Tesispopular! - Facultad de Minas

Comentarios

Transcripción

Tesispopular! - Facultad de Minas
ELEMENTOS DE ESTRUCTURA GENÉTICA DE POBLACIONES Y DE
PAISAJE: UNA APROXIMACION A LA CONSERVACION Y MANEJO EN EL
AREA DE PORCE
CARLOS FEDERICO ÁLVAREZ HINCAPIE
Facultad de Minas
Maestría en Medio Ambiente y Desarrollo
UNIVERSIDAD NACIONAL DE COLOMBIA SEDE MEDELLIN
Medellín, 2005
ELEMENTOS DE ESTRUCTURA GENÉTICA DE POBLACIONES Y DE
PAISAJE: UNA APROXIMACION A LA CONSERVACION Y MANEJO EN EL
AREA DE PORCE
CARLOS FEDERICO ÁLVAREZ HINCAPIE
Ingeniero Agrónomo, Especialista en Gestión Ambiental
Tesis para optar al Título de Maestro en Medio
Ambiente y Desarrollo
Director:
Brian C. Bock. Biólogo, Ph.D.
Co-Directora:
Sandra I. Uribe. I.A., M.Sc., Ph.D.
Asesor:
Andre Victor Lucci Freytas. Biólogo,
M.Sc., Ph.D.
Facultad de Minas
Maestría en Medio Ambiente y Desarrollo
UNIVERSIDAD NACIONAL DE COLOMBIA SEDE MEDELLIN
Medellín, 2005
DEDICATORIA
A las personas, ideas, elementos sustanciales y conceptuales que hacen posible la
exploración del espíritu individual, de la sociedad, de la naturaleza y del entorno, de una
manera libre, independiente y creativa, orientando los destinos individuales y colectivos
hacia un futuro sustentable, con esperanzas de mejora para un país y una gaia atormentados.
AGRADECIMIENTOS
A la Universidad Nacional de Colombia por su aporte formativo a través de sus recurso
administrativos, técnicos y excelentes docentes, así como por su apoyo con la beca de
estudios de posgrado.
Al grupo de Sistemática Molecular por hacer posible los primeros pasos en mi formación
como investigador y por hacer posible el desarrollo de la investigación a través del aporte
de recursos materiales y humanos de envidiable calidad.
A las entidades que facilitaron y aportaron al desarrollo del trabajo: DINAIN-Universidad
Nacional, DIME-Universidad Nacional, Colciencias, IGAC, Ingeominas, Oficina de
Catastro Departamental de Antioquia.
A Patricia Duque por su trabajo de inventario de mariposas en Porce y sus aportes, así
como al Museo Entomológico Francisco Luis Gallego de la Universidad Nacional de
Colombia sede Medellín, que hicieron posible el uso del material criopreservado para la
obtención de información molecular.
A Edgar Alberto Agudelo y Juan Camilo Restrepo por facilitar las imágenes digitales de la
zona producto de su trabajo de grado en ingeniería forestal.
A mis directores, escuchas pacientes y asesores dedicados: Brian C. Book y Sandra I.
Uribe, quienes con su incondicional entrega académica orientaron el trabajo hasta el final.
A Sandra por creer siempre en esta idea, cargarla en hombros, así como por empujar y
animar constantemente a un intenso y conflictivo pupilo.
A Brian y a Vivian por abrir mis ojos a la genética en la conservación.
A Luz Myriam Gómez, Andrés López Rubio, Alba Lucia Marín, Camilo Quintero por sus
horas diurnas y nocturnas de trabajo, apoyo, acompañamiento desinteresado y aporte crítico
a la investigación.
A Alejandro Marín, Juan David Suaza, Andrea Bedoya, Eduard Bejarano, Francisco José
Valencia, Roxana Paola Pineda por su trabajo y aportes.
A Andre Freytas, Giovanni Fagua, Keith Brown, Oscar Ortega, Mónica Morales, Esteban
Álvarez y Clara Villegas por sus necesarios y oportunos aportes.
A Clara por su incondicional acompañamiento y colaboración. Por su mirada tranquila y
serena.
A Carlos Guillermo, Cecilia, Juan y Juliana por su constante apoyo y comprensión en este
arduo proceso.
A Maria la Juana por su silenciosa compañía.
TABLA DE CONTENIDO
1.
INTRODUCCIÓN ........................................................................................................1
2.
OBJETIVOS..................................................................................................................3
2.1 General ....................................................................................................................... 3
2.2 Específicos ................................................................................................................. 3
3
HIPOTESIS DE TRABAJO ........................................................................................4
4-
CONSIDERACIONES INICIALES ...........................................................................5
5.
EL ÁREA DE PORCE: PERSPECTIVA HISTÓRICA ...........................................7
6.
MARCO CONCEPTUAL ............................................................................................9
6.1.
Ecología del paisaje y funcionalidad ecosistémica como base de trabajo para el
manejo ambiental................................................................................................................ 9
6.2.
Mariposas: modelo para estudios de conservación y gestión ambiental con énfasis
en ecosistemas fragmentados............................................................................................ 14
6.3.
Información genética y conservación: elementos para la gestión ambiental del
medio biótico en ecosistemas fragmentados..................................................................... 17
7.
8.
MATERIALES Y METODOS ..................................................................................23
7.1.
Área de estudio..................................................................................................... 23
7.2.
Especies de mariposas seleccionadas................................................................... 24
7.3.
Análisis del paisaje............................................................................................... 26
7.4.
Análisis Molecular ............................................................................................... 28
RESULTADOS Y DISCUSIÓN ................................................................................31
8.1.
8.1.1.
Análisis del patrón del paisaje.......................................................................... 31
8.1.2.
Conectividad Estructural: Corredores y Barreras Potenciales ......................... 37
8.2.
9.
