marcador de
producción tumoral.
Pruebas de laboratorio recomendadas
Con el objetivo de poner en evidencia esta producción de proteínas monoclonales y aclarar
144
el diagnóstico en pacientes con sospecha de
mieloma múltiple, además del examen físico y
el estudio de la médula ósea se debe realizar un
minucioso estudio proteico que permita identificar el tipo y la cantidad de proteína monoclonal
producida por el tumor.
Los estudios proteicos habitualmente utilizados
para este fin incluyen:
• Electroforesis de proteínas en suero y
orina.
• Medición de IgG, IgA e IgM en suero.
• Inmunofijación en suero y orina.
• Concentración y relación de cadenas
ligeras libres en suero.
En 2009, el Grupo Internacional de Trabajo
de Mieloma (International Myeloma Working
Group, IMWG) elaboró un conjunto de recomendaciones acerca del esquema de diagnóstico
inicial referido a la evaluación de la producción
de proteína monoclonal por parte del paciente.2
En estas guías, actualmente aceptadas y utilizadas en gran parte del mundo, se recomienda la
realización de una electroforesis de proteínas
en suero junto a la medición de cadenas ligeras
libres sobre la misma muestra de suero y como
reflejo (es decir, si una o ambas pruebas diera
positivo) una inmunofijación en suero para
tipificar la gammapatía monoclonal encontrada. Este esquema, que utiliza sólo suero como
Delgado F. Cadenas ligeras totales y libres
fuente de investigación, ha demostrado ser el
más eficiente y simple para cubrir el diagnóstico,
considerando los diversos tipos de producción
proteica que pudiera tener un potencial paciente con una gammapatía monoclonal. Tiene la
ventaja adicional de no requerir análisis de las
proteínas en orina de 24 horas a priori en todos
los pacientes (excepto los casos de amiloidosis).
Una actualización de estas recomendaciones
internacionales la publicó recientemente el
IMWG,3 dando un paso más hacia la identificación adecuada y temprana de pacientes
con mieloma múltiple. En esta actualización,
Rajkumar y su grupo sugieren utilizar una serie
de biomarcadores de malignidad definidos junto
al análisis de médula ósea del paciente para realizar el diagnóstico de mieloma múltiple. Entre
estos biomarcadores establecen la relación de
cadenas ligeras libres ≥ 100 como criterio de
malignidad (relación cadena involucrada-cadena
no involucrada). Las guías del IMWG establecen
claramente que esa medición se debe realizar
con el ensayo de cadenas ligeras libres en suero.3
Éste es el esquema y escenario diagnóstico
actual; sin embargo, en algunos laboratorios
se plantea la duda acerca del tipo de ensayo a
realizar para la determinación de las cadenas
ligeras en suero. En los próximos apartados se
hablará de los fundamentos de cada uno de los
ensayos y de su utilidad clínica.
Ensayo de cadenas ligeras libres en suero
Las células plasmáticas son las responsables
de la producción de inmunoglobulinas intactas
(IgG, IgA, IgM, IgD e IgE), además y aun en
condiciones fisiológicas, estas células producen y secretan un exceso de cadenas ligeras κ
o λ.4 Ambas cadenas, tanto κ como λ, circulan
de manera libre, aunque en general, κ circula
en forma de monómero (aproximadamente
25 kDa) mientras que λ lo hace como dímero
(aproximadamente 50 kDa). Las concentracio-
nes en suero de las inmunoglobulinas intactas
rondan los g/L; por ejemplo, el valor normal de
IgG es de aproximadamente 7 a 17 g/L (o, lo que
es igual, 700 a 1,700 mg/dL o 7,000 a 17,000
mg/L), mientras que las cadenas ligeras libres
circulan en sangre en condiciones normales
en valores muy inferiores, unas 1,000 veces
menores (valores de hasta 20 o 25 mg/L o, lo
que es igual, 2-2.5 mg/dL). Las concentraciones
séricas de cadenas ligeras libres dependen del
equilibrio entre la producción por las células
plasmáticas y el metabolismo renal. Por ello,
en circunstancias normales muy poca cantidad
de κ y λ se encontrará en la orina, el riñón es
muy eficiente en su función mientras no se vea
sobrepasado en su capacidad de reabsorción
por una excesiva producción.4 Alrededor de
30 gramos de proteínas pequeñas pueden ser
metabolizadas al día por el riñón y, teniendo en
cuenta que la producción normal de κ y λ es de
alrededor de 0.5-1 gramo diario, es fácil comprender que muy poca proteína aparecerá en la
orina.4 Las inmunoglobulinas intactas, por otro
lado, tienen otro mecanismo de metabolización
que no utiliza al riñón como órgano de filtrado.5
Sin olvidar que κ o λ también formarán parte de
las inmunoglobulinas intactas, recordemos que
hay enfermedades en las que sólo existe producción monoclonal de estas pequeñas proteínas. El
100% de los mielomas múltiples de cadena ligera,6,7 alrededor de 70% de los llamados mielomas
múltiples no secretores8 (cuya denominación
actual es mieloma múltiple oligosecretor) y la
mayor parte de las amiloidosis producen sólo
cadenas ligeras.9 Esto hace que sea fundamental
contar con un método de laboratorio adecuado
para su detección.
La medición de κ y λ ha evolucionado mucho
desde su primera aparición en el mundo clínico, que data del año 1845.10 Estas “proteínas
de Bence-Jones”, identificadas originalmente
en la orina de pacientes con mieloma múltiple,
145
Revista de Hematología
han recorrido un largo camino hasta hallar un
método confiable, sensible y específico para su
medición. La introducción en la última década
del inmunoensayo de cadenas ligeras libres en
suero que utiliza antisuero policlonal (Freelite, The Binding Site Group, Birmingham, UK)
representó un gran avance en el tratamiento
de las gammapatías monoclonales. Se trata de
un ensayo que utiliza anticuerpos policlonales
específicos para detectar cadenas ligeras κ y λ
sólo cuando éstas se encuentren en forma libre,
no unidas a las cadenas pesadas formando
parte de las inmunoglobulinas (Figura 1).11 La
alta sensibilidad de este ensayo combinado
con la posibilidad de calcular una relación κ/λ
proporciona al médico la capacidad de medir la
cantidad de cadena ligera libre producida por el
tumor, identificar la existencia de la enfermedad
monoclonal, evaluar las concentraciones de la
cadena no implicada y también proporciona
información del estado de recuperación inmunológico del paciente en tratamiento. Al medir
directa y específicamente las formas libres se
miden las formas clínicamente relevantes de las
cadenas ligeras; por tanto, resulta una medición
de mayor sensibilidad para la detección de la
producción de estas proteínas asociadas con los
trastornos de células plasmáticas, en compara-
Figura 1. A. Diagrama de una inmunoglobulina intacta
que muestra la estructura de las cadenas pesadas y
ligeras. B. Diagrama de las cadenas ligeras libres κ
y λ, que representa los distintos dominios sobre las
cadenas ligeras y los epítopes que son reconocidos por
el ensayo de cadenas ligeras libres en suero.
146
Volumen 16, Núm. 2, abril-junio 2015
ción con los ensayos de cadenas ligeras totales,
acerca de los que se discutirá a continuación.
Los ensayos de medición de cadenas ligeras
totales no son suficientemente sensibles para
detectar los trastornos de células plasmáticas
asociados con cadenas ligeras
Los ensayos de cadenas ligeras totales cuantifican las cadenas κ y λ libres y unidas (Figura 2) y,
por tanto, tienen intervalos de referencia mucho
mayores en suero que el ensayo de cadenas
ligeras libres (Cuadro 1). Se ha reportado que el
ensayo de cadenas ligeras totales detecta monoclonalidad de cadenas ligeras en muestras de
suero cuando las concentraciones de estas proteínas son mayores a 4 o 5 g/L.12,13 Sin embargo,
las mediciones de κ y λ totales y su relación no
concuerdan de manera consistente con los resultados de la electroforesis o de la inmunofijación
y, por tanto, no es una prueba recomendada para
la clasificación o la vigilancia de los pacientes
Figura 2. Esquematización de la medición de las cadenas ligeras κ y λ con los ensayos de cadenas ligeras
totales y libres. El ensayo de cadenas ligeras totales
cuantifica las cadenas ligeras libres y las unidas a las
cadenas pesadas formando parte de las inmunoglobulinas. El ensayo de cadenas ligeras libres cuantifica
sólo las formas libres de las cadenas ligeras.
Delgado F. Cadenas ligeras totales y libres
Cuadro 1. Intervalos de referencia y valores límites inferiores de sensibilidad para los ensayos de cadenas ligeras libres y
cadenas ligeras totales en suero
Sensibilidad
kappa
(mg/L)
Intervalo de referencia
lambda (mg/L)
Sensibilidad
lambda (mg/L)
3.3-19.4
6,290-13,500
1,380-3,750
0.3
111
300
5.7-26.3
3,130-7,230
930-2,420
0.4
300
300
con mieloma.12 Debido a la concentración relativamente alta de inmunoglobulinas policlonales
circulantes, la cuantificación de las formas libres
monoclonales puede quedar completamente
enmascarada. Los ensayos de cadenas ligeras
totales son menos sensibles para la detección de
trastornos de células plasmáticas asociados con
las cadenas ligeras debido a la “interferencia”
que ocasionan las inmunoglobulinas intactas
cuyo aporte puede ocultar la detección de estas
proteínas monoclonales. Uno de los mayores
efectos negativos al utilizar el ensayo de cadenas
totales se pone de manifiesto durante la vigilancia del tratamiento. El hecho de tener valores
normales mayores no permite detectar pequeñas
alteraciones de cadenas ligeras, por ejemplo, en
una recaída o en la enfermedad residual.
La sensibilidad de ambos ensayos (cadenas
ligeras libres en suero, Freelite® versus cadenas ligeras totales) se comparó en un estudio
donde se evaluaron 16 muestras de suero de
pacientes con cadenas ligeras monoclonales.14
Las 16 muestras arrojaron resultados anormales
utilizando el ensayo de cadenas ligeras libres
en suero, mientras que el ensayo de cadenas
ligeras totales sólo detectó una anormalidad
en 5 de las 16 muestras. Además, una muestra
que contenía proteína monoclonal λ se clasificó
erróneamente como κ por el ensayo de cadenas
ligeras totales (Figura 3). Estos datos indican que
el ensayo de cadenas ligeras totales no es capaz
de discriminar de manera consistente muestras
con mieloma de muestras normales de suero.14
A
B
9
8
7
6
5
4
3
2
1
0
1000.00
NR
Relación κ/λ libres
Cadenas ligeras libres (The Binding Site)
Cadenas ligeras totales (Beckman Coulter)
Cadenas ligeras totales (Roche)
Intervalo de
referencia kappa
(mg/L)
Relación κ/λ totales
Parámetro
100.00
10.00
1.00
NR
0.10
0.01
0.00
Figura 3. Comparación de la relación κ/λ de cadenas
ligeras totales en suero (A) y la relación κ/λ de cadenas
ligeras libres en suero (B) para la identificación de
pacientes con producción de proteínas monoclonales
de cadena ligera κ y λ.
Triángulos azules: pacientes λ; cuadrados negros:
pacientes κ; triángulo rojo: paciente κ mal clasificado
como λ por el ensayo de cadenas ligeras totales.
NR: valor normal.
Significado clínico de cadenas ligeras libres vs
totales
Las cadenas ligeras libres en suero se pueden
detectar en concentraciones tan bajas como 0.3
mg/L (kappa) y 0.4 mg/L (lambda) utilizando el
inmunoensayo de cadenas ligeras libres (Freelite®).11 Asimismo, las mínimas concentraciones
de cadenas ligeras totales detectadas son 111
mg/L y 300 mg/L (kappa) y 300 mg/L (lambda)
con los ensayos de cadenas totales (otras dos
compañías).
Las cadenas ligeras totales ofrecen poco valor
clínico para el diagnóstico y vigilancia de gamma-
147
Revista de Hematología
patías monoclonales. Según algunos autores, los
beneficios del procedimiento de detección de
cadenas ligeras totales son limitados y no se recomienda su uso.15 Se advierte que el método de
medición de cadenas ligeras totales para la identificación de pacientes con mieloma múltiple
de cadena ligera no es suficientemente sensible
para su utilización clínica.15 Las mediciones de
cadenas ligeras totales no están incluidas en las
guías de criterios de respuesta ni de diagnóstico
para pacientes con mieloma múltiple y enfermedades relacionadas.2,3,16,17
Recientemente, un estudio mexicano efectuado
de muestras de pacientes con mieloma múltiple
mostró la poca capacidad de la cuantificación
de cadenas ligeras totales en el diagnóstico
y seguimiento de estos pacientes. 18 En este
estudio, Zamora-Ortiz y su grupo evaluaron
mediante las técnicas serológicas de laboratorio
convencionales (electroforesis de proteínas en
suero, inmunofijación en suero y determinación
de cadenas totales en suero) la existencia de
proteína monoclonal durante la presentación
(62 pacientes) y el seguimiento (29 pacientes)
del tratamiento contra mieloma múltiple. Este
estudio encontró que la inmunofijación en suero diagnosticó 92% de los casos, evidenciando
la existencia de la proteína monoclonal; en
segundo lugar, la electroforesis de proteínas en
suero mostró sensibilidad de 58%, mientras que
la determinación de cadenas ligeras totales sólo
logró identificar 45% de las alteraciones en la
producción de proteína monoclonal. La baja
sensibilidad diagnóstica de la determinación
de cadenas ligeras totales en suero para estos
pacientes proporciona una evidencia clínica
adicional de la falta de valor clínico de esta prueba, en este caso, evaluada en una población de
pacientes mexicanos.18 En este estudio se insiste
en que el método usado para la cuantificación de
cadenas ligeras (totales) no corresponde al más
adecuado debido a que se miden cadenas totales
y no libres; la medición de cadenas ligeras libres
es considerablemente superior a la medición de
148
Volumen 16, Núm. 2, abril-junio 2015
cadenas totales.18 Esta evidencia local no hace
más que validar la recomendación internacional de desestimar el uso del ensayo de cadenas
ligeras totales en el laboratorio de rutina para
pacientes con discrasias de células plasmáticas;
conclusiones que se avalaron y ampliaron en
una carta al editor referida al mismo trabajo
mexicano.18,19
Asimismo, la utilidad del ensayo de cadenas ligeras libres en suero para el diagnóstico, pronóstico
y vigilancia de gammapatías monoclonales ha
sido extensamente estudiada por hematólogos
y líderes en mieloma en todo el mundo y se ha
incorporado en guías internacionales de manejo
de pacientes:
Diagnóstico
El ensayo de cadenas ligeras libres en suero
detecta:
• 94% de los pacientes con mieloma múltiple de inmunoglobulina intacta,20
• 100% de los pacientes con mieloma
múltiple de cadena ligera al momento de
la aparición,6,7,21,22
• 68% de los pacientes con mieloma
múltiple no secretor, que no pueden ser
diagnosticados por métodos tradicionales
de laboratorio,8
• 98% de los pacientes con amiloidosis.1,9,23
El ensayo de cadenas ligeras libres en suero
tiene mayor sensibilidad que la inmunofijación en orina de 24 horas para la detección de
mielomas.24
Vigilancia
El ensayo de cadenas ligeras libres en suero
se utiliza para medir la respuesta clínica al
tratamiento de mieloma múltiple2,7,25,26 y amiloidosis.2,9,23,27,28
Delgado F. Cadenas ligeras totales y libres
El ensayo de cadenas ligeras libres en suero
predice recaídas en mieloma múltiple de manera
más temprana que la inmunofijación.25
En amiloidosis, una reducción de 50% en la
concentración de las cadenas ligeras libres involucradas tiene un importante valor pronóstico y
se asocia con mejoría de la función orgánica.9,23
Guías de manejo de pacientes
Las mediciones de cadenas ligeras libres en
suero se han incorporado en muchas guías internacionales y nacionales en distintos países con
directrices generales de manejo de pacientes;
algunas de ellas son:
°
°
°
°
°
°
°
°
Criterios actualizados para el diagnóstico del mieloma múltiple del Grupo
Internacional de Estudio de Mieloma.3
Lineamientos para el análisis de
cadenas ligeras libres en suero del
Grupo Internacional de Estudio de
Mieloma.2
The International Uniform Response
Criteria in Multiple Myeloma.17
Criterios de Respuesta en Amiloidosis.16,28
Simposio Internacional en Amiloidosis por un panel de consenso de
la Sociedad Internacional de Amiloidosis.28
Guías Hematológicas: Mieloma
Múltiple-Sociedad Argentina de
Hematología.29
Lineamientos en el diagnóstico y
manejo de mieloma múltiple: Asociación Brasileña de Hematología,
Hemoterapia y Terapia Celular.
Asociación Médica Brasileña.30
Manual de manejo de Mieloma
Múltiple-Sociedad Venezolana de
Hematología.31
°
Guía de Práctica Clínica. Diagnóstico y Tratamiento del Mieloma
Múltiple. México: Secretaría de
Salud 32 y Guías mexicanas de
diagnóstico y recomendaciones terapéuticas contra mieloma múltiple
(2009).33
Las cadenas ligeras totales pueden perder un
diagnóstico
En los distintos estudios citados se ha demostrado
que la sensibilidad del ensayo de cadenas ligeras
totales no es suficiente para asegurar la correcta
detección de una concentración anómala de las
proteínas monoclonales producida por el tumor
de células plasmáticas. Esto se debe, en gran
parte, a la falta de especificidad de detección,
porque en la misma determinación se incluye
la detección de grandes masas de proteínas policlonales no implicadas en el proceso tumoral.
Este “enmascaramiento” hace que en muchas
ocasiones las elevaciones anormales de κ, λ
y la alteración de su relación no se detecten a
tiempo. Un retraso en el diagnóstico repercutirá
de manera negativa en el estado clínico del paciente y sus posibilidades terapéuticas, también
podría llevar a profundizar las complicaciones
del mieloma en sí, como daño renal, enfermedad
ósea, anemias, etc.34
Un estudio comparativo reciente efectuado en
Lima, Perú, mostró que 3 de 17 pacientes fueron mal diagnosticados al utilizar el ensayo de
cadenas ligeras totales. Por el contrario, el inmunoensayo de cadenas ligeras libres en suero logró
identificar correctamente a los 17 pacientes. La
existencia de proteína monoclonal se confirmó
en todos los casos mediante una inmunofijación
en suero (observaciones no publicadas). Esto
demuestra, una vez más, que la especificidad
y sensibilidad del ensayo de cadenas ligeras
totales no son suficientes para la detección de
elevaciones anormales de las cadenas ligeras κ y
149
Revista de Hematología
λ y que su uso debe desestimarse en la clínica de
rutina que comprende las pruebas relacionadas
con la búsqueda de un diagnóstico correcto de
mieloma múltiple y otras discrasias de células
plasmáticas.