Componente de paisaje ........................................................................................ 31
Componente Genético.......................................................................................... 40
CONCLUSIONES Y RECOMENDACIONES........................................................47
10. BIBLIOGRAFÍA.........................................................................................................51
LISTA DE TABLAS
Tabla 1. Coberturas empleadas en el análisis....................................................................... 26
Tabla 2. Variabilidad genética de Hypoleria vanilia y de Euptychia hermes...................... 44
Tabla 3. Diferenciación genética entre poblaciones de Hypoleria vanilia y de Euptychia
hermes ........................................................................................................................... 44
LISTA DE FIGURAS
Figura 1. Bosques de Interés particular para el estudio. ...................................................... 23
Figura 2. Hypoleria vanilia. Fuente: Ortega y Duque, 1998. .............................................. 25
Figura 3. Euptychia hermes. Fuente: Eubanks, s.f............................................................... 25
Figura 4. Cambios de las coberturas de bosque primario entre 1961 y 2001. ..................... 34
Figura 5. Red de drenajes en el área de estudio. .................................................................. 37
Figura 6. Drenajes, bosques primarios y secundarios. ......................................................... 38
Figura 7. Sistema de drenajes en bosques y rastrojo alto..................................................... 39
Figura 8. Sistema de drenajes en bosques, rastrojo alto y guaduales................................... 39
Figura 9. Barreras potenciales (vías, río y embalse) para la dispersión de organismos de
bosque............................................................................................................................ 40
ANEXOS
Anexo 1. Imágenes de coberturas del paisaje en la zona de estudio en las épocas 1961 y
2001 ............................................................................................................................... 67
Anexo 2. Índices del Paisaje Calculados ............................................................................ 71
Anexo 3. Descripción de índices del paisaje....................................................................... 73
Anexo 4. Secuencias de Haplotipos .................................................................................... 78
Anexo 5. Variación Haplotípica......................................................................................... 82
Anexo 6. Matriz de identidades de secuencias de Individuos............................................. 84
Anexo 7. Individuos empleados en al análisis molecular, haplotipo y procedencia........... 87
Anexo 8. Diferencias pareadas entre haplotipos .................................................................. 89
Anexo 9. Arboles de relaciones filogenéticos entre los conjuntos poblacionales............... 90
RESUMEN
El creciente impacto de las actividades humanas sobre los ecosistemas y la premura para
reducir los efectos nocivos de las transformaciones antrópicas requiere que la gestión
ambiental incorpore desarrollos recientes en diversas áreas del conocimiento, como la
Ecología y la Conservación molecular, que sugieren que la apropiación de la información
genética y del componente evolutivo del medio biótico, son elementos útiles en la gestión
ambiental especialmente en ecosistemas fragmentados.
En la presente investigación se recopiló y evaluó la información sobre el estado actual y
dinámica del paisaje de un área de 3021 hectáreas en Porce (Antioquia, Colombia) en la
cual se seleccionaron cinco parches de bosque primario para obtener información genética.
Empleando secuencias de ADN mitocondrial de un segmento de 503 pares de bases, se
analizó la subdivisión de poblaciones de dos especies de mariposas con capacidades de
dispersión alta (Hypoleria vanilia) y baja (Euptychia hermes), estimando la dispersión de
las mariposas en el área mediante el flujo de genes. Se analizaron de forma conjunta,
elementos de paisaje y genética de poblaciones, buscando aportar información relevante
para la gestión del área de estudio, interpretando el flujo de genes en relación con las
características del paisaje.
En un paisaje altamente dinámico, se encontró que la zona ha presentado un aumento en su
complejidad espacial debido a la disminución de la dominancia de los pastos ante los
estados sucesionales avanzados. Se determinó la existencia de potenciales corredores
biológicos a partir del análisis del paisaje, así como de unidades poblacionales de manejo, a
partir de la información con el marcador molecular. El fragmento de mayor tamaño
presentó alta diversidad genética y se reconoció la importancia de otros de menor tamaño
por sus características espaciales y composición genética.
A partir de los resultados obtenidos se considera que la incorporación de la información
genética en la toma de decisiones relacionadas con la intervención de los hábitats naturales,
es un elemento indispensable para lograr un desarrollo sustentable a partir de las estrategias
de gestión. Las especies con diferentes capacidades de dispersión y preferencias ecológicas
presentaron diferencias en su diversidad genética, que se relacionaron con el paisaje. Estos
elementos complementan el estudio actual de los efectos de la toma de decisiones sobre el
manejo en la zona y en los hábitats fragmentados.
Palabras claves
Fragmentación, genética del paisaje, mariposas, Hypoleria vanilia, Euptychia hermes, ADN
mitocondrial, Gestión ambiental, Genética de poblaciones, Porce
ABSTRACT
The increasing impact of human activities on ecosystems and the need to reduce the
noxious effects of transformations, requires the incorporation of recent developments of
diverse areas of knowledge, those include ecology and molecular conservation in the
environmental management. It has been suggested that the appropriation of genetic
information and the evolutionary component of biotic environment are useful elements for
the environmental management, specially in fragmented ecosystems.
This research evaluates the present status and the dynamics of 3021 hectares of a landscape
in Porce (Antioquia, Colombia). Five patch of primary forest where selected in order to
obtain genetic information using 503 base pairs of mitochondrial DNA. The subdivision of
populations was analyzed, in two butterfly species with high (Hypoleria vanilia) and low
(Euptychia hermes) dispersal capabilities. The butterfly dispersal in the selected area was
estimated using gene flow. Population genetics and landscape elements where conjointly
analyzed, in order to obtain relevant information for the study area and to interpret the gene
flow in relation with landscape characteristics.
In a highly dynamic landscape, the area presented an increasing spatial complexity, related
to the reduction in the grass dominance compared to advanced successional stages. The
presence of potential biological corridors was determinated by landscape analysis, as well
as population management units using molecular marker information. The largest forest
fragment presented high genetic diversity and the importance of smaller ones was
recognized by the spatial characteristics and genetic composition.
The results suggest that genetic information incorporation in decision making related with
natural habitat modifications is a necessary element to achieve sustainable development
management strategies. Species with different dispersal capabilities and ecological
preferences presented genetic differences related to landscape. These elements found
complement the actual studies of the effects of management in the particular area and in the
fragmented habitats in general.
Key words:
Fragmentation, landscape genetics, butterflies, Hypoleria vanilia, Euptychia hermes,
mitochondrial DNA, Environmental management, Population genetics, Porce
1.
INTRODUCCIÓN
Ante el creciente impacto de las actividades humanas sobre los ecosistemas y la premura
para reducir los efectos nocivos de las transformaciones antrópicas, la gestión ambiental ha
incorporado diversas áreas del conocimiento. Áreas de desarrollo recientes como la
Ecología y la Conservación molecular, sugieren que la apropiación de la información
genética y del componente evolutivo del medio biótico, son elementos útiles en la gestión
ambiental y en especial para ecosistemas fragmentados. Aspectos como la subdivisión de
las poblaciones y la dispersión de los organismos estimada como flujo de genes,
proporcionan información valiosa y complementaria a los inventarios de especies y análisis
de paisaje. Si bien los desarrollos prácticos de las áreas moleculares son relativamente
recientes, es frecuente su incorporación en estudios de conservación y su utilización para la
toma de decisiones.
Los estudios sobre las consecuencias de la fragmentación del paisaje en la viabilidad de las
poblaciones son prioritarios en conservación. De acuerdo con diversos especialistas, dichos
estudios no deben realizarse solamente para especies raras o en vía de extinción, si no
también para especies comunes y poblaciones locales. Esto es de vital importancia para
áreas con gran intervención antrópica y con patrones y procesos de paisaje relativamente
conocidos. Tal es el caso del área de influencia del embalse Porce II (Amalfi, Antioquia),
donde el bosque húmedo tropical, ha sido intervenido para el desarrollo ganadero desde
hace aproximadamente 150 años.