Volumen 16, Núm. 2, abril-junio 2015
4. Waldmann TA, Strober W, Mogielnicki RP. The renal
handling of low molecular weight proteins. II. Disorders
of serum protein catabolism in patients with tubular proteinuria, the nephrotic syndrome, or uremia. J Clin Invest
1972;51:2162-2174.
5. Kim J, Hayton WL, Robinson JM, Anderson CL. Kinetics of
FcRn-mediated recycling of IgG and albumin in human:
pathophysiology and therapeutic implications using
a simplified mechanism-based model. Clin Immunol
2007;122:146-155.
CONCLUSIONES
La clara necesidad de valorar y cuantificar las cadenas ligeras libres en suero y evaluar la relación
κ/λ ha llevado a intensas investigaciones durante
más de 150 años. La complejidad de las proteínas monoclonales para identificar y cuantificar
ha hecho que sólo recientemente se logre contar
con un reactivo de laboratorio capaz de cumplir
con estándares de sensibilidad y especificidad
necesarios para asegurar la correcta evaluación
de los pacientes con discrasias de células plasmáticas, principalmente pacientes con mieloma
múltiple. En este contexto, es importante resaltar
que el inmunoensayo de cadenas ligeras libres
en suero que utiliza un antisuero policlonal es
la única prueba recomendada por las directrices
del Grupo Internacional de Trabajo en Mieloma
para el tamizaje, diagnóstico, pronóstico y vigilancia de pacientes con discrasias de células
plasmáticas.2,3 Resulta imperioso, entonces,
considerar las alternativas disponibles y utilizar
aquéllas que nuestro compromiso profesional
dicte como las más adecuadas para realizar
nuestro trabajo diario de la manera más eficiente
y útil posible para los pacientes.
150
6. Abraham RS, Katzmann JA, Clark RJ, Bradwell AR, et al.
Quantitative analysis of serum free light chains. A new
marker for the diagnostic evaluation of primary systemic
amyloidosis. Am J Clin Pathol 2003;119:274-278.
7. Bradwell AR, Carr-Smith HD, Mead GP, Harvey TC, Drayson
MT. Serum test for assessment of patients with Bence Jones
myeloma. Lancet 2003;361:489-491.
8. Drayson M, Tang LX, Drew R, Mead GP, et al. Serum free
light-chain measurements for identifying and monitoring
patients with nonsecretory multiple myeloma. Blood
2001;97:2900-2902.
9. Lachmann HJ, Gallimore R, Gillmore JD, et al. Outcome in systemic AL amyloidosis in relation to changes
in concentration of circulating free immunoglobulin
light chains following chemotherapy. Br J Haematol
2003;122:78-84.
10. Clamp JR. Some aspects of the first recorded case of multiple myeloma. Lancet 1967;2:1354-1356.
11. Bradwell AR, Carr-Smith HD, Mead GP, et al. Highly sensitive, automated immunoassay for immunoglobulin free light
chains in serum and urine. Clin Chem 2001;47:673-680.
12. Laine ST, Soppi ET, Mörsky PJ. Critical evaluation of the
serum kappa/lambda light-chain ratio in the detection of
M proteins. Clin Chim Acta 1992;207:143-149.
13. Jones RG, Aguzzi F, Bienvenu J, Gasparro C, et al. Use of
immunoglobulin heavy-chain and light-chain measurements in a multicenter trial to investigate monoclonal
components: II. Classification by use of computer-based
algorithms. Clin Chem 1991;37:1922-1926.
REFERENCIAS
14. Mariën G, Oris E, Bradwell AR, Blanckaert N, Bossuyt X.
Detection of monoclonal proteins in sera by capillary zone
electrophoresis and free light chain measurements. Clin
Chem 2002;48:1600-1601.
1. Katzmann JA. Screening panels for monoclonal gammopathies: time to change. Clin Biochem Rev 2009;30:105111.
15. Kyle RA. Sequence of testing for monoclonal gammopathies. Arch Pathol Lab Med 1999;123:114-118.
2. Dispenzieri A, Kyle R, Merlini G, Miguel JS, et al. International Myeloma Working Group guidelines for serum-free light
chain analysis in multiple myeloma and related disorders.
Leukemia 2009;23:215-224.
3. Rajkumar SV, Dimopoulos MA, Palumbo A, Blade J, et al.
International Myeloma Working Group updated criteria
for the diagnosis of multiple myeloma. Lancet Oncol
2014;15:538-548.
16. Gertz MA, Comenzo R, Falk RH, Fernand JP, et al. Definition
of organ involvement and treatment response in immunoglobulin light chain amyloidosis (AL): a consensus opinion
from the 10th International Symposium on Amyloid and
Amyloidosis, Tours, France, 18-22 April 2004. Am J Hematol
2005;79:319-328.
17. Durie BG, Harousseau JL, Miguel JS, Bladé J, et al. International uniform response criteria for multiple myeloma.
Leukemia 2006;20:1467-1473.
Delgado F. Cadenas ligeras totales y libres
18. Zamora-Ortiz G, Velázquez-Sánchez-de-Cima S, HernándezReyes J, Martagón-Herrera NA, et al. Poor performance of
the total kappa/lambda light chain quantification in the
diagnosis and follow-up of patients with multiple myeloma.
Rev Invest Clin 2014;66:314-318.
26. Alyanakian MA, Abbas A, Delarue R, Arnulf B, Aucouturier
P. Free immunoglobulin light-chain serum levels in the
follow-up of patients with monoclonal gammopathies:
correlation with 24-hr urinary light-chain excretion. Am J
Hematol 2004;75:246-248.
19. Delgado F, Kuus K. Comparison of free kappa and lambda
light chain immunoassays and total (bound and free) kappa
and lambda light chain immunoassays. Rev Invest Clin
2014;66:473-474.
27. Wechalekar AD, Hawkins PN, Gillmore JD. Perspectives in
treatment of AL amyloidosis. Br J Haematol 2008;140:365-377.
20. Mead GP, Carr-Smith HD, Drayson MT, Morgan GJ, et al.
Serum free light chains for monitoring multiple myeloma.
Br J Haematol 2004;126:348-354.
21. Drayson MT, Morgan GJ, Jackson GH, et al. Prospective
study of serum FLC and other M-protein assays: when
and how to measure response? Clin Lymphoma Myeloma
2009;9:56.
22. Hutchison C, Plant T, Drayson M, Cockwell P, et al. Serum
free light chain measurement aids the diagnosis of myeloma in patients with acute renal failure. BMC Nephrol
2008:9:1-18.
23. Palladini G, Russo P, Bosoni T, Sarais G, et al. Identification
of amyloidogenic light chains requires the combination of
serum-free light chain assay with immunofixation of serum
and urine. Clin Chem2009;55:499-504.
24. Nowrousian MR, Brandhorst D, Sammet C, Kellert M, et al.
Serum free light chain analysis and urine immunofixation
electrophoresis in patients with multiple myeloma. Clin
Cancer Res 2005;11:8706-8714.
25. Hassoun H, Reich L, Klimek VM, Dhodapkar M, et al. Doxorubicin and dexamethasone followed by thalidomide and
dexamethasone is an effective well tolerated initial therapy
for multiple myeloma. Br J Haematol 2006;132:155-161.
28. Palladini G, Dispenzieri A, Gertz MA, Kumar S, et al. New
criteria for response to treatment in immunoglobulin light
chain amyloidosis based on free light chain measurement
and cardiac biomarkers: impact on survival outcomes. J
Clin Oncol 2012;30:4541-4549.
29. Fantl D. Guía hematológica de mieloma múltiple-Sociedad
Argentina de Hematología. Sociedad Argentina de Hematología 2013:289-316.
30. Hungria VT, Crusoe EQ, Quero AA, Sampaio M, et al.
Guidelines on the diagnosis and management of multiple
myeloma treatment: Associação Brasileira de Hematologia
e Hemoterapia e Terapia Celular Project guidelines: Associação Médica Brasileira-2012. Rev Bras Hematol Hemoter
2013;35:201-217.
31. Manual de manejo de mieloma múltiple. Sociedad Venezolana de Hematología 2013:1-158.
32. Guía de práctica clínica. Diagnóstico y tratamiento del
mieloma múltiple. México: Secretaría de Salud,2010:1-80.
33. Gómez-Almaguer D, Cano-Castellanos Raúl CL, Garcés-Ruiz
Oscar M, Gómez-Almaguer David, et al. Guías mexicanas de
diagnóstico y recomendaciones terapéuticas para mieloma
múltiple (2009). Revista de Hematología 2010;11:40-62.
34. Kariyawasan CC, Hughes DA, Jayatillake MM, Mehta AB.
Multiple myeloma: causes and consequences of delay in
diagnosis. QJM 2007;100:635-640.
151
Artículo de revisión
Rev Hematol Mex 2015;16:152-167.
FLT3, NPM1 y C/EBPα como
marcadores de pronóstico en
pacientes con leucemia mieloide
aguda
Francisco Alejandro Lagunas-Rangel1
Víctor Alfredo Pérez-Contreras2
Carlos Cortés-Penagos1,2
Facultad de Químico-Farmacobiología, Universidad
Michoacana de San Nicolás de Hidalgo, Morelia,
Michoacán, México.
2
Laboratorios Mendel, Morelia, Michoacán, México.
1
RESUMEN
La leucemia mieloide aguda es un grupo de enfermedades fenotípica
y genéticamente heterogéneas, originadas por la acumulación de
mutaciones en una célula madre hematopoyética o célula progenitora. De manera tradicional, los estudios citogenéticos se han utilizado
para estratificar a los pacientes con leucemia mieloide aguda en
tres categorías: favorable, intermedio y desfavorable. Sin embargo,
la estratificación pronóstica y la decisión del tratamiento para los
pacientes que tienen cariotipo normal muestra dificultades debido
a la alta heterogeneidad clínica. Recientemente, la identificación de
mutaciones genéticas adicionales a los marcadores clásicos permitió
generar nuevas entidades en el grupo de leucemia mieloide aguda
respecto al tratamiento y seguimiento de esta enfermedad. En 2008, la
Organización Mundial de la Salud introdujo las mutaciones en NPM1
y C/EBPα como entidades dentro del grupo de leucemia mieloide
aguda con anormalidades genéticas recurrentes, mientras que las
mutaciones en el gen FLT3 se han descrito como de mal pronóstico
en los pacientes portadores. El conocimiento de estas mutaciones
no sólo apoya el seguimiento de esta enfermedad, sino que abre la
posibilidad de generar nuevas estrategias de tratamiento.
Palabras clave: leucemia mieloide aguda, marcador molecular, pronóstico, proliferación, diferenciación celular.
FLT3, NPM1 y C/EBPα as prognosis
markers in patients with acute myeloid
leukemia
ABSTRACT
Acute myeloid leukemia (AML) can be described as a group of diseases,
phenotypic and genetically heterogeneous originated by multiple
mutations in a progenitor or hematopoietic stem cell. Cytogenetics is
traditionally used to stratify the patients with AML in three risk categories: favorable, intermediate and unfavorable. However, the forecast
stratification and the treatment decision for patients with normal
karyotype shows difficulties due to the high clinical heterogeneity.
Recently, the identification of several genetic mutations additional to
classical molecular markers, have been useful to identify new entities
152
Recibido: 15 de enero 2015
Aceptado: 24 de marzo 2015
Correspondencia: Dr. Carlos Cortés Penagos
[email protected]
Este artículo debe citarse como
Lagunas-Rangel FA, Pérez-Contreras VA, CortésPenagos C. FLT3, NPM1 y C/EBPα como marcadores
de pronóstico en pacientes con leucemia mieloide
aguda. Rev Mex Hematol 2015;16:152-167.
www.nietoeditores.com.mx
Lagunas-Rangel FA y col. FLT3, NPM1 y C/EBPα como marcadores de pronóstico
in AML. In 2008, the World Health Organization introduced the mutations in NPM1 and C/EBPα as entities within the group of AML with
recurrent genetic abnormalities. On the other hand, FLT3 mutations
have been associated with poor responses in patients positive to this
mutation. The knowledge of these new mutations has been useful to
clinical stratification of AML patients and opens the possibility to find
new strategies of treatment.
Key words: acute myeloid leukemia, molecular marker, prognostic,
proliferation, cellular differentiation.
ANTECEDENTES
La leucemia mieloide aguda es un conjunto de
enfermedades hematológicas de progresión rápida, fenotípica y genéticamente heterogéneas,
caracterizadas por la expansión clonal de precursores mieloides con capacidad disminuida de
diferenciación. Durante la evolución de este tipo
de leucemia, la célula madre hematopoyética o
célula progenitora sufre una serie de alteraciones
genéticas que modifican en algún punto su sistema de señalización celular (receptor-segundo
mensajero-proteína efectora), teniendo como
consecuencia cambios en la funcionalidad y
expresión de proteínas que son clave en procesos como proliferación, muerte y diferenciación
celular (Figura 1).1 Se ha postulado que para que
ocurra la evolución de la leucemia mieloide
aguda deben darse dos clases de mutaciones: las
que le confieren una ventaja proliferativa (clase
I) y las que bloquean el proceso de diferenciación celular (clase II; Figura 2).1,2 Este modelo
propuesto por Gillilland en 2001, conocido
como teoría de los dos “hits”, supone que la
mayor parte de las leucemias agudas son la
consecuencia de al menos dos mutaciones.3-5 La
identificación de estas modificaciones genéticas
requiere tecnología y metodologías que no son
convencionales en los laboratorios de diagnóstico y para muchas de ellas aún no se conoce
su asociación con alguna característica clínica
de valor diagnóstico o pronóstico.
La citogenética clásica y molecular se ha utilizado tradicionalmente para la identificación de
algunas alteraciones genéticas asociadas con
leucemia mieloide aguda (traslocaciones, eliminaciones, inversiones, etc.), lo que ha permitido
estratificar a los pacientes con este padecimiento
en tres categorías de riesgo: favorable, intermedio y desfavorable. Así, los pacientes con t(8;21)
(q22;q22) [RUNX1/RUNX1T1], inv(16)(p13q22)
[CBFB/MYH11] y t(15;17)(q24;q21) [PML/RARA]
tienen un pronóstico favorable con buena respuesta al tratamiento y remisiones completas.
Por otra parte, los pacientes con t(9;11)(p22;q23)
[MLLT3/MLL] se consideran con pronóstico intermedio, y en los pacientes con t(6;9)(p23;q34)
[DEK/NUP214], inv(3)(q21q26) [RPN1/EVI1] y
t(1;22)(p13;q13) [RBM15/MKL1] el pronóstico
clínico es malo debido a la agresividad del padecimiento y la baja respuesta al tratamiento.6,7
Sin embargo, un grupo importante de pacientes
con diagnóstico de leucemia mieloide aguda
tienen un cariotipo normal; esto es, sin alteraciones cromosómicas evidentes. Estos pacientes
se clasifican con pronóstico intermedio, debido
a que clínicamente no se tiene un marcador de
referencia y su origen biológico aún es desconocido.
153
Revista de Hematología
Volumen 16, Núm. 2, abril-junio 2015
Clase I
Ventajas proliferativas
o de supervivencia
Clase II
Alteración de la diferenciación
hematopoyética y subsecuente
apoptosis
FLT3-ITD
FLT3-TKD
KIT
RAS
PTPN11
JAK2
PML-RARa
RUNX1-RUNX1T1
CBFβ-MYH11
Fusiones de MLL
C/EBPa
NPM1?
LMA
Figura 2. Modelo de interacción de las mutaciones
asociadas con la aparición de leucemia mieloide
aguda. Las mutaciones que confieren ventajas proliferativas se agrupan en la clase I y las que bloquean
el proceso de diferenciación se agrupan en la clase II.
Modificada de la referencia 43.
Figura 1. Esquema general del sistema de señalización
celular dependiente de un receptor.
Recientemente, con el desarrollo de metodologías de secuenciación masiva, se han
identificado nuevas mutaciones genéticas asociadas con la leucemia mieloide aguda. Algunos
de los genes identificados incluyen a: c-KIT,
FLT3, MLL, NPM1, C/EBPα, RAS, RUNX1, WT1,
BAALC, ERG, MN1, DNMT, TET2, IDH, ASXL1,
PTPN11 y CBL. De todos ellos destacan los
que afectan a los genes FLT3, NPM1 y CEBPα,
porque se han asociado con la respuesta al
tratamiento y el progreso de esta enfermedad,
principalmente de los pacientes con cariotipo
154
normal.2,6-8 En 2008, la Organización Mundial
de la Salud publicó la actualización de la clasificación de neoplasias mieloides; uno de los
principales cambios en esta revisión es la incorporación de las mutaciones en los genes NPM1
y C/EBPα como entidades dentro del grupo de
leucemia mieloide aguda con anormalidades
genéticas recurrentes. Las mutaciones en FLT3
no se incluyeron como entidad independiente
debido a que éstas se asocian con otros marcadores ya descritos. Sin embargo, su significado
no debe subestimarse debido a que su identificación es especialmente valiosa en pacientes
con cariotipo normal u otra anormalidad genética recurrente debido a que puede establecer
el pronóstico de la leucemia.7
Debido a la importancia que han adquirido estos
tres marcadores genéticos en el diagnóstico y
pronóstico de la leucemia mieloide aguda, en
este trabajo se revisan los datos más relevantes
de las mutaciones en los genes FLT3 (FLT3-ITD y
FLT3-TKD), NPM1 y las que afectan a C/EBPα; se
hace hincapié en su participación en la aparición
de la neoplasia y su utilidad clínica.
Lagunas-Rangel FA y col. FLT3, NPM1 y C/EBPα como marcadores de pronóstico
FLT3
Estructura y función
El gen FLT3 (FMS-like tyrosine kinase 3) codifica
para un receptor tipo tirosina cinasa (RTK) de
clase III, que está relacionado estructuralmente
con FMS, KIT, PDGFRα y PDGFRβ debido a que
posee cinco dominios tipo inmunoglobulina
en la región extracelular, una única secuencia
transmembrana e intracelularmente una corta región yuxtamembrana seguida por dos dominios
cinasa separados por un sitio de inserción de la
enzima cinasa (Figura 3).9-11
La identificación del gen en murinos fue realizada independientemente por dos grupos
utilizando diferentes estrategias de clonación
en células madre hematopoyéticas de hígado
fetal y placenta. El gen humano FLT3 se clonó
poco después a partir de células CD34+. Este
gen se localiza en el cromosoma 13q12 y originalmente se pensó que contenía 21 exones
similar a la relación intrón-exón de KIT, pero
en realidad posee 24 exones, donde los tres
primeros dominios inmunoglobulina extracelulares están codificados por ocho exones
comparado con cinco exones para el caso de
KIT.9-14
Figura 3. Mutaciones en el gen FLT3 relevantes en la leucemia mieloide aguda. A. El gen FLT3 posee 24 exones,
en el exón 1 se localiza la secuencia señal de inicio de la transcripción (blanco); los exones 2 al 12 codifican los
dominios tipo inmunoglobulina (verde); los exones 13 y 14 codifican principalmente la región transmembrana
y yuxtamembrana (azul), respectivamente. Los dos dominios cinasa (rojo) están codificados por los exones 15
a 17 y 19 a 22, separados por el sitio de inserción codificado por el exón 18. Finalmente, el extremo C terminal
(morado) es codificado por los últimos dos exones. B. La proteína FLT3 es un receptor tirosina cinasa de clase
III. La mutación FLT3-ITD ocurre en la región yuxtamembrana, eliminando el impedimento estérico que normalmente bloquea la dimerización, mientras que FLT3-TKD estabiliza la forma activa de la proteína. Los sitios
donde ocurren las mutaciones FLT3-ITD y TKD se detallan con estrellas. Modificada de las referencias 18 y 44.
155
Revista de Hematología
La proteína FLT3 contiene 993 aminoácidos, con
una homología de 85% al compararla con la
proteína de ratón. Tiene dos isoformas, la primera
de 158 a 160 kDa, unida a la membrana celular
y modificada postraduccionalmente por glicosilación, y la segunda de 130 a 143 kDa, que no
se asocia con la membrana celular y tampoco es
glicosilada. La proteína FLT3 se expresa principalmente en precursores tempranos mieloides y
linfoides CD34+, aunque también se ha encontrado en otros órganos linfo-hematopoyéticos,
como el hígado, el bazo, el timo y la placenta, así
como en las gónadas y el cerebro. La expresión
de FLT3 se pierde gradualmente a medida que
avanza el proceso de diferenciación celular.9,10,12
FLT3 normalmente reside en la membrana celular
de manera monomérica, con una configuración
que impide su activación. Al unirse FLT3 a su
ligando específico (FL) se produce un cambio
conformacional que permite la dimerización y
autofosforilación en trans de varios residuos de
tirosina en el dominio intracelular, creando sitios
de acoplamiento para proteínas transductoras
como SHC, GRB2, VAC, GAB2, SHIP, CBL y
CBLB, que activan diversas vías de señalización
celular. La cascada de señalización involucra la
fosforilación y activación de múltiples mediadores
secundarios incluyendo PI3K, PLCγ, MAPK y RAS.
La actividad de FLT3 es altamente dependiente
del tipo celular y otros factores de crecimiento
que actúan sinérgicamente en la célula; ejemplos
son la IL-3, el G-CSF, el GM-CSF, la EPO y KIT
que producen en colaboración con FLT3 una
vigorosa respuesta proliferativa. La activación de
FLT3 juega un papel crítico en la hematopoyesis
y el crecimiento celular, debido a que regula
diversos procesos celulares como proliferación,
diferenciación y apoptosis celular.2,9,15
Los principales mecanismos autoinhibitorios en
FLT3, que permiten su actividad únicamente al
unirse a su ligando, son los dominios de cinasa
N y C terminal (bilobal kinase fold), el “loop”
156
Volumen 16, Núm. 2, abril-junio 2015
de activación y el dominio yuxtamembrana.
El dominio cinasa N y C terminal se doblan en
dirección opuesta, permitiendo que los residuos
catalíticos clave de ambos dominios se alineen
únicamente después del cambio conformacional
que desencadena la unión al ligando. El loop de
activación muestra varios residuos tirosina que
modifican su conformación al fosforilarse, de
una estructura cerrada a una estructura abierta
que permite el paso de los sustratos y el ATP. Por
otra parte, la región yuxtamembrana estabiliza
la conformación autoinhibida mediante diversas
interacciones no covalentes de la cinasa; por esta
razón, al modificar la estructura con el ligando
se induce la fosforilación de diversos residuos
tirosina conservados que eliminan estas uniones
e inducen la activación de la proteína.14,16-18
Recientemente se describieron diversas mutaciones en el gen FLT3 en pacientes con leucemia
linfoblástica aguda (LLA, 1 a 3% de los pacientes), síndromes mielodisplásicos (SMD, 5 a 10%)
y leucemia mieloide aguda (LMA, 15 a 35 %),
haciendo de FLT3 uno de los genes más frecuentemente mutados en neoplasias hematológicas.9
Notablemente FLT3 es sobreexpresado en 70 a
90% de los pacientes con leucemia mieloide
aguda y linfoblástica aguda, y una tercera parte
de los pacientes con leucemia mieloide aguda
tienen alguna mutación en FLT3. Los pacientes
con leucemia linfoblástica aguda con alguna
translocación que involucra el gen MLL tienen
un perfil genético único que se distingue por la
sobreexpresión de FLT3. De acuerdo con la hipótesis de los dos “hits”, las mutaciones en FLT3
pueden cooperar funcionalmente con otras mutaciones genéticas para inducir la transformación
leucémica. Dos distintas clases de mutaciones
se han identificado en pacientes con leucemia
mieloide aguda que involucran la activación
constitutiva de FLT3, una en la región yuxtamembrana y otra dentro del “loop” de activación en el
dominio tirosina cinasa, denominadas FLT3-ITD
y FLT3-TKD, respectivamente.2,9
Lagunas-Rangel FA y col. FLT3, NPM1 y C/EBPα como marcadores de pronóstico
Mutaciones en FLT3
FLT3-ITD. La mutación más común en FLT3
involucra una duplicación genética en tándem
interna (ITD) entre los exones 14 y 15 correspondientes al dominio yuxtamembrana, que varía
en longitud y posición de paciente a paciente.9
FLT3-ITD se describió por primera vez en 1996
cuando al realizar la detección sistemática de la
expresión de FLT3 en pacientes con leucemia,
se identificaron por PCR productos de amplificación más grandes de lo esperado.19 La mutación
FLT3-ITD ocurre cuando un fragmento de la
secuencia que codifica el dominio yuxtamembrana se duplica y se inserta. La longitud del ITD
varía de 3 a 400 pb, siendo siempre un múltiplo
de tres nucleótidos, por lo que se preserva el
marco de lectura. Los grupos de Meshinchi y
Kayser reportaron de manera independiente que
el promedio de los amplificados es de 59 pb,
involucrando la duplicación de al menos uno
de los siete residuos del codón 591 a 597; este
último es el más común. En algunos casos es
posible identificar más de cinco diferentes clonas
con diferente número de repetidos, puntos de
inserción y relaciones alélicas. La causa de la
duplicación aún no se conoce; sin embargo, se
sugiere que durante la replicación del ADN, una
secuencia palindrómica en la cadena retrasada
forma una estructura en horquilla, que permite
la duplicación, aunado a una falla general en
los mecanismos de reparación por mismatch.
Otras teorías sugieren un defecto en el proceso
de reparación slippage, posterior a la ruptura
simultánea de la cadena líder y retrasada.11,17,20-22
Se ha sugerido que el cambio conformacional
ocasionado por el segmento de la duplicación
de FLT3-ITD es responsable de eliminar el impedimento estérico que normalmente bloquea la
dimerización sin estimulación del ligando, exponiendo así diversos sitios dentro de los dominios
tirosina cinasa que inducen su autofosforilación.
Los experimentos en modelos de trasplante de
médula ósea en ratón indican que FLT3-ITD es
suficiente para promover un cambio fenotípico
asociado con proliferación aumentada, pero
es insuficiente para inducir leucemia aguda
manifiesta.2,9,15
La incidencia de la mutación FLT3-ITD se
correlaciona con la edad de los pacientes
con leucemia mieloide aguda; en pacientes
pediátricos menores de 10 años ocurre en 5 a
16% de los casos, con aumento significativo
en pacientes mayores de 10 años. En pacientes
adultos se reporta una incidencia de 25 a 35%,
sin incremento con la edad. El efecto más significativo de esta mutación es su asociación con
altas cuentas blásticas, incremento del riesgo
de recaída y disminución de la supervivencia.
Diversos grupos reportaron que FLT3-ITD es
uno de los principales marcadores de riesgo
debido a que predice un resultado adverso. Las
mutaciones FLT3-ITD se han correlacionado con
ciertos subgrupos citogenéticos; son especialmente frecuentes en pacientes con un cariotipo
normal. Se ha reportado que 30 a 50% de los
pacientes con leucemia aguda promielocítica
con t(15;17) (q22;q12) [PML-RARA] también
tienen alguna mutación en FLT3. Asimismo, se
ha reportado una asociación frecuente con la
t(6;9)(p23;q34) [DEK-NUP214] (~90%). Otras
mutaciones asociadas con FLT3-ITD ocurren
en NPM1 y DNMT3a. Estudios retrospectivos
sugieren que la existencia de mutaciones en
NPM1 pueden disminuir el pronóstico negativo
de FLT3-ITD, sólo si la relación alélica de este
último es baja.9,15,20,23
En contraste con la proteína FLT3 normal, FLT3ITD activa la vía STAT5 significativamente. La
existencia de regiones fosforiladas en la región
yuxtamembrana de FLT3-ITD permite que interactúe con proteínas proximales del retículo
endoplásmico y el aparato de Golgi, lo que
inhibe su procesamiento por las enzimas de
estos complejos, resultando en la retención
157
Revista de Hematología
del receptor en el citoplasma y aumentando el
tiempo de exposición a sustratos como STAT5.
La proteína STAT5 induce la expresión de
genes como la ciclina D1, c-MYC y p21, que
son importantes reguladores de la proliferación celular. Por otra parte, las proteínas Pu.1
y CEBPα, involucradas en la regulación de la
diferenciación en células hematopoyéticas, son
significativamente reprimidas por FLT3-ITD, lo
que sugiere su contribución en el bloqueo de
la diferenciación. Además, se ha reportado que
FLT3-ITD inicia un ciclo de inestabilidad genómica, incrementando las especies reactivas de
oxígeno (ROS) que favorecen fenómenos como
el rompimiento de la doble cadena de ADN y
errores en la reparación.2,9,15,18,20,24
FLT3-ITD se encuentra con más frecuencia de
forma heterocigota y se ha observado que la relación alélica (FLT3-ITD/FLT3) determina en gran
medida el pronóstico clínico en pacientes con
esta mutación. Varios estudios han indicado que
los valores altos de relación alélica tienen peor
pronóstico clínico, debido a que la existencia
de la proteína FLT3 normal interfiere y bloquea
la señalización aberrante de FLT3-ITD. Se ha
propuesto que la pérdida de la heterocigocidad
(LOH) puede deberse a la recombinación homóloga del alelo FLT3-ITD, creando más copias del
alelo mutado que del normal, lo que implica un
alto riesgo de recaída y muerte.15,24
Stirewalt y su grupo reportaron que los diferentes
tamaños del ITD en el gen FLT3 tienen un importante efecto en el tratamiento y supervivencia.
Los pacientes con fragmentos largos del ITD (≥40
pb) tuvieron peor respuesta al tratamiento que
aquéllos con fragmentos pequeños (<40 pb), lo
que a su vez disminuye el tiempo de supervivencia. Sin embargo, estos resultados contrastan
con otros reportes en los que no se observa una
asociación; se necesitan más estudios antes de
definir una conclusión que pueda ser trasladada
al manejo clínico de estos pacientes.25-27
158
Volumen 16, Núm. 2, abril-junio 2015
Existen diversos métodos experimentales para
detectar la mutación FLT3-ITD; la más utilizada
es mediante electroforesis en geles de agarosa
o poliacrilamida de los productos de PCR generados de la amplificación de los exones 14
y 15. Por lo general, las muestras utilizadas son
médula ósea o sangre periférica, de las que indistintamente se realiza la extracción de ácidos
nucleicos (ADN o ARN). Libura y colaboradores
reportaron que el uso de cDNA, obtenido a
partir de ARN, es una a dos escalas logarítmicas más sensible que el ADN. Se sugiere que
esta diferencia se debe a que al utilizar ARN
se realizan dos amplificaciones: la primera en
la transcripción reversa para obtener el cDNA,
y la segunda en la reacción de PCR, lo que no
ocurre al utilizar ADN, pudiendo así detectar
concentraciones más bajas de FLT3-ITD. La
relación alélica se puede determinar utilizando
marcadores fluorescentes que se unen al ADN,
así los productos de PCR se separan de acuerdo
con su tamaño mediante electroforesis capilar
y se mide la abundancia de cada fragmento por
la intensidad de la fluorescencia después de
producir la excitación del fluoróforo con láser.9,28
FLT3-TKD. El segundo tipo de mutación en FLT3
son mutaciones puntuales “missense” en el
exón 20 del loop de activación en el dominio
tirosina cinasa (TKD). La mutación FLT3-TKD
se ha encontrado en células malignas de pacientes con leucemia mieloide crónica (1%),
leucemia linfoblástica aguda (1-3%), síndromes
mielodisplásicos (2-5%) y leucemia mieloide
aguda (5-10%). Casi todas estas mutaciones
involucran la sustitución de un aspartato por
una tirosina en el codón 835 (D835Y) por
una mutación puntual (GAT→TAT). El aspartato en la posición 835 pertenece al dominio
DFG (aspartato-fenilalanina-glicina) del loop
de activación, que juega un papel crítico en
la prevención de la unión del ATP, pudiendo
adoptar una forma cerrada (inactivo) o abierta
(activo). Estas mutaciones producen un cambio
Lagunas-Rangel FA y col. FLT3, NPM1 y C/EBPα como marcadores de pronóstico
conformacional en la proteína, perturbando el
equilibrio energético requerido para estabilizar
la forma cerrada y eliminando su función autoinhibitoria que provoca su activación constitutiva.
También se han identificado otras sustituciones,
eliminaciones e inserciones dentro de este codón
y otros aledaños. A diferencia de la mutación
ITD, FLT3-TKD no se asocia con altas cuentas
blásticas, lo que implica un pronóstico no tan
adverso. En modelos animales se ha demostrado
que mientras FLT3-ITD provoca inicialmente la
evolución de un trastorno mieloproliferativo,
FLT3-TKD induce el desarrollo de una alteración
linfoide. Un solo paciente puede ocasionalmente
tener ambas mutaciones, ITD y TKD en FLT3; sin
embargo, la mayoría de los pacientes tiene un
solo tipo de mutación.2,15,16
FLT3-TKD se identifica fácilmente debido a que
resulta en la pérdida de un sitio de reconocimiento de la enzima de restricción EcoRV, pudiendo
así digerir un producto de PCR por amplificación
de esta región mediante un análisis tipo RFLP o,
bien, confirmando el cambio puntual mediante
secuenciación de ADN.11
NPM1
Estructura y función
NPM1 (nucleophosmin) es una proteína que
originalmente se identificó como fosfoproteína
expresada a concentraciones altas en la región
granular del nucléolo. Posteriormente, basados
en la observación de que su expresión rápidamente aumentaba en respuesta a estímulos
mitóticos y su elevada concentración en células
proliferantes y malignas, se pensó que tenía un
papel importante en la regulación del crecimiento, proliferación y transformación celular.
Sin embargo, a medida que el conocimiento
de esta multifuncional proteína ha aumentado, se ha relacionado en muchos procesos
celulares.29,30
NPM1 existe como oligómero en dos formas
alternativas, designadas como B23.1 y B23.2,
que comparten 255 residuos en el extremo N
terminal, mientras que los últimos 35 aminoácidos del extremo C terminal de B23.1 están
ausentes en B23.2. La isoforma B23.1 es casi
exclusimente nucleolar, mientras que B23.2 se
localiza en el nucléolo y en el nucleoplasma.
La isoforma B23.1 contiene 294 aminoácidos
y tiene un peso aproximado de 37 kDa, tiene
diversos dominios, iniciando con el extremo N
terminal que contiene un segmento hidrofóbico
implicado en la oligomerización y en la función
como chaperona; le continúan dos dominios
ácidos (ricos en ácido aspártico y glutámico)
importantes en la unión a las histonas, que se
encuentran separados por una región asociada
con la actividad ribonucleasa. Esta región, al
igual que el extremo C terminal, contiene regiones alcalinas involucradas con la unión a ácidos
nucleicos. Las porciones alcalinas son seguidas
por una región aromática, que contiene dos
residuos triptófano (W288 y W290) requeridos
para la localización nucleolar de la proteína.
Además, incluye una señal bipartita de localización nuclear (NLS), una señal de exportación
nuclear (NES) rica en leucina y diversos sitios de
fosforilación que regulan su asociación con los
centrosomas y compartimentos subnucleolares.