1
En la presente investigación se recopiló y evaluó la información sobre el estado actual y
dinámica del paisaje de un área de Porce y se exploró el estado de subdivisión de las
poblaciones de mariposas mediante un análisis molecular. Esto se realizó en un intento por
analizar de forma conjunta, elementos de paisaje y genética de poblaciones y aportar
información relevante para el área de estudio. Adicionalmente, con el ánimo de validar a
nivel local los estudios de paisaje y genética de poblaciones que la literatura plantea como
indispensables, pero ante los cuales por la complejidad, muchos investigadores son
escépticos en su aplicación.
El análisis de paisaje se realizó en un área de 3021 hectáreas que incluyen 17 parches de
bosque primario. Las mariposas, 34 en total, se obtuvieron de 5 fragmentos de bosque
primario. Estos parches se seleccionaron de forma que fueran representativos para las
variaciones de tamaño y distancia que se consideran de gran importancia en la subdivisión
de poblaciones de mariposas.
Se utilizaron dos especies de mariposas con capacidades de dispersión alta y baja, y se
realizó un estimativo de la dispersión de las mariposas en el área mediante el flujo de
genes. El flujo de genes depende de la dispersión, por lo tanto, se espera altos niveles de
diferenciación genética si la fragmentación está reduciendo o inhibiendo la dispersión. Los
efectos de la fragmentación, deberían también reflejarse en la distancia genética entre los
individuos y poblaciones de una especie presente en el paisaje. En general, para las
mariposas, se asume que mayores distancias geográficas, y medios hostiles deberían
originar mayores diferencias genéticas entre las poblaciones.
Se analizó de forma conjunta la conectividad genética entre las mariposas y la conectividad
física entre los fragmentos de bosque. Así mismo, se interpretó el flujo de genes en relación
con las características del paisaje que la literatura registra determinantes para las mariposas.
2
2.
OBJETIVOS
2.1 General
• Analizar la estructuración genética de dos especies de mariposas en el área de Porce en
relación con el paisaje y el estado actual de fragmentación.
2.2 Específicos
• Reconstruir y analizar la dinámica del paisaje en el área de influencia de la
hidroeléctrica Porce.
• Estimar el flujo de genes y la subdivisión poblacional de Hypoleria vanilia y Euptychia
hermes en el área y relacionarla con aspectos como el tamaño de los parches, la
complejidad y la conectividad del paisaje.
• Analizar la información desde las perspectivas de conservación y manejo en el área.
3
3
HIPOTESIS DE TRABAJO
La presente investigación estuvo orientada por dos hipótesis de trabajo independientes:
•
El paisaje afecta de manera diferencial a las especies según sus capacidades de
dispersión que se pueden cuantificar a partir del análisis de secuencias de ADN
mitocondrial.
•
Algunos fragmentos son puntos claves para comunidades de mariposas, siendo
prioritarios para fines de manejo y conservación.
4
4- CONSIDERACIONES INICIALES
Estas consideraciones se presentan a modo de referencia general y se relacionan con una
extensa revisión de literatura y aportes de especialistas en la conservación de mariposas que
asesoraron el proyecto. Estas consideraciones fueron de gran importancia para el
planteamiento del estudio.
• En un ecosistema fragmentado la configuración espacial y el aislamiento entre los
parches son de gran relevancia para la toma de decisiones sobre las estrategias de
conservación y manejo a largo plazo.
• La forma en la que el paisaje está estructurado y la distribución de los parches en el
paisaje, afecta la persistencia de las poblaciones nativas.
• Para las mariposas tropicales en ecosistemas fragmentados, hay un gran efecto de la
conectividad del paisaje, por lo cual identificar y conservar corredores de dispersión es
de gran importancia.
• Diversos estudios con mariposas que relacionan la estructura genética de poblaciones
con paisaje en ecosistemas fragmentados, sugieren que tanto las pérdidas de hábitat por
causas naturales como las actividades de manejo que alteran los estados sucesionales,
pueden originar pérdidas en la diversidad genética y ocasionar mayor subdivisión entre
las poblaciones.
• Al parecer, la mayoría de las especies de mariposas no pueden adaptarse fácilmente a los
últimos estados sucesionales y no “escapan” hacia habitats más favorables que
representen los estados sucesionales anteriores; en especial, si la diversidad genética no
se mantiene a escalas de paisaje adecuadas.
5
• En el caso de las mariposas, la distancia geográfica y el tamaño de los parches son
aspectos del paisaje que afectan la conectividad genética y el flujo de genes. Los efectos
son más drásticos para especies con poblaciones localizadas y con baja capacidad de
dispersión.
• Los análisis de estructuración genética de poblaciones con base en microsatélites y ADN
mitocondrial, permiten estimar los efectos de la fragmentación a escalas locales de
paisaje y aún para especies con alta capacidad de dispersión.
• Las poblaciones de mariposas más susceptibles al proceso de fragmentación, son
aquellas altamente localizadas y estructuradas que pueden dispersarse pero lo hacen
“localmente”.
• Al incluir elementos de la estructura genética de poblaciones de mariposas para el
manejo de ecosistemas fragmentados, debe darse prioridad a poblaciones grandes y bien
definidas en fragmentos grandes y estables.
6
5. EL ÁREA DE PORCE: PERSPECTIVA HISTÓRICA
Geográficamente la región de estudio hace parte del denominado Choco Biogeográfico
entre las regiones norte y nordeste del departamento de Antioquia. Esta región presenta una
temperatura promedia de 22.5°C con una humedad relativa de 83%, una precipitación
media de 3050 mm. Según la clasificación de Holdridge incluye tres zonas de vida: bosque
húmedo tropical, bosque muy húmedo premontano y la transición del bosque húmedo
premontano a tropical (Cano, citado por Pérez y Gutiérrez, 1996; Duque, 2000).
La zona donde se realizó el estudio está ubicada en el área influencia del proyecto
hidroeléctrico Porce II. Aproximadamente el 70% del área de protección del embalse que
corresponde aproximadamente a 3500 hectáreas se clasifica como bosque húmedo tropical.
Esta es un área reconocida como de alta riqueza biológica en el territorio antioqueño, en la
cual se han registrado endemismos de importancia para la conservación (E.P.M., 2000a).
En la región se ha presentado una colonización de vieja data, con registros de
asentamientos indígenas que superan los 9000 años y con actividad extractiva importante
registrada desde hace más de 100 años. Ha predominado la explotación minera, maderera,
la ganadería y algunos cultivos (E.P.M., 2000a; E.P.M., 2000b).