El gen NPM1 contiene 12 exones y se encuentra
localizado en el cromosoma 5q35. La isoforma
B23.1 es codificada por los exones 1 al 9, 11 y
12, mientras que la isoforma B23.2 solamente
contiene los exones 1 al 10 (Figura 4).29,31
La sobreexpresión de NPM1 promueve la
supervivencia y recuperación celular frente a
condiciones de estrés, mientras que la deficiencia bloquea la traducción proteica y detiene el
ciclo celular. La expresión de NPM1 disminuye
con la diferenciación celular.30
NPM1 reside principalmente en el nucléolo,
aunque se transporta rápidamente entre el nú-
159
Revista de Hematología
A
Exón
2
3
4
5
6
7
8
9
10
12
3´
GAGGCTATTCAAGATCTCTG----GCAGTGGAGGAAGTCTCTTTAAGAAAATAG
GAGGCTATTCAAGATCTCTCTCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG
GAGGCTATTCAAGATCTCTGCATGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG
GAGGCTATTCAAGATCTCTGCCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG
NuLS
Grupo alcalino
Región moderadamente alcalina
Región aromática (única en B23.1)
NLS
Dominio ácido
NES
Dominio N terminal no polar
Región central
NLS
Normal
Variante A
Variane B
Variane D
1
Dominio ácido
5´
B
Volumen 16, Núm. 2, abril-junio 2015
C
N
Oligomerización
Chaperona molecular
Unión a histonas
Unión a ADN/ARN
Actividad ribonucleasa
Figura 4. Mutaciones en el gen NPM1. A. El gen NPM1 posee 12 exones, los exones 1 al 3 codifican el extremo
N terminal donde se localiza la señal de exportación nuclear; el exón 4 contiene un dominio de unión a metales
(MB). El segmento entre los exones 5 y 7 codifica los dos dominios ácidos y la región de separación, la otra
parte del exón 7 y el exón 8 presentan la señal de localización nuclear. Los exones 9 a 12 codifican el extremo
C terminal, que contiene la señal de localización nucleolar. Las principales mutaciones asociadas con leucemia
mieloide aguda ocurren dentro del exón 12, principalmente las variantes A, B y D. B. La proteína NPM1 es una
histona chaperona nucleolar, las mutaciones descritas modifican la señal de localización nucleolar permitiendo
que permanezca mayor tiempo dentro del citoplasma. El sitio de mutación se detalla con una estrella.
NES: señal de exportación nuclear; NLS: señal de localización nuclear; NuLS: señal de localización nucleolar.
Modificada de la referencia 29.
cleo y el citoplasma, por lo que forma parte de
diversos procesos celulares que incluyen el transporte de partículas pre-ribosomales y biogénesis
de los ribosomas, respuesta contra estímulos
estresantes como radiación UV e hipoxia, mantenimiento de la estabilidad genómica a través del
control de la ploidía celular y la participación en
procesos de reparación del ADN, la regulación
de la transcripción a través del moldeamiento de
los eventos de condensación y descondensación
160
de la cromatina, previene la agregación proteica
en el nucléolo y participa en la regulación de la
actividad y estabilidad de supresores tumorales
decisivos como p53 y ARF. En realidad, NPM1
funciona como histona chaperona, capaz de
realizar el ensamblaje de histonas y del nucleosoma, así como promover un incremento de la
acetilación dependiente de la transcripción. Los
dominios ácidos de NPM1 sirven como sitios
de unión de proteínas ribosomales alcalinas,
Lagunas-Rangel FA y col. FLT3, NPM1 y C/EBPα como marcadores de pronóstico
minimizando interacciones no específicas entre
proteínas ribosomales y rRNA durante el ensamblaje ribosomal en el nucléolo.29,32 A través de sus
dominios, NPM1 es capaz de unirse a distintas
proteínas en diferentes compartimentos celulares, incluidos factores nucleolares (nucleolina,
fibrilarina y snoRNPs), factores de transcripción
(IRF1, YY1 y NF-κB, histonas H2B, H3 y H4),
proteínas involucradas en la proliferación celular
(ADN polimerasa α), mitosis (NUMA, NEK2A)
y respuesta al estrés oncogénico (ARF y p53),
directamente con el ADN y ARN. Además, se
ha reportado que NPM1 tiene actividad de endorribonucleasa en el rRNA y forma complejos
con segundos mensajeros como PIP3 en respuesta a factores antiapoptósicos (inhibiendo la
ruptura del ADN por la caspasa CAD y p53).29,31
Asimismo, NPM1 está frecuentemente sobreexpresada en tumores sólidos de diversos orígenes
histológicos, está implicada en traslocaciones
cromosómicas o eliminaciones en varios tipos de
malignidades hematológicas y tumores sólidos.
De manera sorprendente, se ha encontrado que
una alta proporción de pacientes con leucemia
mieloide aguda (~35%) tienen mutaciones o
una localización aberrante de NPM1, lo que
hace al gen NPM1 uno de los mutados con más
frecuencia en esta enfermedad.29
Mutaciones en NPM1
La mutación más común en NPM1 se localiza
en el exón 12, que se manifiesta en 35% de los
casos de leucemia mieloide aguda de novo. Las
mutaciones en el gen NPM1 son consistentemente heterocigotas, ocurren principalmente
en el exón 12, con algunas pocas excepciones
reportadas en los exones 11 y 9. El 86% de los
pacientes con mutaciones en NPM1 tienen un
cariotipo normal, el otro 14% tiene anormalidades cromosómicas probablemente secundarias.
Se han descrito aproximadamente 50 variantes
genéticas; sin embargo, en 95% de los casos
ocurren en la posición del nucleótido 960; la
mutación más común es la duplicación de los
nucleótidos TCTG en las posiciones 956 a 959
que es conocida como variante A. Las variantes
B y D se observan en 10 y 5% de los casos,
respectivamente, todas las demás variantes
son especialmente raras. Independientemente
de la variante de la mutación, todas generan
modificaciones en el extremo C terminal de la
proteína.31,33,34
En condiciones normales, la importación nuclear
de NPM1 predomina sobre la exportación, lo
que explica su mayor concentración en el nucléolo. Una de las características distintivas de
las mutaciones en NPM1 es su sobreexpresión
en el citoplasma de células leucémicas con leucemia mieloide aguda (NPM1c+); esto se debe
a dos alteraciones en el extremo C terminal: la
primera es la generación de un dominio de exportación nuclear adicional rico en leucina, que
aumenta el transporte dependiente de CRM1 y,
segundo, la pérdida de los residuos aromáticos
288 y 290 que son decisivos para la localización
nucleolar.31,33,34
Las mutaciones en NPM1 son muy estables,
generalmente la pérdida de la mutación se
asocia con el cambio de cariotipo, de normal a
anormal; por esta razón algunos autores (Gorello
y su grupo y Chou y colaboradores) sugieren el
uso de NPM1 como marcador para vigilar la
enfermedad mínima residual en pacientes con
cariotipo normal. La existencia de NPM1 se correlaciona significativamente con la de FLT3-ITD,
lo que sugiere que las mutaciones en NPM1 son
eventos primarios que preceden a la adquisición
de FLT3. En contraste, las mutaciones en tándem
dentro del gen MLL son usualmente excluyentes
con NPM1.30,33-36
La incidencia en las mutaciones en NPM1 se
incrementa con la edad, se manifiesta en 2.1 a
6.5% en pacientes pediátricos y en 25 a 35%
en pacientes adultos; sin embargo, las variantes
menos comunes ocurren principalmente en niños y adultos jóvenes. Notablemente, 80 a 90%
161
Revista de Hematología
de los pacientes con leucemia mielomonocítica
aguda y leucemia monocítica tienen mutaciones
en NPM1. Los casos con NPM1c+ tienen mayor
cuenta blástica y elevado número de plaquetas;
sin embargo, la mutación en NPM1, en ausencia de FLT3 ITD, se asocia con buena respuesta
al tratamiento y supervivencia a cinco años en
60% de los pacientes, lo que resalta el valor
de la identificación molecular para establecer
una estratificación de riesgo en pacientes con
cariotipo normal. La coexistencia de FLT3-ITD y
NPM1 se asocia con mal pronóstico clínico; sin
embargo, estos pacientes tienen mejor respuesta
que los pacientes NPM1 negativos y FLT3-ITD
positivos.27,30
Estructura y función
de la señalización celular desencadenada por
rapamicina y la proteína cinasa R de la siguiente
manera: bajo condiciones de crecimiento favorables, los factores de iniciación de la transcripción
elF2α y elF4E incrementan su actividad, posiblemente a través del incremento de la actividad de
c-MYC; a su vez, éstas actúan promoviendo la
transcripción de p30 que desencadena el proceso de proliferación celular. De la misma manera,
cuando existen bajas concentraciones de elF2α
y elF4E, se promueve la transcripción de p42,
que induce diferenciación celular. Las funciones
de la isoforma p30 aún no son bien conocidas;
sin embargo, Pabst y su grupo demostraron que
esta isoforma ha perdido las funciones normales
de C/EBPα y tiene un efecto negativo en la variante de 42 kDa. C/EBPα tiene cuatro dominios
principales, el extremo C terminal contiene una
estructura de cremallera de leucina (bZIP) que
media la homo y heterodimerización, así como
las interacciones proteína-proteína con otros
factores de transcripción (GATA, PU.1, ETS y
RUNX1) y factores de crecimiento (c-JUN y E2F),
un dominio de unión al ADN (DBD) de carácter
alcalino cargado positivamente, capaz de unirse
a secuencias específicas del ADN y, por último,
dos elementos de regulación y transactivación,
denominados TAD1 y TAD (Figura 5).37,38
El gen C/EBPa (CCAAT/enhancer-binding protein
α) codifica para dos proteínas que pertenecen a
la familia de proteínas potenciadoras de la unión
a la secuencia CCAAT, que están implicadas
en el equilibrio entre proliferación celular y
diferenciación terminal. Este gen se sitúa en el
cromosoma 19q13.1 y posee un único exón sin
tener intrones. C/EBPα da lugar a dos diferentes
transcritos, usando dos diferentes secuencias de
inicio AUG dentro del mismo marco de lectura;
la primera secuencia de inicio codifica una isoforma de 42 kDa (p42), mientras que la segunda
secuencia de inicio codifica otra isoforma de 30
kDa (p30), que pierde los primeros 118 aminoácidos, incluido el dominio funcional TAD1. Las
células regulan la relación de p42/p30 a través
C/EBPα actúa como factor de transcripción, con
un papel determinante durante la diferenciación
de varios tipos celulares, que incluyen hepatocitos, adipocitos, enterocitos, queratinocitos,
células pulmonares, células de glándula mamaria y células hematopoyéticas. Asimismo, juega
un papel fundamental en estados tempranos de
la diferenciación mieloide y es particularmente
expresado en células mielomonocíticas y específicamente es altamente regulada durante
la diferenciación granulocítica.37,39 La isoforma
p42 activa directamente promotores de linaje
específico y tiene contacto con el aparato de
transcripción basal (TBP/TFIIB), actúa sobre acetiltransferasas de histonas (CBP/p300) y recluta
el complejo de remodelamiento de la croma-
Las mutaciones en NPM1 son fácilmente identificadas por secuenciación y PCR alelo específico
o, bien, con la observación de NPM1c+ mediante
inmunohistoquímica. La inmunohistoquímica es
la primera opción para la detección de NPM1c+,
mientras que las pruebas de biología molecular
permiten la detección y vigilancia de la enfermedad mínima residual.30
C/EBPα
162
Volumen 16, Núm. 2, abril-junio 2015
Lagunas-Rangel FA y col. FLT3, NPM1 y C/EBPα como marcadores de pronóstico
118 aa
C/EBPa p30
p21
N TAD2
DBD
bZIP
Represión de E2F SWI/SNF
DNA Dimerización
TBP/TFIIB
CDK2/CDK4
E2F, GATA1,
CBP/p300
ETS1, PU.1,
c-JUN, RUNX1
C/EBPa
N
p42
TAD1
R1
TAD2
DBD
R2
R3
Región frecuentemente
afectada
Mutaciones que impiden
la transcripción
de p42
C
bZIP
R4
R5
Región frecuentemente
afectada
Mutaciones que alteran la
unión al ADN
Figura 5. Mutaciones en C/EBPα. C/EBPα posee dos
isoformas diferentes p30 y p42 que difieren en los
primeros 118 aminoácidos. p42 tiene cuatro dominios
principales, una estructura de cremallera de leucina
(bZIP), un dominio de unión al ADN (DBD) y, por
último, dos elementos de regulación y transactivación
denominados TAD1 y TAD2; este último no aparece
en p30. Las mutaciones dentro de C/EBPα se dividen
en cinco regiones (R1 a R5), R1 y R4 son las más
frecuentes.
Modificada de la referencia 37.
tina (SWI/SNF). Por otra parte, p30 promueve
diferenciación de adipocitos, pero previene la
diferenciación terminal y produce arresto del
ciclo celular.40 C/EBPα posee múltiples acciones
como la regulación negativa de la expresión de
c-MYC que permite la diferenciación, regulación
directa de la expresión de genes específicos de
linaje mieloide y acción sinérgica con otros genes clave en el desarrollo mieloide, incluido el
complejo de genes CBF y PU.1. Las principales
asociaciones de C/EBPα ocurren con p21, CDK2,
CDK4 y E2F. La represión de E2F, dependiente
de la transcripción de genes por C/EBPα, es un
evento crítico en la supresión de la proliferación
celular y también induciendo la diferenciación
granulocítica. C/EBPα también inhibe la proliferación celular por activar la transcripción de
p21/WAF1, estabilizar a p21 e inactivar a CDK2
y CDK4. La fuerte implicación de C/EBPα en la
diferenciación granulocítica apunta a que es un
blanco clave en la leucemogénesis; recientemente se reportaron tres mecanismos de inactivación:
el primero es la regulación negativa de su transcripción debido a la expresión del gen de fusión
RUNX1/RUNX1T1en la t(8;21), el segundo
mecanismo es la inhibición de la traducción del
mRNA por interacción con hnRNPE2 inducido
por la proteína de fusión BCR-ABL1, lo que
contribuye a la transición de la fase crónica a la
crisis blástica por bloqueo de la diferenciación,
y finalmente, el tercer mecanismo es por mutaciones inactivantes, especialmente en leucemia
mieloide aguda.37
Mutaciones en C/EBPα
El gen C/EBPα está mutado en aproximadamente 6 a 15% de los casos de leucemia mieloide
aguda de novo y en 15 a 18% de los pacientes
con cariotipo normal, sin asociación con la
edad. Esta mutación ocurre principalmente en
los subtipos M1 y M2 (según la FAB) donde se
observa en 20% de los pacientes; sin embargo,
los pacientes con t(8;21), inv(16) y t(15;17) no
tienen la mutación. Los pacientes con mutaciones en C/EBPα tienen concentraciones altas
de hemoglobina, bajas cuentas plaquetarias,
altas cuentas blásticas y difícilmente tienen
linfadenopatías o leucemia extramedular comparados con pacientes sin mutaciones en C/
EBPα. Las mutaciones descritas corresponden
a mutaciones puntuales que pueden impedir la
transcripción de p42, permitiendo la sobreexpresión de p30 o, bien, afectar la región de
cremallera de leucina y el DBD, provocando que
la estructura de este dominio se modifique e impidiendo así la unión adecuada al surco mayor
del ADN. La mayoría de los pacientes tiene más
de una mutación en C/EBPα, el escenario más
frecuente es la combinación de dos mutaciones
en alelos diferentes, una mutación en el dominio N terminal que bloquea la transcripción de
163
Revista de Hematología
p42 y otra en el bZIP que altera la unión con
el ADN, su dimerización o su interacción con
otras proteínas. Hasta ahora se han reportado
146 mutaciones distintas en C/EBPα, de las que
cinco son mutaciones missense, 54 corresponden a adiciones o eliminaciones que modifican
el marco de lectura y 78 son mutaciones nonsense; además se incluyen nueve mutaciones
silenciosas sin efecto transcripcional. Todas
estas mutaciones ocurren en cinco regiones de
la proteína (R1 a R5), donde R1 corresponde a
los aminoácidos situados antes del TAD1, R2
se sitúa en la región entre TAD1 y TAD2, R3
concierne la región anterior al DBD y la parte
N terminal de este dominio, R4 corresponde a
los aminoácidos en la zona C terminal del DBD
y el N terminal de la región con estructura de
cremallera de leucina y finalmente R5 lo conforman los aminoácidos del extremo C terminal
de la estructura de cremallera. Las mutaciones
en C/EBPα ocurren principalmente en R1 y R4
con 76% de las mutaciones no silenciosas; sin
embargo, la distribución entre estas dos regiones
es heterogénea. De manera interesante, casi todas las mutaciones nonsense (65 de 78) ocurren
en la región 5’ del segundo codón de inicio, lo
que permite que se aumente la transcripción de
la isoforma 30 kDa.6,37,40-42
Las mutaciones en C/EBPα presentes en pacientes que muestran un cariotipo normal se
asocian con un pronóstico favorable similar
al que ocurre con inv(16)(p13q22) o t(8;21)
(q22;q22). La razón del porqué C/EBPα confiere buen pronóstico aún no se conoce; sin
embargo, recientemente se sugirió que sólo los
pacientes con la mutación doble tienen buen
pronóstico, mientras que los pacientes con
una mutación única no difieren de los que no
exhiben ninguna mutación. La coexistencia de
mutaciones en C/EBPα y FLT3-ITD ocurre en
22 a 33% de los casos; sin embargo, aún no es
claro si no existe un efecto o si éste es negativo
en el pronóstico de estos pacientes.39,41
164
Volumen 16, Núm. 2, abril-junio 2015
La identificación de las mutaciones dentro del
gen C/EBPα se realiza generalmente mediante
secuenciación directa del ADN obtenido de
células sanguíneas debido a la aleatoriedad con
que ocurren las mutaciones.
CONCLUSIONES
La leucemia mieloide aguda es la más común
de las leucemias mieloides con prevalencia de
3.8 casos por 100,000 habitantes, con aumento
en la población de 65 años o más hasta 17.9
casos por 100,000 habitantes. Cerca de 55%
de los pacientes con leucemia mieloide aguda
tiene algún tipo de anormalidad citogenética
que permite orientar el tratamiento y pronosticar su evolución en favorable, intermedia o
desfavorable. Sin embargo, en el otro 45% de
los pacientes, que tienen un cariotipo normal, el
pronóstico aún parece incierto.1 Recientemente,
el descubrimiento de mutaciones genéticas en
varios genes, como FLT3, NPM1, C/EBPα, KIT,
MLL, RAS, PTPN11 y CBL en pacientes con
cariotipo normal, ha abierto una ventana de
posibilidades para definir con mayor precisión la
naturaleza de esta enfermedad. En la actualidad,
la Organización Mundial de la Salud resaltó la
búsqueda intencionada de mutaciones en FLT3,
NPM1 y C/EBPα en todos los pacientes con leucemia mieloide aguda, pero principalmente en
los que tienen un cariotipo normal, para de esta
manera determinar el pronóstico y personalizar
más adecuadamente el tratamiento.
En el Cuadro 1 se simplifica la descripción de
las mutaciones más frecuentes en los genes FLT3,
NPM1 y C/EBPα en pacientes con leucemia
mieloide aguda. El gen FLT3 tiene dos mutaciones frecuentes asociadas con leucemia mieloide
aguda, denominadas FLT3-ITD y FLT3-TKD, que
afectan la región yuxtamembrana y el dominio
tirosina cinasa de la proteína, respectivamente.