Debido al proceso histórico de explotación, en la actualidad el paisaje está fragmentado en
unidades boscosas de diferente tamaño y grado de intervención. Los fragmentos están
inmersos en una matriz de pastos y de regeneraciones secundarias en distintos estados
sucesionales, que se han desarrollado después de varias etapas de explotación (Agudelo y
Restrepo, 2004).
7
Los principales fragmentos de bosque primario se denominan Normandia, San Ignacio13 y
San Ignacio45, Tenche, El Encanto y Caiman. En general, aunque el bosque primario
intervenido (Bp) ha permanecido más o menos constante en el tiempo, la estructura del
paisaje sigue siendo fragmentada y se han originado grandes cambios en la forma y el
tamaño de los parches, la conectividad y la heterogeneidad del paisaje (Agudelo y
Restrepo, 2004).
De acuerdo con la información disponible, el último gran desmonte de la zona sucedió 40
años atrás, con la conversión de bosque primario a pastos en el sector de la Calandria
(Agudelo y Restrepo, 2004). El bosque San Ignacio 13 hacía parte del bosque Normandía
en 1961, posteriormente, entre 1962 y 1979 quedó aislado. En 1961, el bosque Encanto se
clasificaba como bosque secundario y en la actualidad, se considera bosque primario. Entre
1961 y 2001 el área de los bosques san Ignacio 45 y Normandía aumento en un 4,6 y 7 %
respectivamente, mientras que para el bosque Tenche, disminuyó en 1,4% La misma
tendencia fue observada para el perímetro. En primera instancia se puede afirmar que los
cambios descritos en esta zona de colonización han seguido presentándose y existe un
potencial significativo para el manejo de las unidades boscosas en aras de la conservación
de la biodiversidad (E.P.M., 2000a y E.P.M., 2000b).
8
6. MARCO CONCEPTUAL
6.1.
Ecología del paisaje y funcionalidad ecosistémica como base de trabajo para
el manejo ambiental
La ecología del paisaje es una ciencia interdisciplinaria que estudia las interdependencias
de los factores que modulan los paisajes como ecosistemas (Láser y Rodd, 1991). Se basa
en la premisa de que existen fuertes conexiones entre los patrones ecológicos y las
funciones y procesos (Gustafson, 1998). Así, en ecosistemas fragmentados, los corredores
de hábitat pueden funcionar como elementos conectores entre los parches facilitando el
movimiento de individuos entre ellos. De esta forma pueden contribuir a la dispersión y a la
persistencia de las poblaciones, en especial cuando la distancia entre los parches no permite
los movimientos diarios o estacionales (Wyser, 2003).
La ecología del paisaje considera el desarrollo y dinámica de la heterogeneidad espacial y
las interacciones e intercambios a través de paisajes heterogéneos, los cuales son de gran
importancia en el análisis y gestión integral de ecosistemas (Turner, 1989). Existen diversos
métodos para el estudio del paisaje en ecología. Estos incluyen las herramientas para la
colección y muestreo del ambiente biofísico, como los sensores remotos para obtener
imágenes satelitales, fotografías aéreas y los sistemas de posicionamiento global (Chuvieco,
2000).
Adicionalmente, se incluye el análisis e integración de datos espaciales o no, mediante
sistemas de información geográfica, estadística espacial o geoestadística y modelación. Por
9
último, existen diversos programas computacionales usados cada vez más para analizar el
patrón del paisaje (Liu y Taylor, 2002).
En el conjunto de herramientas para la gestión ambiental del medio biótico, se destacan la
simulación estadística de hábitats (Goigel, 1987; Guillot et al, 2004), el sistema de
valoración de hábitat (HES), el procedimiento de valoración de hábitat (HEP), el concepto
de complejidad biótica (Canter, 1998), los análisis de viabilidad poblacional (PVA)
(RAMAS, 2001), los modelos de paisaje neutros (Kimberly, 1997), compatibles además
con la aplicación directa de sistemas de información geográfica (SIG) (Villegas et al, 2000;
Naranjo et al, 2000, Alvarez et al, 2003), la planeación ecológica del paisaje (Cowell, 1998)
y el uso diversos indicadores (Westman, 1985; Ayala, 2001).
El estudio del paisaje puede incluir un componente estructural relacionado con los tipos,
número y ubicación relativa de los diferentes elementos y un componente funcional,
relacionado con el efecto que el paisaje o componentes particulares, tienen sobre los
organismos. La incorporación de ambos componentes puede resultar particularmente
informativa para alcanzar un conocimiento de las dinámicas del paisaje (Turner y Ruscher,
1988).
Los análisis de paisaje en ecosistemas fragmentados pueden servir para la evaluación de
medidas de gestión ambiental. Es posible por ejemplo, evaluar la efectividad de corredores
biológicos establecidos para fomentar la conectividad entre áreas de conservación o usarlos
como herramienta para la planeación o manejo (Diaz y Dieter-Guillwald, 2003; Alvarez et
al, 2000; Alvarez et al, 2003).
La fragmentación del paisaje es un proceso que cada vez cobra más importancia a nivel
mundial, ya que afecta la cantidad, la distribución, la ubicación espacial y la diversidad de
las coberturas y usos del suelo. Conjuntamente con la pérdida de hábitat, pueden influir
negativamente en la variabilidad poblacional de diversos organismos (Sawchik et al, 2002).
10
En términos generales, el fenómeno de la fragmentación puede entenderse como el cambio
en la configuración espacial de una estructura más homogénea a una menos homogénea
(Haila et al, 1993). La conversión de tierras no productivas a tierras “desarrolladas”
produce la fragmentación del hábitat natural, con el consecuente aislamiento y reducción de
las subpoblaciones y en forma global, afectando las dinámicas metapoblacionales, lo que
puede contribuir a aumentar el riesgo de extinción de las especies (Hedrick y Gilpin, 1997;
Lande, 1998; Frankham, 2003).
Los efectos de la fragmentación tienen repercusiones a corto y a largo plazo en las
poblaciones y comunidades (Kattan et al, 1994). En comunidades vegetales por ejemplo,
las repercusiones pueden evidenciarse siglos después de ocurrido el fenómeno de
perturbación (Metzger, 1998). Entre las consecuencias que ocasiona este proceso está la
división de poblaciones naturales previamente conectadas, generando efectos demográficos,
genéticos y evolutivos (Saunders et al, 1991; Haila et al, 1993; Lande, 1998; Kawata, 1997;
Thomas et al, 1998; Monaghan et al, 2002a; Monaghan et al, 2002b; Van Dyck y
Matthysen, 1999, Norberg y Leimar, 2002). El seguimiento de los cambios poblacionales
producidos por el proceso de la fragmentación es la mejor medida indirecta disponible para
el establecimiento de acciones de conservación. (Australian and New Zealand Environment
and Conservation Council, 2000).