La mutación FLT3-ITD es una duplicación en
tándem interna que ocurre entre los exones 14 y
Lagunas-Rangel FA y col. FLT3, NPM1 y C/EBPα como marcadores de pronóstico
Cuadro 1. Mutaciones frecuentes que afectan a FLT3, NPM1 y C/EBPα en pacientes con leucemia mieloide aguda
Gen
Mutaciones
frecuentes
Pronóstico
clínico
FLT3-ITD
Involucra una duplicación en tándem interna (ITD) entre los exones 14 y 15 en el Desfavorable
dominio yuxtamembrana. La longitud del ITD varía de 3 a 400 pb (múltiplo de tres
nucleótidos). El promedio de los amplificados es de 59 pb
Intermedio
FLT3-TKD
Mutaciones puntuales missense en el exón 20 del loop de activación en el dominio
tirosina cinasa (TKD). Casi todas estas mutaciones involucran la sustitución de un
aspartato por una tirosina en el codón 835 (D835Y), debido al cambio GAT→TAT
Duplicación de los nucleótidos TCTG en las posiciones 956 a 959 del exón 12
Adición de los nucleótidos CATG entre las posiciones 956 y 957 del exón 12
Adición de los nucleótidos CCTG entre las posiciones 956 y 957 del exón 12
Región situada antes del TAD1, pudiendo presentar adiciones, eliminaciones y mutaciones missense y nonsense. Principalmente en esta región ocurren mutaciones
nonsense que impiden la transcripción de la variante p42
Favorable
Favorable
Favorable
Favorable
Región C terminal del DBD y el N terminal del bZIP. Al igual que R1, puede presentar adiciones, eliminaciones y mutaciones missense y nonsense, que provocan una
alteración en la unión al ADN y otras proteínas.
Favorable
FLT3
NPM1
Descripción
Variante A
Variante B
Variante D
R1
C/EBPα
R4
Tomado de la referencia 7.
15. Se asocia con mal pronóstico clínico debido
a que induce cuentas blásticas altas, incremento
del riesgo de recaída y disminución de la supervivencia. FLT3-TKD generalmente es una mutación
“missense” que modifica el codón 835, cambiando un residuo aspartato por una tirosina (D835Y).
Su pronóstico se considera intermedio porque, a
diferencia de FLT3-ITD, los pacientes no tienen
manifestaciones clínicas adversas; sin embargo,
no tienen una respuesta óptima al tratamiento.
El gen NPM1 tiene varias mutaciones asociadas
con leucemia mieloide aguda dentro del exón
12, existen diferentes variantes; sin embargo, las
principales conllevan la duplicación en el caso
de la variante A y la adición de cuatro bases en el
caso de las variantes B y D entre los nucleótidos
956 y 957. Sólo la existencia de mutaciones en
NPM1 se asocia con un pronóstico favorable
en ausencia de FLT3-ITD. El gen C/EBPα codifica dos factores de transcripción con diferente
secuencia de inicio, p42 y p30. Las mutaciones
en este gen pueden ocurrir en cinco regiones
diferentes; sin embargo, las regiones R1 y R4 son
las afectadas con más frecuencia. Las mutaciones
en la región R1 afectan la transcripción de p42,
provocando la sobreexpresión de p30. Asimis-
mo, las mutaciones en la región R4 modifican
el bZIP y el dominio de unión al ADN alterando
su interacción con este último y con otras proteínas asociadas. Comúnmente, los pacientes
tienen ambas mutaciones en alelos diferentes y
se asocian con un pronóstico favorable.
REFERENCIAS
1. Estey E, Döhner H. Acute myeloid leukaemia. Lancet
2006;368:1894-1907. Available at: http://www.sciencedirect.com/science/article/pii/S0140673606697808.
Accessed August 29, 2014.
2. Takahashi S. Current findings for recurring mutations
in acute myeloid leukemia. J Hematol Oncol 2011;4:36.
doi:10.1186/1756-8722-4-36.
3. Deguchi K, Gilliland DG. Cooperativity between mutations
in tyrosine kinases and in hematopoietic transcription
factors in AML. Leukemia 2002;16:740-744. doi:10.1038/
sj.leu.2402500.
4. Becker H, Pfeifer D, Afonso JD, Nimer SD, et al. Two cell
lines of t(8;21) acute myeloid leukemia with activating KIT
exon 17 mutation: models for the “second hit” hypothesis.
Leukemia 2008;22:1792-1794. doi:10.1038/leu.2008.61.
5. Jordan CT. Unique molecular and cellular features of acute
myelogenous leukemia stem cells. Leukemia 2002;16:559562. doi:10.1038/sj.leu.2402446.
6. Martelli MP, Sportoletti P, Tiacci E, Martelli MF, Falini B.
Mutational landscape of AML with normal cytogenetics:
165
Revista de Hematología
biological and clinical implications. Blood Rev 2013;27:1322. doi:10.1016/j.blre.2012.11.001.
and acute myeloid leukemia. Stem Cells 2006;24:11741184. doi:10.1634/stemcells.2005-0519.
7. Swerdlow SH, Campo E, Harris NL, Jaffe ES, et al. WHO
Classification of Tumours of Haematopoietic and Lymphoid
Tissues. 4a ed. Lyon: International Agency for Research on
Cancer (IARC), 2008.
21. Kiyoi H, Towatari M, Yokota S, Hamaguchi M, et al. Internal
tandem duplication of the FLT3 gene is a novel modality of
elongation mutation which causes constitutive activation
of the product. Leukemia 1998;12:1333-1337.
8.
Rubnitz JE, Gibson B, Smith FO. Acute myeloid leukemia. Hematol Oncol Clin North Am 2010;24:35-63.
doi:10.1016/j.hoc.2009.11.008.
9. Stirewalt DL, Radich JP. The role of FLT3 in haematopoietic malignancies. Nat Rev Cancer 2003;3:650-665.
doi:10.1038/nrc1169.
22. Meshinchi S, Stirewalt DL, Alonzo TA, Boggon TJ, et al.
Structural and numerical variation of FLT3/ITD in pediatric AML. Blood 2008;111:4930-4933. doi:10.1182/
blood-2008-01-117770.
10. Small D. FLT3 mutations: biology and treatment. Hematology Am Soc Hematol Educ Program 2006:178-184.
doi:10.1182/asheducation-2006.1.178.
11. Levis M, Small D. FLT3: ITDoes matter in leukemia. Leukemia
2003;17:1738-1752. doi:10.1038/sj.leu.2403099.
12. Lyman SD, Jacobsen SE. c-kit ligand and Flt3 ligand: stem/
progenitor cell factors with overlapping yet distinct activities. Blood 1998;91:1101-1134. Available at: http://
bloodjournal.hematologylibrary.org/content/91/4/1101.
short. Accessed October 22, 2014.
13. Rosnet O, Matteï M-G, Marchetto S, Birnbaum D. Isolation
and chromosomal localization of a novel FMS-like tyrosine
kinase gene. Genomics 1991;9:380-385. doi:10.1016/08887543(91)90270-O.
14. Gilliland DG, Griffin JD. The roles of FLT3 in hematopoiesis
and leukemia. Blood 2002;100:1532-1542. doi:10.1182/
blood-2002-02-0492.
15. Meshinchi S, Appelbaum FR. Structural and functional
alterations of FLT3 in acute myeloid leukemia. Clin Cancer
Res 2009;15:4263-4269. doi:10.1158/1078-0432.CCR-081123.
16. Griffith J, Black J, Faerman C, Swenson L, et al. The structural basis for autoinhibition of FLT3 by the juxtamembrane
domain. Mol Cell 2004;13:169-178. doi:10.1016/S10972765(03)00505-7.
17. Kayser S, Schlenk RF, Londono MC, Breitenbuecher F, et al.
Insertion of FLT3 internal tandem duplication in the tyrosine kinase domain-1 is associated with resistance to chemotherapy and inferior outcome. Blood 2009;114:23862392. doi:10.1182/blood-2009-03-209999.
18. Chan PM. Differential signaling of Flt3 activating mutations
in acute myeloid leukemia: a working model. Protein Cell
2011;2:108-115. doi:10.1007/s13238-011-1020-7.
19. Nakao M, Yokota S, Iwai T, Kaneko H, et al. Internal tandem duplication of the flt3 gene found in acute myeloid
leukemia. Leukemia 1996;10:1911-1818. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/8946930. Accessed
October 31, 2014.
20. Parcells BW, Ikeda AK, Simms-Waldrip T, Moore TB, Sakamoto KM. FMS-like tyrosine kinase 3 in normal hematopoiesis
166
Volumen 16, Núm. 2, abril-junio 2015
23. Levis M. FLT3 mutations in acute myeloid leukemia: what is
the best approach in 2013? Hematology Am Soc Hematol
Educ Program 2013;2013:220-226. doi:10.1182/asheducation-2013.1.220.
24. Li L, Bailey E, Greenblatt S, Huso D, Small D. Loss of the
wild-type allele contributes to myeloid expansion and
disease aggressiveness in FLT3/ITD knockin mice. Blood
2011;118:4935-4945. doi:10.1182/blood-2011-01-328096.
25. Stirewalt DL, Kopecky KJ, Meshinchi S, Engel JH, et al. Size
of FLT3 internal tandem duplication has prognostic significance in patients with acute myeloid leukemia. Blood
2006;107:3724-3726.
26. Ponziani V, Gianfaldoni G, Mannelli F, Leoni F, et al. The size
of duplication does not add to the prognostic significance
of FLT3 internal tandem duplication in acute myeloid leukemia patients. Leukemia 2006;20:2074-2076. doi:10.1038/
sj.leu.2404368.
27. Gale RE, Green C, Allen C, Mead AJ, et al. The impact
of FLT3 internal tandem duplication mutant level, number, size, and interaction with NPM1 mutations in a
large cohort of young adult patients with acute myeloid
leukemia. Blood 2008;111:2776-2784. doi:10.1182/
blood-2007-08-109090.
28. Libura M, Asnafi V, Tu A, Delabesse E, et al. FLT3 and
MLL intragenic abnormalities in AML reflect a common
category of genotoxic stress. Blood 2003;102:2198-2204.
doi:10.1182/blood-2003-01-0162.
29. Grisendi S, Mecucci C, Falini B, Pandolfi PP. Nucleophosmin
and cancer. Nat Rev Cancer 2006;6:493-505. doi:10.1038/
nrc1885.
30. Falini B, Nicoletti I, Bolli N, Martelli MP, et al. Translocations
and mutations involving the nucleophosmin (NPM1) gene
in lymphomas and leukemias. Haematologica 2007;92:519532. Available at: http://www.ncbi.nlm.nih.gov/pubmed/17488663. Accessed November 19, 2014.
31. Falini B, Nicoletti I, Martelli MF, Mecucci C. Acute myeloid
leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+AML): biologic and clinical features. Blood
2007;109:874-885. doi:10.1182/blood-2006-07-012252.
32. Burgess RJ, Zhang Z. Histone chaperones in nucleosome assembly and human disease. Nat Struct Mol Biol
2013;20:14-22. doi:10.1038/nsmb.2461.
Lagunas-Rangel FA y col. FLT3, NPM1 y C/EBPα como marcadores de pronóstico
33. Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, et
al. Mutations in nucleophosmin (NPM1) in acute myeloid
leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood
2005;106:3747-3754. doi:10.1182/blood-2005-05-2168.
34. Falini B, Bolli N, Liso A, Martelli MP, et al. Altered nucleophosmin transport in acute myeloid leukaemia with
mutated NPM1: molecular basis and clinical implications.
Leukemia 2009;23:1731-1743. doi:10.1038/leu.2009.124.
35. Chou WC, Tang JL, Wu SJ, Tsay W, et al. Clinical implications
of minimal residual disease monitoring by quantitative polymerase chain reaction in acute myeloid leukemia patients
bearing nucleophosmin (NPM1) mutations. Leukemia
2007;21:998-1004. doi:10.1038/sj.leu.2404637.
36. Gorello P, Cazzaniga G, Alberti F, Dell’Oro MG, et al. Quantitative assessment of minimal residual disease in acute
myeloid leukemia carrying nucleophosmin (NPM1) gene
mutations. Leukemia 2006;20:1103-1108. doi:10.1038/
sj.leu.2404149.
37. Leroy H, Roumier C, Huyghe P, Biggio V, et al. CEBPA point
mutations in hematological malignancies. Leukemia
2005;19:329-334. doi:10.1038/sj.leu.2403614.
38. Pabst T, Mueller BU, Zhang P, Radomska HS, et al.
Dominant-negative mutations of CEBPA, encoding
CCAAT/enhancer binding protein-alpha (C/EBPalpha), in
acute myeloid leukemia. Nat Genet 2001;27:263-270.
doi:10.1038/85820.
39. Bienz M, Ludwig M, Leibundgut EO, Mueller BU, et al. Risk
assessment in patients with acute myeloid leukemia and
a normal karyotype. Clin Cancer Res 2005;11:1416-1424.
doi:10.1158/1078-0432.CCR-04-1552.
40. Nerlov C. C/EBPalpha mutations in acute myeloid leukaemias. Nat Rev Cancer 2004;4:394-400. doi:10.1038/
nrc1363.
41. Pabst T, Mueller BU. Complexity of CEBPA dysregulation in human acute myeloid leukemia. Clin Cancer Res
2009;15:5303-5307. doi:10.1158/1078-0432.CCR-08-2941.
42. Gregory TK, Wald D, Chen Y, Vermaat JM, et al. Molecular
prognostic markers for adult acute myeloid leukemia
with normal cytogenetics. J Hematol Oncol 2009;2:23.
doi:10.1186/1756-8722-2-23.
43. Kelly LM, Gilliland DG. Genetics of myeloid leukemias. Annu
Rev Genomics Hum Genet 2002;3:179-198. doi:10.1146/
annurev.genom.3.032802.115046.
44. Abu-Duhier FM, Goodeve AC, Wilson GA, Care RS, et
al. Genomic structure of human FLT3: implications for
mutational analysis. Br J Haematol 2001;113:1076-1077.
doi:10.1046/j.1365-2141.2001.02821.x.
167
Artículo de revisión
Rev Hematol Mex 2015;16:168-178.
Estado del arte: metformina, cáncer
y leucemia
RESUMEN
Al día de hoy se sabe que en la génesis y mantenimiento efectivo de
una célula tumoral participan el mantenimiento de señales de proliferación celular, la evasión de los mecanismos supresores, resistencia a la
apoptosis, replicación ilimitada, inducción de la angiogénesis, invasión
y metástasis. Recientemente se han postulado también las alteraciones
al equilibrio energético celular y la expresión de genes de resistencia
a múltiples fármacos. La metformina, un medicamento prescrito durante más de 50 años, es en la actualidad el patrón de referencia en el
tratamiento de pacientes diabéticos no insulinodependientes debido a
que tiene mecanismos de acción capaces de regular los mecanismos de
obtención de energía. A partir de la administración tan difundida de este
fármaco en todo el mundo, surgieron diversas cohortes que apuntaban
a que metformina era un factor protector contra el cáncer. Esta teoría
se ha trasladado de manera exitosa a experimentos in vitro e in vivo,
confirmándose las propiedades antitumorales, al parecer, mediadas por
la inhibición de la vía LBK1/AMPK/mTOR y del IGF-1R. Por esta razón,
en apenas menos de una década es posible encontrar ensayos clínicos
de la adición de metformina a los esquemas de quimioterapia contra
casi todos los tipos de cáncer. Sin duda alguna, se seguirán generando y
consolidando los conocimientos de los efectos de metformina descritos
e incluso de otros más inesperados, como los efectos sinérgicos que
parece tener con los antibióticos en el tratamiento de la tuberculosis
multirresistente.
Christian Omar Ramos-Peñafiel1
Adrián Santoyo-Sánchez2
Irma Olarte-Carrillo3
Gloria Eugenia Queipo-García4
Yonathan Garfias-Becerra5
Adolfo Martínez-Tovar3
Servicio de Hematología.
Unidad de Medicina Experimental.
Laboratorio de Biología Molecular.
4
Servicio de Genética.
Hospital General de México Dr. Eduardo Liceaga,
México, DF.
5
Unidad de Investigación, Instituto de Oftalmología
Conde de Valenciana, México, DF.
1
2
3
Palabras clave: metformina, proteínas cinasas activadas por AMP,
serina-treonina cinasas TOR, receptor IGF tipo 1, cáncer, genes MDR.
State of the art: Metformin, cancer and
leukemia
ABSTRACT
It is currently known that in the genesis and effective maintenance
of a tumor cell they are involved at least the following mechanisms:
sustaining proliferative signaling, evading growth suppressors, resisting
cell death, enabling replicative immortality, inducing angiogenesis and
activating invasion and metastasis. Recently other modifications have
also postulated like deregulating cellular energetics and the expression
of multidrug resistance genes. Metformin, a drug used for more than
50 years, is currently the leader in the management of non-insulin dependent diabetic patients due it has mechanisms of action to regulate
energy production mechanisms. The widespread worldwide use of this
drug allowed that various cohorts pointing to metformin was a protective
factor against cancer. This theory has been successfully transferred to in
vitro and in vivo experiments and all confirm the antitumoral properties
168
Recibido: 9 de enero 2015
Aceptado: 26 de marzo 2015
Correspondencia: Dr. Christian Omar Ramos
Peñafiel
Hospital General de México
Unidad 111-D, 2º piso
Dr. Balmis 148
México, DF
[email protected]
Este artículo debe citarse como
Ramos-Peñafiel CO, Santoyo-Sánchez A, OlarteCarrillo I, Queipo-García GE y col. Estado del arte:
metformina, cáncer y leucemia. Rev Hematol Mex
2015;16:168-178.
www.nietoeditores.com.mx
Ramos-Peñafiel CO y col. Metformina, cáncer y leucemia
apparently mediated by inhibition of LBK1/AMPK/mTOR and the IGF1R pathways. For this reason it is possible to find many clinical trials in
the last decade about adding metformin to chemotherapy regimens for
almost all cancers. Knowledge of the described effects of metformin is
still being generated and strengthened as well as other more unexpected,
such as the possible synergistic effects with antibiotics in the management of multidrug-resistant tuberculosis.