La influencia de la estructura del paisaje en la prevalencia de las especies, depende de la
combinación de elementos propios de cada especie con los elementos del paisaje mismo
(Haydon y Pianka, 1999). Se ha encontrado que se requiere tener en consideración además
de los parches de hábitat propicios para los organismos, otros elementos como los hábitats
que rodean estos parches, así como la matriz en la que están inmersos y sus arreglos
espaciales, pues estos juegan un papel clave en las dinámicas de las poblaciones y
comunidades (Rengifo, 2001; Ricketts, 2001; Collinge et al, 2003).
11
Ya que la ecología del paisaje se enfoca en los patrones espaciales de los tipos de cobertura
y cómo afectan éstos los procesos ecológicos, es importante poder describir el paisaje de
forma cuantitativa (Donovan y Welden, 2002). El desarrollo de métodos para cuantificar
los sistemas ecológicos (ambientes heterogéneos) y el interés por el monitoreo y la
medición a escala del paisaje de los patrones y procesos ha propiciado recientemente una
“explosión” de medidas cuantitativas (Gustafson, 1998). Los métodos cuantitativos son
requeridos para comparar diferentes paisajes, identificar cambios significativos a través del
tiempo y relacionar los patrones del paisaje con funciones ecológicas (Turner, 1989).
El empleo de índices, indicadores u otras medidas subrogadas, puede servir para un
conocimiento rápido de la biodiversidad, asumiendo que es posible establecer una
correlación entre dichas medidas y la diversidad ecosistémica. Empero, es importante
recalcar que estas aproximaciones requieren trabajo de investigación básica, para establecer
los nexos ente la diversidad biológica y los indicadores particulares empleados (Sydney
Catchment Authority, 2000). Desde la perspectiva del paisaje, los índices se pueden
diferenciar en dos grandes categorías: espacial y la no espacial. La categoría no espacial
describe la composición e incluyen las medidas de número de clases de parches o
proporciones. Los índices espaciales describen los atributos de los parches y contiene
información relevante para medir la fragmentación (Rutledge, 1998). Pueden ser divididos
dentro de los que describen la composición, la forma y la configuración de los diferentes
componentes (parches) en el paisaje.
Los índices de composición describen características básicas del paisaje en términos de
tipos y cantidades de hábitat (Donovan y Welden, 2002). Son medidas de los atributos del
parche y no necesariamente tienen una base ecológica aunque algunas están relacionas con
el área requerida por un organismo particular (Rutledge, 2003). Algunos índices de
composición1son el número de parche (NP), el tamaño medio del parche (MPS), el parche
1
Los índices a los que se hace referencia en esta sección son fundamentalmente los presentados en el
programa Fragstats 3.3®.
12
más grande (LPI) y la densidad de parches (PD). Las fórmulas y detalles particulares
aparecen el en anexo 4.
Los índices de forma intentan cuantificar la complejidad de parche. Muchas medidas se
enfocan en alguna variación de las relaciones perímetro-área simple o referida a una forma
particular (cuadrado o círculo), otras como la dimensión fractal determinada por la
pendiente de la regresión logarítmica entre el perímetro y la forma de los parches del
paisaje (Rutledge, 2003). Algunos índices de forma son la relación perímetro-área (PARA),
la dimensión fractal (FRAC) y el índice de forma (SHAPE). Estos índices pueden ser
particularmente reveladores para entender los efectos de borde producidos por la
fragmentación, tal como han sido documentados para diversos grupos taxonómicos como
las plantas (Laurance et al, 1998).
Por su parte, las métricas de configuración y estructura del paisaje describen la posición
espacial de los diferentes hábitat en relación unos con otros (Donovan y Welden, 2002).
Los índices de configuración miden el grado de conectividad o aislamiento entre los
parches del paisaje, pueden ser divididos en dos categorías: índices basados en distancias
entre parches y los índices que comparan la “textura” de un paisaje (Rutledge, 2003).
Algunos de estos índices incluyen la distancia al vecino más cercano (ENN), la media de la
distancia al vecino más cercano (MNN), el índice de proximidad (PROX), la conectividad
(CONNECT), la cohesión (COHESION), la proporción de clase (PLAND) y el índice de
contraste de borde (ECON). En este punto es importante recalcar que la conectividad es en
cierta medida dependiente de cada especie, en el sentido de que lo que aparece conectado
para una especie, puede ser inalcanzable para otra (Ivits et al, 2002), por lo que estas
métricas deben ser tratadas con atención. Otros índices incluyen los de diversidad de
Shannon (SHDI) y Simpson (SIDI), así como los índices de equitatividad de Shannon
(SHEI) y de Simpson (SIEI).
13
Los índices del paisaje pueden ser empleados tanto para comparar diferentes zonas como
para realizar estudios de la dinámica temporal del paisaje en una región particular (Turner y
Ruscher, 1988). Los componentes del paisaje (como los tipos de coberturas, su cantidad y
distribución espacial, su ubicación fisiográfica, etc.) son cambiantes en el tiempo, tanto por
factores naturales, como por factores antrópicos y tales cambios afectarán la ecología y
evolución de las poblaciones (Donovan y Welden, 2002). Se requiere por tanto conocer la
historia de la evolución de propios paisajes para poder manejarlos adecuadamente para la
conservación de la naturaleza (Appelqvist et al, 2001).
6.2. Mariposas: modelo para estudios de conservación y gestión ambiental con énfasis
en ecosistemas fragmentados
Las mariposas aparecen como un excelente modelo para estudiar poblaciones estructuradas
espacialmente y se incluyen entre los organismos más útiles como indicadores de cambio
en los hábitats (Ehrlich y Myrphy, 1987; Kremen, 1992). Estos insectos cumplen funciones
diversas en los ecosistemas como defoliadores, descomponedores, polinizadores, presas u
hospederos de depredadores o parasitoides.
La dinámica de poblaciones en este grupo de insectos, se relaciona con el ecosistema por
las influencias sobre el ciclaje de nutrientes, las plantas y las relaciones depredador-presa.
Diferentes comunidades de plantas y regímenes de manejo del ecosistema producen
diferentes comunidades de mariposas, lo que las hace útiles para el seguimiento de la
dinámica de la biodiversidad que debe involucrarse en las diferentes practicas de gestión
(Miller et al, 2001).
Con base en numerosas investigaciones se sustenta la utilidad de las mariposas para indicar
la salud de los ecosistemas y evaluar los efectos de las prácticas históricas de manejo. Su
14
validez como modelo para el estudio de la fragmentación del hábitat es ampliamente
reconocida, en especial en relación con la subdivisión de poblaciones, metapoblaciones,
ecología y evolución de las mismas (Harrison et al, 1988; Singer y Ehrlich, 1991; Thomas
et al, 1998; Sawchik et al, 2002; Keyghobadi et al, 2003; Watt y Boggs, 2003).