Key words: metformin, AMP-activated protein kinases, TOR serinethreonine kinases, receptor, IGF type 1, cancer, MDR genes.
ANTECEDENTES
En la actualidad el cáncer es una de las primeras
causas de muerte en todo el mundo. De acuerdo
con el Registro Global de Cáncer (GLOBOCAN),
sólo en 2012 se estimó un total de 14.1 millones
de casos con 8.2 millones de muertes directas
asociadas; los principales tipos de cáncer fueron
el de mama y de pulmón.1 Una de las principales limitantes en todo el mundo son los pocos
registros disponibles principalmente en países en
vías de desarrollo. A pesar de que, de acuerdo
con el Instituto Nacional de Cáncer de Estados
Unidos, la incidencia global de cáncer va a la
baja; la población latina muestra un repunte
de algunos tipos de cáncer, principalmente de
cuello uterino.2,3 En México, el Registro Histopatológico de Neoplasias Malignas de 2002,
estimó un total de 58,599 defunciones asociadas
con cáncer, 13% de todas las muertes; del total
de los casos registrados entre 1993 y 2002, el
cáncer de cuello uterino fue la principal causa
(22% de los casos), seguido del cáncer de mama
(11%), próstata (6%) y los linfomas (5%). Las
leucemias sólo representaron 2% de todos los
cánceres de México (16,512 casos).4 Diversos
investigadores también han sugerido que las
zonas urbanas pobladas son un factor de riesgo
de diversos tipos de cáncer. La mayor parte de
la población hispana con cáncer está ubicada
en ciudades de Estados Unidos, Costa Rica y
la Ciudad de México. En población pediátrica,
Pérez-Saldivar y colaboradores estimaron la tasa
de incidencia anual de leucemias en población
pediátrica de hospitales públicos de la Ciudad
de México, registraron 57.6 casos por millón de
niños; la leucemia linfoblástica fue la principal
causa, seguida de la leucemia mieloide aguda
con 6.9 casos por millón de niños; concluyeron
que la frecuencia de leucemia linfoblástica en la
Ciudad de México es la más alta en población
hispana.5 González-Salas y su grupo, en 2012,
evaluaron en el Hospital General de México la
distribución de leucemias agudas en adultos a
través de dos periodos con 18 años de diferencia e identificaron que la leucemia linfoblástica
aguda fue la variedad más frecuente en los dos
periodos con un ligero realce de la leucemia
promielocítica.6 En 2009, en México la mortalidad asociada con cáncer hemato-oncológico
fue de 18%, en su mayor parte correspondió a
leucemias agudas.7
El tratamiento general de la mayoría de los
pacientes con neoplasias hemato-oncológicas
consiste en un régimen secuencial de quimioterapia, que, en su conjunto, ocupa varios
mecanismos de acción; el principal es el bloqueo
de la proliferación y diferenciación celular mediante el ciclo celular.8,9
169
Revista de Hematología
Mecanismos de génesis del cáncer
El cáncer es una enfermedad multifactorial cuya
génesis requiere la acumulación de factores de
riesgo, como exposición a diversos agentes que
condicionan el bloqueo de los mecanismos
normales de inducción de la apoptosis. En general, todos los tipos de tumores comparten los
mismos mecanismos, pero de manera particular
cada uno puede expresar algún mecanismo
más que otro.10 En el año 2000, Hanahan y
Weinberg realizaron una descripción muy completa de los principales mecanismos presentes
en todos los tumores; en general, incluyeron
el mantenimiento de señales de proliferación
celular, evasión de los mecanismos supresores,
resistencia a la apoptosis, replicación ilimitada,
angiogénesis y metástasis.11,12 Los avances en el
entendimiento de la actividad tumoral permitieron el reconocimiento de otros dos mecanismos:
la influencia en el metabolismo y la captación
de energía, que puede estar incrementadas en
diversos tumores y, finalmente, la evasión de la
destrucción de las células tumorales mediante
las células del sistema inmunitario.13,14 Otro de
los mecanismos implicados en la fisiopatología
y progresión de los tumores es su interacción
con el microambiente principalmente asociado
con los pericitos.15 Las enfermedades como
el mieloma múltiple han permitido un mejor
entendimiento de la interacción existente entre
las células tumorales y su microambiente. 16
La mayor parte del estroma tumoral está compuesto de fibroblastos; éstos pueden ser de dos
tipos: aquéllos con características morfológicas
semejantes a los fibroblastos que sostienen
a las células endoteliales y los denominados
miofibroblastos con la capacidad de expresar
α-actina.17 Estos últimos se expresan en sitios
con actividad inflamatoria elevada, como el
hígado, el pulmón y el riñón.18 La aparición de
diversas células madre tumorales también se ha
implicado en un pronóstico desfavorable en las
diversas enfermedades oncológicas. Estas células madre pueden interactuar con el estroma
170
Volumen 16, Núm. 2, abril-junio 2015
generando plasticidad. Las células tumorales
circulantes que se liberan del microambiente y
pasan a la circulación también tienen la capacidad de encontrar un nuevo microambiente; estos
sitios se conocen como nichos metastásicos, que
tienen la capacidad de albergar nuevas células
tumorales y son independientes de las señales
tumorales iniciales.19 Los mecanismos básicos
para la génesis de cualquier tipo de cáncer,
descritos en el artículo original de Hanahan y
Weinberg, se describen en la Figura 1.11
Metformina y cáncer
La metformina es un fármaco antidiabético
prescrito ampliamente para el tratamiento de la
diabetes melllitus tipo 2. Inicialmente, Galega
officinalis (lila francesa) se usó para el tratamiento de la poliuria y la halitosis por diversos
herbolarios, pero a finales del decenio de 1950
tres fármacos se sintetizaron a partir de sus
ingredientes activos (fenformina, metformina
y buformina). Químicamente, la metformina
es una biguanida sintética (Figura 2) y es la
única biguanida disponible en el Reino Unido
y Estados Unidos desde 1995.20 A pesar de su
administración tan extensa, aún es poco lo que
se sabe de su mecanismo de acción. Al igual
que un número importante de fármacos (por
ejemplo, aceteminofen, tamoxifeno, simvastatina), la mitocondria es uno de los principales
blancos moleculares de metformina.21 Debido a
que metformina posee una carga positiva, ésta se
acumula en la matriz mitrocondrial inhibiendo
al complejo I de la cadena transportadora de
electrones. El resultado es la reducción en la oxidación de NADH y finalmente la disminución en
las concentraciones de ATP, con la consecuente
activación de la proteína AMPK (de las siglas en
inglés: adenosine 5´-monophosphate-activated
protein kinase), lo que transforma a la célula de
un estado anabólico a un estado catabólico, restaurando su equilibrio energético.22 El interés de
su administración potencial como medicamentos
antitumorales se originó en diversos estudios
Ramos-Peñafiel CO y col. Metformina, cáncer y leucemia
Figura 1. Mecanismos implicados en la génesis, mantenimiento y perpetuidad de las células tumorales.
Imagen traducida de la referencia 11.
Figura 2. Estructura química de metformina.
epidemiológicos de cohortes de pacientes con
diabetes mellitus tipo 2, en los que la administración de metformina sola o en combinación
con sulfonilureas disminuía el riesgo de cáncer
en comparación con los expuestos a insulina.23
Estos hallazgos se han repetido en una diversidad
de ensayos epidemiológicos en todo el mundo y
de manera general con resultados constantes.24,25
Por tanto, podemos ubicar los beneficios de la
administración de metformina respecto del cáncer en dos escenarios: el primero, pacientes con
mayor riesgo de cáncer (por ejemplo, diabéticos)
y segundo, los que ya tienen diagnóstico de
cáncer y se desea potencializar el tratamiento o
evitar las recaídas.
171
Revista de Hematología
Estudios en pacientes con riesgo de cáncer
La diabetes es uno de los principales factores
de riesgo de diversas neoplasias. Uno de los
estudios más amplios lo presentaron Baur y colaboradores en Alemania, en colaboración con
cerca de 3,188 médicos de atención primaria.
La prevalencia de cáncer fue mayor en el grupo
de pacientes con diabets mellitus 2 (66/1,242)
en comparación con la población sin diabetes
(185/6,025: 5.1 versus 3%, p< 0.001). En cuanto
al tratamiento, los pacientes con diabetes mellitus tipo 2 que fueron tratados con metformina
como monoterapia mostraron menor tendencia a
padecer cáncer (OR 1,04; IC 95% 0.46-2.39) en
comparación con los que recibieron tratamiento
oral sin la adición de metformina (OR 2.26; IC
95% 1.24-4.13). En ese mismo estudio, pero
en la cohorte prospectiva, el riesgo de morir
por cáncer también fue menor en el grupo de
tratamiento con metformina (RR 1.34; IC 95%
0.42- 4.25) en comparación con los que recibieron cualquier otro tratamiento que no incluyera
metformina (RR 3.51; IC 95% 2.09-5.88).26 Estos
resultados se replicaron en otros países. Zhang
y colaboradores reportaron menor riesgo de padecer neoplasias colorrectales en pacientes con
diabetes mellitus 2 que fueron tratados con metformina de acuerdo con los hallazgos reportados
de cinco ensayos (RR 0.63; IC 95% 0.5-0.79).24
Col y colaboradores diseñaron un metanálisis
basado en siete estudios (cuatro cohortes y tres
de caso-control), todos los estudios evaluaron
metformina versus cualquier otro tratamiento
(sulfonilureas, insulina y la combinación con
sulfonilurea); la mayor parte consideró solamente cáncer de mama invasor y sólo uno se basó
en los subtipos histopatológicos (expresión del
receptor de hormona y HER2). Se determinó
que metformina tiene un factor protector (OR
0.83; IC 95% 0.71-0.97) en los siete estudios,
fue mayor en las pacientes con más de tres años
de tratamiento (n=4 estudios, OR 0.75; IC 95%
0.62-0.91).25 En este contexto, el grupo encabezado por Liu describió el efecto de la adición de
172
Volumen 16, Núm. 2, abril-junio 2015
metformina en la proliferación celular en líneas
de cáncer de mama triple receptor negativas.27
Recientemente, Koh y colaboradores describieron sobre esa misma línea celular los efectos de
un compuesto derivado de metformina (metformina ácido gamma-aminobutírico (GABA),
metformina-pregabalina, metformina-gabapentina) con efectos antitumorales semejantes pero
100 veces mayor.28
Debido a los efectos en la línea celular, diversos
investigadores han explorado su efecto en la
supervivencia, principalmente en el cáncer de
mama HER-2 positivo. En un estudio de cohorte,
Kim y colaboradores incluyeron 6,967 pacientes
no diabéticas, 202 pacientes diabéticas y 184
diabéticas pero con otro tipo de tratamiento;
el brazo de tratamiento con metformina tuvo
mejor supervivencia y el grupo que no recibió
metformina mostró mayor tendencia a metástasis
(RR: 5.37; IC 95% 1.88-15.28).29
Efectos antitumorales de metformina
A pesar de una gran diversidad de estudios epidemiológicos, el entendimiento de su efecto
antitumoral ha derivado de los diversos ensayos en líneas celulares. En su mecanismo de
acción habitual, el clorhidrato de metformina
inhibe indirectamente la acción mitocondrial
mediante la obstrucción de sus mecanismos de
obtención de ATP mediante el bloqueo de la
AMPK (AMP proteiína cinasa), incrementando
las concentraciones de AMP con el consecuente bloqueo de la expresión de factores
de transcripción (llamados factores de Yamanaka: OCT4, KLF4, SOX2, cMyc); también se
ha reportado que regula la transcripción de
microARNs (miARN) que influyen con diversos
factores de transcripción, como FOXO o CREB
(Figura 3).30,31
Este efecto en los mARN lo describieron Feng
y colaboradores en la línea celular HCT 116
(cáncer de colon) en donde la adición de met-
Ramos-Peñafiel CO y col. Metformina, cáncer y leucemia
Figura 3. Mecanismos de acción antitumoral de metformina.
formina y 5-fluorouracilo (5-FU) incrementó las
concentraciones de un gen supresor de tumores
denominado Spry2 mediante la supresión del
micro RNA-21 (mir-21).32 Su principal mecanismo de acción en las células tumorales se ha
centrado en la inhibición de procesos celulares
que consumen energía y el principal blanco
es la activación vía AMPK. De manera normal
AMPK fosforila a TSC2 (complejo de esclerosis
tuberosa 2) estimulando la GTPasa y reduciendo
la actividad de la vía mTOR (blanco mamario
de rapamicina), indispensable para la proliferación celular.30,33,34 Su efecto, a su vez, va más
allá de las vías de señalización; de acuerdo
con Vazquez-Martin, su efecto puede extenderse hasta en las células que inician cambios
oncogénicos.33 Esto lo corroboró Memmott en
2010 en un ensayo en ratones a los que se les
expuso al carcinógeno de tabaco 4-metilnitrosamina-1-(3-piridil)-1-butanol y fueron tratados
posteriormente con metformina.35 En el hígado,
metformina activó a AMPK e inhibió a mTOR,
pero en el pulmón metformina inhibió la fosforilación del receptor del factor de crecimiento
semejante a la insulina (IGF-1R/1R), Akt y la
vía ERK (factor de señalización extracelular).35
La inhibición del IGF-1R también ha sido de
beneficio en otras líneas celulares. Xie y colaboradores reportaron el efecto de la adición de
metformina en líneas de cáncer de endometrio.
La adición del fármaco aumentó la expresión del
173
Revista de Hematología
receptor de progesterona, que es regulado por la
vía del IGF.36 La fosforilación de mTOR también
ha adquirido importancia porque incrementa la
traducción de diversas proteínas que codifican
reguladores del ciclo celular, como c-myc y la
ciclina D1 (Figura 3).37
Otros efectos que se han descrito son en las
vías relacionadas con la activación de AMPK,
como LKB1 (serina/treonina cinasa 11).38 En
otro aspecto cercano a los descritos, Rozengurt y colaboradores describieron en células
de cáncer de páncreas que la metformina
también inhibe los receptores acoplados a
proteínas G asociados con los receptores
de IGF-1R. 38 Otra GTPasa que también es
blanco de mefformina es la GTPasa Rac1,
altamente expresada en cáncer de próstata.39
En el modelo celular de cáncer de próstata de
Dirat y colaboradores, metformina inhibió la
GTPasa Rac 1 mediante el bloqueo de vías de
señalización celular, como P-REX1, AMPc,
CXCL12/CXCR4. 39 Recientemente, otra vía
de señalización se identificó como blanco de
metformina. El grupo lidereado por Nakamura,
en la línea de células pancreáticas BxPC3,
adicionó metformina, misma que bloqueó la
expresión de las proteínas implicadas en la
vía de señalización Sonic hedgehog (Shh).40
Asimismo, en cáncer de mama también se
describió que metformina inhibió el efecto de
la vía Shh mostrando una correlación entre las
concentraciones de AMPK.41
Las investigaciones del equipo de Lin en líneas
celulares de cáncer de pulmón también evidenciaron que la adición de metformina inhibe la
fosforilación de la vía mediada por IL6/STAT3
(transductor de señal y transcriptor activador
signal transducer and activator transcriptor,
Figura 3), incrementando la toxicidad mediada
por cisplatino, pudiendo regularla por la activación de LKB1-AMPK y por este otro mecanismo
independiente de la vía mTOR.42
174
Volumen 16, Núm. 2, abril-junio 2015
Metformina y su asociación con las proteínas
que inhiben la apoptosis
Entre otros mecanismos implicados está la
asociación con otras proteínas implicadas en
diversas vías de señalización, como PI3K. Una
de las proteínas más complejas es la survivina,
que está implicada principalmente entre los
mecanismos inhibidores de la apoptosis (Figura 3); son una familia completa de genes que
están activos en estado normal y en estados
patológicos. Su principal papel es en el mecanismo de mitosis,43 principalmente en la etapa
G2/M, inhibiendo la actividad de la caspasa
7.44 Durante el desarrollo tumoral, la relación
de la expresión de survivina está expresada
de manera inversa, diversas mutaciones sobre
la survivina también se han asociado con el
crecimiento tumoral.45
Diversos fármacos realizan sinergia con metformina, pero uno en especial muestra un efecto
antagónico. Lesan y colaboradores, en la línea
celular MKN-45, demostraron que la adición
de metformina al cisplatino incrementa las concentraciones de survivina y mTOR. Este efecto
antagónico se justifica por la interferencia del
cisplatino mediado a metformina, por lo que no
es buena opción para el tratamiento de cáncer
gástrico.46 En otro modelo de cáncer gástrico,
Han y colaboradores evaluaron el efecto en tres
líneas celulares de cáncer gástrico (MKN-28,
SGC-7901, BGC-823) de añadir metformina,
sugiriendo que el efecto de ésta en la apoptosis
está mediada por inhibición de la survivina mediada por el efecto en la vía mTOR.47
Metformina en neoplasias hemato-oncológicas
La mayor parte de la evidencia obtenida de las
líneas celulares sugiere que la vía de señalización celular LKB1/AMPK tiene in papel muy
importante en la regulación y protección de
los mecanismos de apoptosis. Debido a que
Ramos-Peñafiel CO y col. Metformina, cáncer y leucemia
metformina actúa mediante la activación de
AMPK, se ha sugerido que muestra un efecto
potencial en especial en las neoplasias en las que
se prescriben antracíclicos como doxorrubicina
(cáncer de mama, de ovario, leucemia linfoblástica, melanoma).48 Otros autores sugieren que
su potencial antileucémico puede radicar en
dos mecanismos; el primero: la disminución de
la hiperinsulinemia, limitando la expresión de
diversos factores de crecimiento semejantes a la
insulina, y el segundo, por el bloqueo de vías de
señalización dependientes de AMP, la principal
es la vía mTOR.49 Otros autores sugieren que
este regulador metabólico puede ser de utilidad
en situaciones como la expresión de BCR-ABL1,
porque ésta activa vías de supervivencia, como
PI3K/AKT/mTOR, que también es bloqueada
por los activadores de la AMPK.50 Vakana y
colaboradores demostraron en líneas celulares
la disminución en la expresión del transcrito
BCR-ABL1 [células de leucemia mieloide crónica Ph (+), leucemia linfoblástica aguda] con la
adición de metformina a los medios de cultivo,
incluyendo líneas celulares con expresión de la
mutación T315I.51 Debido a estos efectos, Pan y
colaboradores evaluaron el efecto en diversas
líneas celulares de la adición de metformina
500 μM o rosiglitazone 10 μM; los autores concluyeron que metformina sensibiliza a la línea
celular Reh, mientras la insulina incrementa la
quimiorresistencia.8
Otros modelos en líneas celulares de leucemia también han propuesto que la adición de
metformina induce apoptosis mediante la sobrerregulación de vías de estrés celular y proteínas
que interactúan en la apoptosis (disminución
de la expresión de IRE1α y CHOP).52 En nuestra
experiencia en la línea celular MOLT-4, también
se logró la inhibición en la viabilidad celular,
logrando un bloqueo, principalmente en la etapa G0/G1; posteriormente al adicionar además
prednisona como estrategia de pretratamiento
en pacientes adultos con leucemia linfoblás-
tica aguda, se logró incrementar la respuesta
favorable a los esteroides.53 Recientemente en
un estudio piloto se adicionó metformina a
nuestro régimen institucional de tratamiento de
leucemia linfoblástica, logrando reducción del
porcentaje de recaídas tempranas (25 versus
48%) en comparación con el grupo que sólo
recibió quimioterapia; la dosis administrada en
este ensayo fue de 850 mg vía oral cada 8 horas.9
Nuevos trucos de la metformina
El conocimiento de los efectos antitumorales
de metformina es cada vez más complejo y
extenso, se centra en la activación de AMPK y
el bloqueo de la vía mTOR. Estos efectos antitumorales se han reportado en gran número
de líneas celulares de cáncer, pero Singhal y
colaboradores evaluaron los efectos de este
fármaco en el crecimiento de Mycobacterium
tuberculosis. En su modelo, el crecimiento celular de Mycobacterium fue detenido debido a
la activación de AMPK, produciendo especies
reactivas de oxígeno, al igual que facilitó la
fusión lisosomal.54 Estos resultados han impulsado propuestas para incorporarse dentro de
los esquemas de tratamiento, en especial en los
bacilos multirresistentes.55
CONCLUSIONES
En la actualidad, la metformina es la primera
línea de tratamiento de los pacientes diabéticos
no insulinodependientes en todo el mundo.56 Sus
indicaciones se han extendido con el tiempo,
como en diabetes gestacional, prediabetes o en
el síndrome de ovario poliquístico.57-59 A pesar
de que se ha prescrito durante más de 50 años
en la clínica, es poco aún lo que se conoce de
su mecanismo de acción y más aún de su potencial antitumoral. Los efectos antitumorales de
metformina se resumen en la Figura 4 e incluyen
un nuevo posible efecto que actualmente está en
investigación, que es el bloqueo de la expresión
175
Revista de Hematología
Volumen 16, Núm. 2, abril-junio 2015
Figura 4. Efectos de metformina en los mecanismos fisiopatogénicos de las células de cáncer.