En general, su utilidad en los estudios de fragmentación se relaciona con las características
de las poblaciones y su distribución en el paisaje. (Erhardt y Thomas, 1991; Hamer et al,
1997; Meyer y Sisk, 2001; Saarinen, 2002; Krauss et al, 2003). Desde la perspectiva
genética, por ejemplo, el uso de las mariposas se ha incrementado en los últimos años
realizándose investigaciones que han permitido entender como la fragmentación del habitat
reduce la migración, aumenta la pérdida de variabilidad en poblaciones pequeñas y afecta la
distribución de las poblaciones separadas geográficamente (Keyghobadi et al, 2003;
Hanski, 2003; Joyce y Pullin, 2003). En este sentido, los estudios de mariposas han
contribuido sustancialmente al desarrollo de la teoría de metapoblaciones y han permitido
entender en cuales aspectos las metapoblaciones reales difieren de los modelos propuestos.
La mayoría de las mariposas raras, amenazadas o en peligro de extinción presentan
poblaciones localizadas y relativamente cerradas, son sedentarias y los individuos que las
conforman pasan la mayor parte de su vida en el parche natal o en parches cercanos. Por lo
tanto, los esfuerzos de manejo y conservación deben enfocarse hacia poblaciones locales,
en especial cuando éstas ocupan parches de gran tamaño, donde las poblaciones son
relativamente estables (New et al, 1995; Harrison et al, 1988).
La mayoría de las especies de mariposas con poblaciones cerradas existen como
poblaciones locales interconectadas por dispersiones ocasionales. No obstante, en algunos
casos pueden persistir por la colonización de nuevos hábitats y la recolonización de
antiguos parches adecuados para su existencia. Otras especies presentan poblaciones
abiertas donde los adultos se dispersan ampliamente y habitan todos los parches disponibles
y por tanto, aunque las dinámicas naturales o las actividades humanas hayan removido
15
hábitats importantes para su sobrevivencia, son más hábiles en mantener poblaciones en los
parches. En este caso, su conservación depende de la protección de parches que incluyen
diferentes propiedades del paisaje (New et al, 1995; Sawchik et al, 2002).
Algunos autores consideran las mariposas como organismos “bandera” para la
conservación de invertebrados (Ehrlich y Murphy, 1987; New et al, 1995). Desarrollos
recientes con énfasis en especies de mariposas y manejo de especies con bases ecológicas,
ejemplifican el progreso en este sentido. Es de resaltar que aunque los insectos comprenden
más del 50% de todas las especies conocidas y son componentes esenciales de los
ecosistemas, estos constituyen un grupo relativamente ignorado en manejo y conservación.
Así, la conservación y manejo de insectos se ha desarrollado mayoritariamente en los
últimos 50 años. Al respecto, numerosos autores sugieren la necesidad de incrementar los
estudios experimentales y de diagnóstico en conservación y gestión para estos organismos
(Ehrlich y Murphy, 1987; Kremen et al, 1993; New et al, 1995; Ehrlich, 2003, Watt y
Boggs, 2003).
En mariposas propias de bosque presentes en ecosistemas fragmentados, el área, la forma y
la distribución de los parches de hábitat, afectan el comportamiento de estos organismos. Se
sugiere que para especies de ciclo de vida corto como las mariposas, puede darse una rápida
respuesta adaptativa a la fragmentación del hábitat, lo que implica reducciones progresivas
en la dispersión y aumentando la subdivisión y el efecto de la deriva. Comparaciones entre
las tasas de dispersión entre hábitats continuos y fragmentados para poblaciones de la
mariposa Proclossiona eunomia, mostraron que la dispersión entre los parches es
significativamente inferior en los paisajes fragmentados. Se infiere que tanto la
configuración espacial del paisaje, como el aislamiento de los parches de hábitat deben ser
tenidos en cuenta para el establecimiento de estrategias de conservación (Baguette et al,
2003).
16
Las modificaciones en la matriz del paisaje pueden proveer oportunidades para reducir o
aumentar el aislamiento de los parches. En mariposas de zonas inundadas propias de un
hábitat fragmentado, se encontró que la matriz donde están inmersos los parches de hábitat
puede influenciar significativamente el aislamiento efectivo de estos (Ricketts, 2001).
6.3.
Información genética y conservación: elementos para la gestión ambiental del
medio biótico en ecosistemas fragmentados
La gestión del medio biótico busca reducir los impactos ambientales producto de las
actividades de manejo sobre las diferentes especies, permitiendo el mantenimiento de las
comunidades y sus funciones ecológicas. El manejo y conservación del medio biótico desde
la perspectiva genética buscan conservar tanta variabilidad y diversidad genética como sea
posible. Esto con el fin de retener al máximo la capacidad adaptativa y el potencial
evolutivo de las especies. La biodiversidad debe ser considerada a diferentes niveles entre
los cuales está la diversidad genética (Gaston, 1996). Al respecto, la Unión Internacional
para la Conservación de la Naturaleza, ha señalado la necesidad de implementar estrategias
de manejo y conservación incluyendo este nivel para lograr un manejo efectivo del medio
biótico (UICN, s.f., UICN, 2002).
Esto implica reconocer que la diversidad biológica no es solo una consecuencia de la
ecología, sino que es en esencia un proceso ocurrido en el tiempo (Halffter, 2000). En este
sentido, el manejo de especies puede tener dos objetivos. En el corto plazo, se busca
minimizar el riesgo de extinción, mientras que a largo plazo se pretende promover
condiciones que mantengan el potencial de cambio evolutivo de las poblaciones sin un
manejo intensivo de las mismas (Akçakaya y Ginzburg, 1999). Para ambos objetivos, la
información genética es importante, si se considera que muchas actividades humanas
pueden reducir la diversidad genética, interrumpiendo o disminuyendo las capacidades de
17
adaptación, especiación y cambios microevolutivos. Este impacto en última instancia
reduce la biodiversidad en todos sus niveles (Templeton et al, 2001).
La genética de la conservación intenta cuantificar las diferencias genéticas entre
poblaciones, los niveles de parentesco, los niveles de flujo genético entre poblaciones, la
presencia de hibridización entre especies y/o las relaciones sistemáticas entre taxones
(Calcagnotto et al, 2001). Esto permite utilizar tales elementos para desarrollar actividades
de manejo como reproducción dirigida, translocaciones o identificación de unidades de
conservación (Marshall et al, 1999).
Para lograr un manejo efectivo, preservación y recuperación de cualquier especie, es
importante un conocimiento de los niveles históricos de diversidad genética que existen
dentro y entre poblaciones (Lentsch et al, 2000; Futuyma, 1998; Bohonak y Jenkins, 2003).