Modificada de la referencia 11.
de los genes de resistencia a fármacos. A pesar
de ser un medicamento tan antiguo, cada vez
conocemos más de su real y potencial mecanismo de acción.
Agradecimientos
Agradecemos el apoyo del Consejo Nacional de
Ciencia y Tecnología (CONACyT) que apoya los
protocolos de investigación (registros 80085 y
162269) que dan origen a esta revisión. De igual
manera, agradecemos a la División de Posgrado
176
y la Coordinación de Servicio Social de Pregrado
de la Facultad de Medicina de la Universidad
Nacional Autónoma de México.
REFERENCIAS
1. Torre LA, Bray F, Siegel RL, Ferlay J, et al. Global cancer
statistics, 2012. CA Cancer J Clin 2015;65:87-108.
2. Edwards BK, Noone AM, Mariotto AB, Simard EP, et al.
Annual Report to the Nation on the status of cancer, 19752010, featuring prevalence of comorbidity and impact on
survival among persons with lung, colorectal, breast, or
prostate cancer. Cancer 2014;120:1290-1314.
Ramos-Peñafiel CO y col. Metformina, cáncer y leucemia
3. 4. 5. Bazargan M, Bazargan SH, Farooq M, Baker RS. Correlates of
cervical cancer screening among underserved Hispanic and
African-American women. Prev Med (Baltim) 2004;39:465473.
Meneses-García A, Ruiz-Godoy LM, Beltrán-Ortega A,
Sánchez-Cervantes F y col. Principales neoplasias malignas
en México y su distribución geográfica (1993-2002). Rev
Invest Clin 2012;64:322-329.
Pérez-Saldivar ML, Fajardo-Gutiérrez A, Bernáldez-Ríos R,
Martínez-Avalos A, et al. Childhood acute leukemias are
frequent in Mexico City: descriptive epidemiology. BMC
Cancer 2011;11:355.
6. González-Salas WM, Olarte-Carrillo I, Gutiérrez-Romero
M, Montaño-Figueroa EH, et al. Frecuencia de leucemias
agudas en un hospital de referencia. Rev Med Inst Mex
Seguro Soc 2012;50:167-171.
7. Estadística a propósito del día mundial contra el cáncer.
Instituto Nacional de Estadística y Geografía [Internet].
México, D.F., México; 2015 [Consultado 4 abril 2015].
Disponible en: http://www.inegi.org.mx/inegi/default.
aspx?s=inegi&c=269
8. Pan J, Chen C, Jin Y, Fuentes-Mattei E, et al. Differential
impact of structurally different anti-diabetic drugs on
proliferation and chemosensitivity of acute lymphoblastic
leukemia cells. Cell Cycle 2012;11:2314-2326.
9. Ramos-Peñafiel CO, Martínez-Murillo C, Santoyo-Sánchez
A, Jiménez-Ponce F, et al. [Effect of metformin addition
to an acute lymphoblastic leukemia chemotherapy
treatment]. Rev Med Inst Mex Seguro Soc 2014;52:270275.
10. Horne SD, Pollick SA, Heng HHQ. Evolutionary mechanism
unifies the hallmarks of cancer. Int J Cancer 2015;136:20122021.
11. Hanahan D, Weinberg RA. Hallmarks of cancer: the next
generation. Cell 2011;144:646-674.
12. Sonnenschein C, Soto AM. The aging of the 2000 and
2011 Hallmarks of Cancer reviews: a critique. J Biosci
2013;38:651-663.
13. Marín de Mas I, Aguilar E, Jayaraman A, Polat IH, et al.
Cancer cell metabolism as new targets for novel designed
therapies. Future Med Chem 2014;6:1791-1810.
14. Masoudi-Nejad A, Asgari Y. Metabolic cancer biology:
structural-based analysis of cancer as a metabolic disease,
new sights and opportunities for disease treatment. Semin
Cancer Biol 2015;30:21-29.
15. Lopes-Ribeiro A, Keith-Okamoto O. Combined effects of
pericytes in the tumor microenvironment. Stem Cells Int
2015;2015:8.
16. Romano A, Conticello C, Cavalli M, Vetro C, et al. Immunological dysregulation in multiple myeloma microenvironment. Biomed Res Int 2014;2014:198539.
17. Kharaishvili G, Simkova D, Bouchalova K, Gachechiladze M,
et al. The role of cancer-associated fibroblasts, solid stress
and other microenvironmental factors in tumor progression and therapy resistance. Cancer Cell Int 2014;14:41.
18. Kawaguchi M, Kataoka H. Mechanisms of hepatocyte
growth factor activation in cancer tissues. Cancers (Basel)
2014;6:1890-1904.
19. Liu H, Lv L, Yang K. Chemotherapy targeting cancer stem
cells. Am J Cancer Res 2015;5:880-893.
20. Krentz AJ, Bailey CJ. Oral antidiabetic agents: current role
in type 2 diabetes mellitus. Drugs 2005;65:385-411.
21. Chan K, Truong D, Shangari N, O’Brien PJ. Drug-induced
mitochondrial toxicity. Expert Opin Drug Metab Toxicol
2005;1:655-669.
22. Emami Riedmaier A, Fisel P, Nies AT, Schaeffeler E, Schwab
M. Metformin and cancer: from the old medicine cabinet to
pharmacological pitfalls and prospects. Trends Pharmacol
Sci 2013;34:126-135.
23. Bowker SL, Yasui Y, Veugelers P, Johnson JA. Glucose-lowering agents and cancer mortality rates in type 2 diabetes:
assessing effects of time-varying exposure. Diabetologia
2010;53:1631-1637.
24. Zhang Z-J, Zheng Z-J, Kan H, Song Y, et al. Reduced risk
of colorectal cancer with metformin therapy in patients
with type 2 diabetes: a meta-analysis. Diabetes Care
2011;34:2323-2328.
25. Col NF, Ochs L, Springmann V, Aragaki AK, Chlebowski
RT. Metformin and breast cancer risk: a meta-analysis
and critical literature review. Breast Cancer Res Treat
2012;135:639-646.
26. Baur DM, Klotsche J, Hamnvik O-PR, Sievers C, et al. Type
2 diabetes mellitus and medications for type 2 diabetes
mellitus are associated with risk for and mortality from
cancer in a German primary care cohort. Metabolism
2011;60:1363-1371.
27. Liu B, Fan Z, Edgerton SM, Deng X-S, et al. Metformin induces unique biological and molecular responses in triple
negative breast cancer cells. Cell Cycle 2009;8:2031-2040.
28. Koh M, Lee J-C, Min C, Moon A. A novel metformin derivative, HL010183, inhibits proliferation and invasion
of triple-negative breast cancer cells. Bioorg Med Chem
2013;21:2305-2313.
29. Kim HJ, Kwon H, Lee JW, Kim HJ, et al. Metformin increases
survival in hormone receptor-positive, Her2-positive breast
cancer patients with diabetes. Breast Cancer Res 2015;17:64.
30. Dowling RJO, Niraula S, Stambolic V, Goodwin PJ. Metformin in cancer: translational challenges. J Mol Endocrinol
2012;48:R31-R43.
31. Serrano M. Metformin and reprogramming into iPSCs. Cell
Cycle 2012;11:1058-1059.
32. Feng Y-H, Wu C-L, Shiau A-L, Lee J-C, et al. MicroRNA21-mediated regulation of Sprouty2 protein expression
enhances the cytotoxic effect of 5-fluorouracil and metformin in colon cancer cells. Int J Mol Med 2012;29:920926.
177
Revista de Hematología
33. Vazquez-Martin A, Oliveras-Ferraros C, Cufí S, Martin-Castillo B, Menendez JA. Metformin and energy metabolism in
breast cancer: from insulin physiology to tumour-initiating
stem cells. Curr Mol Med 2010;10:674-691.
46. Lesan V, Ghaffari SH, Salaramoli J, Heidari M, et al. Evaluation of antagonistic effects of metformin with cisplatin in
gastric cancer cells. Int J Hematol Stem cell Res 2014;8:1219.
34. Pernicova I, Korbonits M. Metformin–mode of action
and clinical implications for diabetes and cancer. Nat Rev
Endocrinol 2014;10:143-156.
47. Han G, Gong H, Wang Y, Guo S, Liu K. AMPK/mTOR-mediated inhibition of survivin partly contributes to metformininduced apoptosis in human gastric cancer cell. Cancer Biol
Ther 2015;16:77-87.
35. Memmott RM, Mercado JR, Maier CR, Kawabata S, et al.
Metformin prevents tobacco carcinogen–induced lung
tumorigenesis. Cancer Prev Res (Phila) 2010;3:1066-1076.
36. Xie Y, Wang Y-L, Yu L, Hu Q, et al. Metformin promotes progesterone receptor expression via inhibition of mammalian
target of rapamycin (mTOR) in endometrial cancer cells. J
Steroid Biochem Mol Biol 2011;126:113-120.
37. Micic D, Cvijovic G, Trajkovic V, Duntas LH, Polovina S. Metformin: its emerging role in oncology. Hormones (Athens)
2011;10:5-15.
38. Rozengurt E, Sinnett-Smith J, Kisfalvi K. Crosstalk between
insulin/insulin-like growth factor-1 receptors and G proteincoupled receptor signaling systems: A novel target for the
antidiabetic drug metformin in pancreatic cancer. Clin
Cancer Res 2010;16:2505-2511.
39. Dirat B, Ader I, Golzio M, Massa F, Mettouchi A, et al.
Inhibition of the GTPase Rac1 mediates the antimigratory
effects of metformin in prostate cancer cells. Mol Cancer
Ther 2015;14:586-596.
40. Nakamura M, Ogo A, Yamura M, Yamaguchi Y, Nakashima
H. Metformin suppresses sonic hedgehog expression in
pancreatic cancer cells. Anticancer Res 2014;34:1765-1769.
41. Fan C, Wang Y, Liu Z, Sun Y, et al. Metformin exerts anticancer effects through the inhibition of the Sonic hedgehog
signaling pathway in breast cancer. Int J Mol Med 2015
May 21 [Epub ahead of print].
42. Lin C-C, Yeh H-H, Huang W-L, Yan J-J, et al. Metformin
enhances cisplatin cytotoxicity by suppressing signal
transducer and activator of transcription-3 activity independently of the liver kinase B1-AMP-activated protein
kinase pathway. Am J Respir Cell Mol Biol 2013;49:241-250.
43. Altieri DC. Survivin, versatile modulation of cell division
and apoptosis in cancer. Oncogene 2003;22:8581-8589.
44. Yang J, Liu F-X, Yan X-C. [Research advances on inhibitor of
apoptosis, survivin]. Ai Zheng 2003;22:771-774.
45. Yamamoto T, Tanigawa N. The role of survivin as a new
target of diagnosis and treatment in human cancer. Med
Electron Microsc 2001;34:207-212.
178
Volumen 16, Núm. 2, abril-junio 2015
48. Vallianou NG, Evangelopoulos A, Kazazis C. Metformin and
cancer. Rev Diabet Stud 2013;10:228-235.
49. Rosilio C, Ben-Sahra I, Bost F, Peyron J-F. Metformin: a
metabolic disruptor and anti-diabetic drug to target human
leukemia. Cancer Lett 2014;346:188-196.
50. Vakana E, Platanias LC. AMPK in BCR-ABL expressing leukemias. Regulatory effects and therapeutic implications.
Oncotarget 2011;2:1322-1338.
51. Vakana E, Altman JK, Glaser H, Donato NJ, Platanias LC.
Antileukemic effects of AMPK activators on BCR-ABLexpressing cells. Blood 2011;118:6399-6402.
52. Leclerc GM, Leclerc GJ, Kuznetsov JN, DeSalvo J, Barredo JC.
Metformin induces apoptosis through AMPK-dependent
inhibition of UPR signaling in ALL lymphoblasts. PLoS One
2013;8:e74420.
53. Ramos-Peñafiel CO, Olarte-Carrillo I, Martínez-Tovar
A, Castellanos-Sinco H, et al. Effect of metformin to a
pretreatment with steroids in adult patients with acute
lymphoblastic leukemia and in the viability of the MOLT-4
cell line. Med UIS 2014;27:221-229.
54. Singhal A, Jie L, Kumar P, Hong GS, et al. Metformin
as adjunct antituberculosis therapy. Sci Transl Med
2014;6:263ra159.
55. Vashisht R, Brahmachari SK. Metformin as a potential
combination therapy with existing front-line antibiotics
for tuberculosis. J Transl Med 2015;13:83.
56. Tran L, Zielinski A, Roach AH, Jende JA, et al. The Pharmacologic treatment of type 2 diabetes: Oral medications.
Ann Pharmacother 2015;49:540-556.
57. Poomalar GK. Changing trends in management of gestational diabetes mellitus. World J Diabetes 2015;6:284-295.
58. Bansal N. Prediabetes diagnosis and treatment: A review.
World J Diabetes 2015;6:296-303.
59. Jayasena CN, Franks S. The management of patients
with polycystic ovary syndrome. Nat Rev Endocrinol
2014;10:624-636.
In memoriam
Rev Hematol Mex 2015;16:179-181.
Doctor Elías Jiménez Fonseca
Rafael Jiménez-Bonilla
Profesor y Miembro del Comité Ético Científico, Universidad de Ciencias Médicas (UCIMED), Costa Rica.
El doctor Elías Jiménez Fonseca nació en 1938 en San José,
Costa Rica, y falleció en esa misma ciudad el 1 de marzo del
presente año. A sus 17 años, después de la abrupta muerte de
su padre por insuficiencia cardiaca, se trasladó con su madre y
dos hermanos a la Ciudad de México para cumplir su sueño de
estudiar Medicina en la UNAM. Al igual que toda su familia,
se hizo mexicano de corazón. Una vez graduado de médico
con honores (1961), estudió Pediatría en el Hospital Infantil de
México, donde después de conseguir su añorada especialidad
(1965), decidió hacerse hematólogo al lado del gran Maestro
mexicano, el Dr. Samuel Dorantes Mesa.
Luego de 10 años de residir en México, regresó a su tierra natal
para ser el primer hematólogo pediatra de Costa Rica. Tuvo la
suerte de que en su país acababa de crearse el Hospital Nacional
de Niños, al que se incorporó de inmediato como Jefe de Hematología y también a la docencia universitaria en la Universidad
de Costa Rica.
Poco después, al darse cuenta de que el Hospital Saint Jude de
Memphis había establecido la terapia total para el tratamiento
de los niños con leucemia, viajó a ese centro para tratar de poner en práctica los novedosos tratamientos. Ahí estableció gran
amistad con el Dr. Rhômes Aur, responsable en aquel momento
de los tratamientos de niños con leucemia linfocítica. Esto lo
convirtió en pionero de las curaciones de los niños leucémicos
costarricenses. No satisfecho de sus logros, se incorporó al
Grupo Latinoamericano para el Tratamiento de Leucemias y
Hemopatías Malignas creado por su entrañable amigo, el Dr.
Santiago Pavlovsky, con lo que el Hospital Nacional de Niños
obtuvo niveles impresionantes de supervivencia y curación de
los pacientes con leucemia, y se transformó en el primer centro
que realizó trasplantes de médula ósea en América Central.
Dirigió durante más de 30 años los destinos del Hospital Nacional de Niños, ya fuera como director o subdirector, y en 1975
creó el primer Comité Ético Científico del país y de Centroaméwww.nietoeditores.com.mx
Correspondencia: Dr. Rafael Jiménez Bonilla
Apartado 638-1007
Centro Colón, Costa Rica
[email protected]
179
Revista de Hematología
rica. Posteriormente fue nombrado Presidente
del Seguro Social de Costa Rica, que abarca el
cien por ciento de los hospitales del país, donde
realizó una magna labor como jerarca de la más
grande institución médica costarricense, consiguiendo financiamiento para muchas obras,
como el moderno edificio de Especialidades
Médicas del Hospital Nacional de Niños.
Otro de sus grandes logros fue la creación
del primer programa de
Hematología en su país,
con el que logró formar
hematólogos pediatras,
no sólo de Costa Rica,
sino de varios países
de Latinoamérica, que
son en la actualidad
jefes en sus respectivos
hospitales.
Al darse cuenta que el
voluntariado era necesario para obtener
mejores resultados en
los niños con cáncer,
organizó un grupo de
personas que hoy conforman la Asociación de
Lucha contra el Cáncer
Infantil, sin la cual no se
hubiera podido atender
a los miles de niños con
esos padecimientos. Esta
institución mantiene en la actualidad un albergue para los pequeños y sus padres que viajan
de zonas rurales para recibir tratamiento en el
Hospital Nacional de Niños, y paga el transporte
y sepelios, así como personal especializado,
equipo médico y medicamentos.
Fue presidente y fundador de la Asociación
Costarricense de Hematología, vicepresidente
de la Academia Nacional de Medicina, presi-
180
Volumen 16, Núm. 2, abril-junio 2015
dente de la Asociación de Investigación Clínica,
miembro de múltiples asociaciones médicas
internacionales y un asiduo luchador para que
en Costa Rica se estableciera una ley específica
de investigación biomédica, que convirtió a su
país en el primero de Latinoamérica en tener
una ley en ese sentido.
Sus grandes atributos, que lo hicieron sobresalir
del promedio y transformarse en un hombre
extraordinario, fueron
varios, entre los que
cabe citar su preclara inteligencia, que lo
hizo conformar grupos
multidisciplinarios y
delegar funciones en
sus subalternos para
que descollaran en sus
labores. Es común entre
los grandes hombres
ser sencillos y no tratar
de imponer sus ideas a
la fuerza, sino a base
de convencimiento y
basado en los mejores
razonamientos y experiencia en el campo; así
fue él.
No conforme con lo que
hacía, siempre buscaba
un nuevo sueño por el
cual luchar. Las personas superiores emiten una luz constante que
irradia a los que se les acercan. Por eso logró
establecer diferentes grupos de amigos, que
serán los responsables de continuar su obra.
Era amante del deporte, la lectura, la música
clásica y auspiciador de la Orquesta Sinfónica
Nacional. Disfrutó cada momento junto a sus
tres hijos, siete nietos y su esposa Cecilia, con
la cual estuvo casado 55 años.
Jiménez-Bonilla R. Doctor Elías Jiménez Fonseca
Nunca perdió su vínculo con la Hematología
mexicana. En los congresos de la Agrupación
Mexicana para el Estudio de la Hematología y en
diferentes foros pediátricos, se hacía presente para
disertar sobre distintos temas de su especialidad;
últimamente acerca de los problemas de comportamiento en niños que habían tenido anemia
por deficiencia de hierro en las primeras etapas
de su vida y que lamentablemente quedaron con
secuelas permanentes, estudios realizados con la
pediatra estadounidense Betzy Lozoff.
Entre sus innumerables publicaciones pueden
citarse no sólo las de su especialidad hematológica, sino capítulos y libros de Pediatría para
médicos y padres. Lamentablemente, en la
magna obra de la Hematología: la Enciclopedia
Iberoamericana, dirigida por el insigne médico
español don Antonio López Borrasca, tuvo que
declinar su participación como autor. En aquel
momento su hijo varón había muerto en un
accidente automovilístico.
El Maestro Jiménez fue un ser humano excepcional que supo implantar ideas que prevalecerán
por muchísimos años. Nadie de los que estuvo a
su lado podrá jamás decir que no fue conmovido
por su gran poder de síntesis, por la casta que
sacaba ante las emergencias, pero sobre todo,
porque valoraba por igual al más humilde de los
trabajadores del hospital que a las autoridades
superiores. Podría decirse que fue un verdadero
caballero andante, por inculcar en sus discípulos
la universalización del conocimiento y el uso de
principios y valores morales que los convirtieron,
sin duda, en mejores seres humanos.
Al despedirlo sentimos tristeza, pero a la vez
un gran orgullo de haber podido estar a su lado
durante más de cuatro décadas.
181
Letter to the editor
Rev Hematol Mex 2015;16:182.
Chemotherapy alone in early stage
Hodgkin’s lymphoma
Guillermo J Ruiz-Argüelles MD, FRCP (Glasg),
MACP
Centro de Hematología y Medicina Interna, Clínica
Ruiz
Quimioterapia sin radioterapia en el
tratamiento de los estadios iniciales del
linfoma de Hodgkin
The paper by Radford et al clearly shows that treatment with
ABVD chemotherapy (CT) is noninferior to treatment with radiotherapy (RT) in early-stage Hodgkin’s lymphoma.1 Equipments
which deliver RT worldwide are heterogeneous in its features,
efficacy and conditions, and outdated radiotherapy equipments
are still operating in underprivileged circumstances, such as those
prevailing in developing (middle income) countries.2 With this
idea in mind we published a study assessing the efficacy of CT
alone in the treatment of early stage Hodgkin’s lymphoma and
we found that “it is better a conventional CT than a suboptimal
RT in the treatment of early-stage Hodgkin’s disease”.2,3
In certain conditions, therapeutic choices are based not only
on scientific data, but also in economic circumstances which
lead into differentiated efficacy of the therapeutic approaches.4
The data in the paper by Radford et al, scientifically support the
decision to use CT alone in the treatment of early-stage Hogkin’s
lymphoma, in circumstances in which RT is less than optimal
and in other scenarios.
REFERENCES
182
1. Radford J, Illidge T, Counsell N, Hancock B, et al. Results of a trial of PET-directed
therapy for early stage Hodgkin’s lymphoma. N Engl J Med 2015;372:1598-1607.
2. Ruiz-Argüelles GJ, Gómez-Almaguer D. Chemotherapy in early stage Hodgkin’s
disease. Sem Oncol 1997;24:XIV.
3. Ruiz-Argüelles GJ, Gómez-Almaguer D, Apreza-Molina MG. Chemotherapy alone
may be an efficient alternative in the treatment of early stage Hodgkin’s disease
if optimal radiotherapy is not available. Leukemia Lymph 1997;27:179-183.
4. Ruiz-Argüelles GJ, Tarín-Arzaga LC, González-Carrillo ML, Gutiérrez-Riveroll KI, et
al. Therapeutic choices in patients with Ph1 (+) chronic myelogenous leukemia
living in México in the tyrosine kinase inhibitors (TKI) era: Stem cell transplantation or TKI’s? Bone Marrow Transplant 2008;42:23-28.
www.nietoeditores.com.mx
Normas para autores
Los manuscritos deben elaborarse siguiendo las recomendaciones del
Comité Internacional de Editores de Revistas Médicas (N Engl J Med
1997;336:309-15) y se ajustan a las siguientes normas:
1.
2.
3.
4.
5.
6.
7.
8.
El texto debe enviarse por correo electrónico a la atención del Editor:
[email protected]
Las secciones se ordenan de la siguiente manera: autores, adscripciones, dirección para envío de correspondencia al editor
La extensión máxima de los originales será de 15 hojas, de los casos
clínicos 8 hojas y cuatro figuras o cuadros. Las revisiones no excederán 15 hojas.
Si todos los autores pertenecen a servicios diferentes pero a una
misma institución el nombre de ésta se pondrá una sola vez y al final.
La identificación de los autores deberá hacerse con números en
superíndice.
Todo el material gráfico (cuadros, figuras y fotografías) deberá ser de
calidad (nitidez y enfoque) para que su reproducción sea excelente. Se
recomienda incluir todo tipo de ilustración enseguida de las referencias
bibliográficas.
Las gráficas, dibujos y otras ilustraciones deben dibujarse profe sionalmente o elaborarse con un programa de cómputo y adjuntarlas
al mismo archivo del texto.
Los cuadros (y no tablas) deberán numerarse con caracteres arábigos.
Cada uno deberá tener un título breve; al pie del mismo se incluirán
las notas explicativas que aclaren las abreviaturas poco conocidas. No
se usarán líneas horizontales o verticales internas. Todos los cuadros
deberán citarse en el texto.
Tipo de artículos: la revista publica artículos originales en el área de
investigación clínica o de laboratorio, editoriales, artículos de revisión,
biotecnología, comunicación de casos y cartas al editor. Se reciben
artículos en los idiomas español e inglés.
Resumen no mayor de 250 palabras, y deberá estar estructurado en
antecedentes, material y método, resulta dos y conclusiones. Con esta
estructura se deberán enunciar claramente los propósitos, procedimientos básicos, metodología, principales hallazgos (datos concretos y su
relevancia estadística), así como las conclusiones más relevantes. Al
final del resumen proporcionarán de 3 a 10 palabras o frases clave.
Enseguida se incluirá un resumen (abstract) en inglés.
9. Abstract. Es una traducción correcta del resumen al inglés.
10. Texto. Deberá contener antecedentes, material y métodos, resultados
y discusión, si se tratara de un artículo experimental o de observación.
Otro tipo de artículos, como comunicación de casos, artículos de revi sión y editoriales no utilizarán este formato.
a) Introducción. Exprese brevemente el propósito del artículo. Resuma el fundamento lógico del estudio u observación. Mencione
las referencias estrictamente pertinentes, sin hacer una revisión
extensa del tema. No incluya datos ni conclusiones del trabajo que
está dando a conocer.
b) Material y método. Describa claramente la forma de selección
de los sujetos observados o que participaron en los experimentos (pacientes o animales de laboratorio, incluidos los testigos).
Identifique los métodos, aparatos (nombre y dirección del fabricante entre paréntesis) y procedimientos con detalles suficientes
para que otros investigadores puedan reproducir los resultados.
Explique brevemente los métodos ya publicados pero que no son
bien conocidos, describa los métodos nuevos o sustancialmente
modificados, manifestando las razones por las cuales se usaron
y evaluando sus limitaciones. Identifique exactamente todos los
medicamentos y productos químicos utilizados, con nombres genéricos, dosis y vías de administración.
c) Resultados. Preséntelos siguiendo una secuencia lógica. No repita en el texto los datos de los cuadros o figuras; sólo destaque o
resuma las observaciones importantes.
d) Discusión. Insista en los aspectos nuevos e importantes del estudio. No repita pormenores de los datos u otra información ya presentados en las secciones previas. Explique el significado de los
resultados y sus limitaciones, incluidas sus consecuencias para
la investigación futura. Establezca el nexo de las conclusiones
con los objetivos del estudio y absténgase de hacer afirmaciones
generales y extraer conclusiones que carezcan de respaldo. Proponga nueva hipótesis cuando haya justificación para ello.
e) Referencias. Numere las referencias consecutivamente siguiendo el orden de aparición en el texto (identifique las referencias en
el texto colocando los números en superíndice y sin paréntesis).
Cuando la redacción del texto requiera puntuación, la referencia
será anotada después de los signos pertinentes. Para referir el
nombre de la revista utilizará las abreviaturas que aparecen enlistadas en el número de enero de cada año del Index Medicus. No
debe utilizarse el término “comunicación personal”. Sí se permite,
en cambio, la expresión “en prensa” cuando se trata de un texto ya
aceptado por alguna revista, pero cuando la información provenga
de textos enviados a una revista que no los haya aceptado aún, citarse como “observaciones no publicadas”. Se mencionarán todos
los autores cuando éstos sean seis o menos, cuando sean más
se añadirán las palabras y col. (en caso de autores nacionales) o
et al.(si son extranjeros). Si el artículo referido se encuentra en un
suplemento, agregará Suppl X entre el volumen y la página inicial.
La cita bibliográfica se ordenará de la siguiente forma en caso de revista:
Torres BG, García RE, Robles DG y col. Complicaciones tardías de
la diabetes mellitus de origen pancreático. Rev Gastroenterol Mex
1992;57:226-229.
Si se trata de libros o monografías se referirá de la siguiente forma:
Hernández RF. Manual de anatomía. 2ª ed. México: Méndez Cervantes, 1991;120-129.
Si se tratara del capítulo de un libro se indicarán el o los autores del
capítulo, nombre del mismo, ciudad de la casa editorial, editor del libro,
año y páginas.
11. Transmisión de los derechos de autor. Se incluirá con el manuscrito
una carta firmada por todos los autores, conteniendo el siguiente párrafo: “El/los abajo firmante/s transfiere/n todos los derechos de autor
a la revista, que será propietaria de todo el material remitido para publicación”. Esta cesión tendrá validez sólo en el caso de que el trabajo
sea publicado por la revista. No se podrá reproducir ningún material
publicado en la revista sin autorización.
Revista de Hematología se reserva el derecho de realizar cambios o
introducir modificaciones en el estudio en aras de una mejor comprensión
del mismo, sin que ello derive en un cambio de su contenido. Los artículos
y toda correspondencia relacionada con esta publicación pueden dirigirse
al e-mail: [email protected]
Author requirements
Manuscripts should be made following recommendations of the International Committee of Medical Journal Editors (N Engl J Med 1997;336:30915) and adjusted to the following guidelines:
1.
The document printed in letter size (21 × 27 cm) sheets must be delivered, using double-spacing, along with its with corresponding computer disk data and indicating the article’s title on the label, leading
author’s name and computer program with version. (e.g., Estrogen and
climaterium. Guillermo Martínez. Word 6.0).
Sections are ordered in the following form: page title, structured abstract, summary, introduction, materials and methods, results, discussion, references, tables and captions.
3. The maximum extension of originals will be 15 pages, for clinical cases
8 pages, and four for figures or tables. Reviews will not exceed 15
pages.
The first page will contain the full title of the article, not exceeding 85
characters, the names of the authors, services or departments and
institution(s) they belong to and the leading author’s address. If all the
authors belong to different services of the same institution, their name
will be mentioned only once at the end. Authors identification should be
done superscript Arabic numbers.
4. For identification, each page of the article should have, on the upper
left corner, the initial of the name and last name of the leading author,
and on the upper right corner, the consecutive page number.
5. All graphic material should be sent in slides, black-and-white, sharp
and clearly defined. In the slide frame write in ink the code word to
identify the article, the figure number, last name of the leading author
and with an arrow the top part of the figure will be marked. If the slide
includes material formerly published, it should come with the written
authorization of the copyright holder.
6. Graphs, drawings and other illustrations should be professionally
drawn or made by computer and attached in the same disk the text
writing is, on the label written the program used.
7. Tables (and non-charts) should be numbered with Arabic numbers.
Each should have a brief title; the footnotes will include explanatory
notes to clarify abbreviations poorly known. Do not use horizontal or
vertical inner lines. All tables should be quoted in the text.
8. Type of articles: the journal publishes original articles in the area of
clinical or laboratory research, editorials, review articles, biotechnology, case communications and letters to the editor. Articles are received
in Spanish and English languages.
9. Summary. The second page will include a summary, no longer than
250 words and will be structured in background, materials and methods, results and conclusions. Following this structure, purposes, basic
proceedings, methodology, main outcomes (hard data and statistical
significance), and most relevant conclusions. At the end of the summary there will be 3 to 10 keywords or sentences. Following this, an
abstract written in English will be provided.
10. Abstract. This is the right translation of the summary to English.
11. Text. Text should contain introduction, materials and methods, results
and discussion, if this is an experimental or observational article. Other
articles, like case communications, review articles and editorials will
not use this format.
a) Introduction. Briefly express the purpose of the article. Summarize
the logic grounds of the study or observation. Quote only strictly
pertinent references, without making a extensive review of the topic. Do not include data or conclusions of the job you are making
known.
b) Materials and methods. Describe clearly in the selection the way
you selected the observed subjects or those who participated in the
experiments (patients or laboratory animals, including controls).
Identify methods, devices (name and address of the manufacturer
in parentheses) and detailed procedures for others to reproduce
the results. Briefly explain formerly published methods which are
not widely known, describe new or substantially modified methods,
manifesting the reasons why you used them and assessing their
limitations. Identify every single medication and chemical product
used, with generic name, dose and route of administration.
c) Results. Present them following in a logical sequence. Do not repeat data from tables or figures within the text; just emphasize or
summarize the pertinent observations.
d) Discussion. Emphasize new and important aspects of the study. Do
not repeat details in the data or other information previously mentioned
in other sections. Explain the meaning of the results and their
limitations, including their consequences for future research. Establish
the connection of the conclusions with the study objectives and refrain
from making general statements and making conclusions without
support. Suggest a new hypothesis when it is justified.
e) References. Number the references consecutively following the
appearance order in the text (identify the references within the
text with superscript numbers without parentheses). When the text
needs punctuation, the reference will be annotated after the pertinent signs. To refer the name of a journal use abbreviations listed
every year in the January number of the Index Medicus. The term
“personal communication” should not be used. On the other hand,
it is allowed to use the expression “in press” when it refers to an
already accepted text by some journal, but when the information
comes from texts sent to a journal which has not accepted it yet, it
should be referred to as “non-published observations”. All authors
should be mentioned when there are six or less, when there are
more, add the words and cols. (in the case of national authors) or
et al. (if foreigners). If the cited article is located in a supplement,
add suppl X between the volume and the initial page.
In the case of a journal, bibliographic citations will be ordered in this
way:
Torres BG, García RE, Robles DG et al. Late complications of diabetes
mellitus of pancreatic origin. Rev Gastroenterol Mex 1992; 57:226-229.
In the case of books or monographs, reference will be:
Hernández RF. Anatomy manual. 2nd edition. Mexico: Méndez Cervantes, 1991; 120-129.
In the case of a book chapter, indicate the author(s) in the chapter, the
name of the chapter, city of the publishing house, the book’s editor,
year and pages.
12. Transfer-of-copyright. Along with the manuscript, deliver a letter signed by all the authors, with the following paragraph: “The undersigned
author(s) transfer all copyrights to the journal, which will be the holder
of all submitted material for publication”. This transfer will be valid only
in the case that the journal publishes the paper. No material can be
reproduced without the journal’s authorization.
13. We recommend to include citations from Mexican or Latin American
authors in the bibliographic references.
Hematologia reserves the right to make changes or include modifications
in the study in order of better understanding of such, without modifying its
content. Articles and all mailing relating with this publication should be [email protected]
dressed to the following e-mail: [email protected]

Documentos relacionados