Con base en ello y de uso reciente aparece el concepto de Unidades Evolutivas
Significativas (ESU) que hace referencia a poblaciones o individuos históricamente
aislados con propiedades particulares. Al realizar un árbol filogenético, con base en
secuencias de ADN u otros datos los grupos o individuos más aislados presentarán más
diferencias en los atributos genéticos y un potencial evolutivo diferente. Este concepto se
considera como una componente para la toma de decisiones sobre prioridades de
conservación, Se ha sugerido orientar la conservación hacia los linajes mayores y no las
ramas filogenéticas menores (Rogers et al, 1996).
Es importante resaltar que desde la perspectiva económica, el concepto de capital natural
crítico (CNC) incluye la diversidad genética como un elemento indicador de los organismos
a conservar. El CNC aparece como un criterio de sostenibilidad y como un instrumento
necesario para el diseño de políticas de protección y manejo ambiental sostenibles. Su
presencia y participación en los procesos naturales, así como en los bienes y servicios
ambientales para las actividades humanas, es imprescindible para el mantenimiento de las
relaciones y funciones ecosistémicas. El CNC ha sido propuesto para la evaluación del
18
funcionamiento y resilencia ecosistémicos (Deutsch et al, s.f.), así como para el monitoreo,
planificación y toma de decisiones de gestión (Ekins et al, 2003; Lopera, 2003).
El estudio de la subdivisión de las poblaciones en ecosistemas fragmentados involucra la
descripción de la distribución de la variación genética en las poblaciones locales y en el
paisaje así como la estimación de parámetros como el de flujo de genes. Esto permite
realizar inferencias sobre el movimiento espacial de los individuos entre las poblaciones
como un indicativo de la dispersión y aproximarse a los procesos genéticos más
determinantes con relación al tiempo de establecimiento de las poblaciones (Gillet, 1999;
Keyghobadi et al, 2003). La hipótesis más aceptada, es que la fragmentación reduce la
migración, disminuye la variabilidad genética y facilita la formación de metapoblaciones.
Para medir los niveles y patrones de variabilidad genética puede utilizarse diversos tipos de
datos. Entre los más comunes están aquellos fácilmente observables en los organismos que
generalmente corresponden a aspectos medibles y que si son cuantitativos son llamados
datos morfométricos.
Los datos genéticos incluyen aspectos bioquímicos de los organismos como enzimas y
otros factores fisiológicos. Los datos genéticos más comúnmente usados son las diferencias
en isoenzimas llamadas aloenzimas. Estas enzimas se extraen fácilmente de los tejidos de
los organismos. Son de uso frecuente para estimar las características de las poblaciones y se
asume que se encuentran bajo un estricto control genético. Así, las diferencias en la forma
de cada enzima pueden interpretarse como diferencias genéticas entre los individuos
muestreados. Esta técnica se ha usado rutinariamente desde 1970 y dado que las enzimas no
están modificadas por el ambiente, las muestras que se toman a partir de diversas áreas
geográficas permiten realizar una interpretación genética sobre las poblaciones. El tercer
tipo de datos cuya disponibilidad y uso es más reciente, son los moleculares que provienen
de moléculas como el ADN o ARN. Estos se obtienen del núcleo, la mitocondria o los
cloroplastos de los organismos. El ADN se extrae de los tejidos de los individuos y la
variación entre los mismos puede medirse comparando patrones de variación de segmentos
19
del ADN o de sus secuencias. Como en las isoenzimas, las variaciones en el ADN, pueden
interpretarse directamente como diferencias genéticas (Moritz y Hillis, 1996).
Para el caso de la genética de la conservación, muchos estudios de poblaciones recientes se
realizan con ADN mitocondrial, ya que por evolucionar más rápidamente que el ADN del
núcleo, los datos derivados de la mitocondria reflejan las influencias más recientes sobre la
variabilidad genética. Además, permiten precisar los procesos locales y su relación con la
distribución geográfica (Rogers et al, 1996, Avise, 1996; Hoy, 1994; Futuyma, 1998). El
hecho de que el ADN mitocondrial revele de forma más fina los patrones geográficos de
variación, lo hace útil para relacionar la estructura genética de las poblaciones con la
estructura del paisaje como en el caso de ecosistemas fragmentados.
La utilidad de el ADN mitocondrial en estudios de poblaciones y su relación con la
distribución geográfica ha sido largamente documentada (Avise, 1996; Hudson et al, 1992;
Hudson, 2000). La teoría matemática que fundamenta esta utilidad, aparece descrita en
Avise (1996) y Futuyma (1998). Aunque hasta hace algunos años los estudios de
poblaciones con secuencias de ADN no se realizaban directamente con secuencias de ADN,
por los altos costos y especificidad en la manipulación, en la actualidad las secuencias se
usan directamente en el análisis de la estructuración de las poblaciones. El estimativo más
sencillo de realizar entre las secuencias de ADN es la divergencia entre las mismas, que se
correlaciona con la divergencia entre los individuos (Avise, 1996):
p = zd / zt. Donde:
zd: Número de nucleótidos que difieren entre dos secuencias.
zt: Número total de nucleótidos comparados.
Cuando se obtiene un número considerable de secuencias la distancia genética media
llamada diversidad nucleotídica se calcula como se muestra a continuación (Avise, 1996):
20
p (promedio) = ∑ fi * fj * pij. Donde:
fi y fj: Frecuencias de la i-esima y la j-esima secuencias en la muestra.
pij: Divergenecia estimada entre la i-esima y la j-esima secuencias.
Adicionalmente, es posible calcular la proporción de sitios nucleotídicos que difieren entre
dos secuencias y realizar estimaciones del flujo de genes con base en las divergencias entre
los genes particulares o alelos (Hartl y Clark, 1997):
k = 2µt. Donde:
µ: Tasa de mutación neutral.
t: Tiempo.
Como las secuencias son haploides por su carácter de herencia uniparental, los valores
calculados pueden interpretarse como distancias entre individuos en el locus. Fst aparece
como un indicativo de estas diferencias. De acuerdo con Hudson et al (1992) se estima
como:
Fst = 1 / (1 + 2Nm). Donde:
N: Número de individuos dentro de cada subpoblación.
m: Fracción de migrantes en cada subpoblación por generación.
A su vez, el estimador de Nm se denomina NmF y puede obtenerse así:
(Nm)F: ½ [(1/Fst) – 1]
De acuerdo con Hudson et al (1992), éste es el estimativo de flujo de genes más adecuado
para trabajos con secuencias de ADN mitocondrial, donde hay una diversidad nucleotídica
considerable y un tamaño de muestra pequeño. Otros estimativos de flujo de genes con base
21
en secuencias de ADN mitocondrial incluyen aproximaciones filogenéticas y el valor S
(Hudson et al, 1992, Hudson 2000).
La variabilidad genética representativa de un ambiente fragmentado, es decir los individuos
o poblaciones que reflejan la composición genética y la estructura, aportan elementos sobre
el ecotipo localmente adoptado. Las poblaciones más estructuradas, los genotipos menos
frecuentes, el flujo de genes entre los parches y las unidades filogenéticas que pueden estar
asociados o no con un gradiente ambiental, son aspectos del estudio de la genética de
poblaciones, que cobran significado para el manejo y gestión del medio ambiente (Rogers
et al, 1996). La dispersión de los individuos dentro de una población define la escala
espacial para la conservación y determina si las poblaciones son abiertas o cerradas.
22
7. MATERIALES Y METODOS
7.1.
Área de estudio
En las siguientes gráficas aparece la zona de estudio. La descripción de la zona se presentó
anteriormente. El área de estudio incluyó 3021 ha Se señalan los bosques denominados
Normandia, San Ignacio13, San Ignacio45, Tenche y Encanto, seleccionados para el
estudio molecular en virtud de sus condiciones bióticas, su tamaño y la diversidad de
lepidópteros previamente reportados por Duque (2000). En el siguiente gráfico se presentan
los bosques focales del estudio.
N
Figura 1. Bosques de Interés particular para el estudio.
23
7.2.Especies de mariposas seleccionadas
En el inventario preliminar realizado en Porce, la familia Nymphalidae apareció como una
de las más abundantes y diversas y por tanto de uso potencial para efectuar mediciones de
impacto a corto, mediano y largo plazo (Keith Brown, comunicación personal). Las
especies se seleccionaron a partir de recomendaciones de expertos nacionales e
internacionales (Giovanny Fagua, Universidad Javeriana; Keith Brown y Andre Victor
Lucci Freytas, Universidad de Campinas, Brasil), por sus diferencias ecológicas en sus
capacidades de dispersión. La primera especie fue Hypoleria vanilia Mielke y Brown, 1979
(Nymphalidae: Itomiinae), con una alta capacidad de dispersión y la segunda fue Euptychia
hermes Fabricius, 1775 (Nymphalidae: Satyriinae) con una dispersión baja. Debido a esto
resultan de importancia para la gestión ambiental del medio biótico, pues representan
diversas formas de respuesta de los organismos a las transformaciones y cambios en su
entorno como los ocurridos con la fragmentación de los bosques.
La subfamilia Ithomiinae es de origen neotropical, y sus adultos se encuentran a menudo en
el interior del bosque y muchas especies se encuentran adaptadas a las condiciones propias
de estos ambientes (Vélez y Salazar, 1991). En términos generales se consideran asociadas
a bosques, siendo sensibles a las discontinuidades del hábitat (Fox, 1949).
Morfológicamente son reconocibles por la transparencia de las alas que presentan la gran
mayoría de sus miembros, aunque muchas especies presentan manchas vistosas de
coloraciones naranjas, blancas y negras (Vélez y Salazar, 1991). Específicamente, H.
vanilia es una especie que puede presentar fenómenos de dispersión en grandes distancias y
que puede considerarse como propia de zonas boscosas, aunque se le puede ver
desplazándose en áreas relativamente perturbadas (Keith Brown, André Freytas,
comunicación personal). La especie se aprecia en la siguiente fotografía:
24
Figura 2. Hypoleria vanilia. Fuente: Ortega y Duque, 1998.
Por su parte la subfamilia Satyrinae es una de las más grandes dentro de los Nymphalidae,
ocupando diversas regiones y microambientes, lo que les ha permitido obtener una gran
variabilidad en tamaños y diseños alares. El carácter más representativo en el grupo, es la
presencia de uno o más manchas oculares, usualmente más visibles en la parte ventral de
las alas (Ehrlich and Ehrlich, 1961; Klimaitis, 2000; Freitas, 2001). Este grupo contiene
especies “generalistas”, presentes tanto en ambientes alterados y áreas abiertas, como en
ambientes mas preservados como los bosques (Andrade, 1994; Uribe y Salazar, 1998).
Euptychia hermes presenta poblaciones localizadas y tasas de dispersión limitadas (Emmel,
1970; Andrade, 1994; Araujo, 2000; Giovanny Fagua, Andre Freytas y Kitch Brown,
comunicación personal)). En la siguiente fotografía se aprecia esta especie.
Figura 3. Euptychia hermes. Fuente: Eubanks, s.f.
25
Los especimenes procesados en el presente estudio se depositaron en el Museo
Entomológico Francisco Luis Gallego de tal forma que sirvan como colección de referencia
y como fuente de trabajo para estudios posteriores. En el Anexo 8 aparece el listado de los
ejemplares utilizados para el análisis molecular, con su número de identificación y
procedencia.
7.3.Análisis del paisaje
Se desarrolló un análisis de la estructura del paisaje y su evolución a lo largo del tiempo.
Para el análisis se emplearon diversas fuentes: mapas topográficos (IGAC), fotografías
aéreas de 1961, escala 1:55.000 (facilitadas por INGEOMINAS Medellín), fotografías
aéreas de 1989, escala 1:20.000 (adquiridas en el IGAC), fotografías aéreas de 1999, escala
1:9.000 a 1:11.000 (facilitadas por Catastro Departamental de Antioquia) mapa de
cobertura vegetal de 1979 (EPM), información bibliográfica (E.P.M., 2000b) y datos de
campo de 1997-1998 (Duque, 2000; observaciones personales).
Desde una perspectiva cuantitativa se evaluaron diversos índices de paisaje, haciendo
énfasis en los relacionados con la composición, forma y estructura del paisaje, relacionados
con el proceso de la fragmentación. Se tomaron las coberturas empleadas por Agudelo y
Restrepo (2004), las que se referencian en la siguiente tabla:
Tabla 1. Coberturas empleadas en el análisis
Símbolo
Ra
Pr
P
Bs
Rb
Bp
G
C
E
I
Cobertura
Rastrojo alto
Pasto enrastrojado
Pasto
Bosque secundario
Rastrojo bajo
Bosque primario
Guadua
Cultivo
Embalse
Infraestructura
Tomado de Agudelo y Restrepo, 2004
26
Empleando el programa ArcView 3.2 ®, utilizando la cartografía digital de coberturas del
suelo en formato vector2, se construyó una capa digital en formato raster, con tamaño de
píxel de 5m. Este grid sirvió de insumo para el análisis de patrón de paisaje. Se tuvo como
referencia el área de influencia del proyecto hidroeléctrico Porce II, en especial los bosques
seleccionados.
El estudio involucró la evolución temporal del paisaje al incorporar datos de diferentes
épocas. Para esto se compararon los índices del paisaje de las dos épocas y se realizó una
superposición de ambas imágenes para determinar en que puntos del paisaje se llevaron a
cabo los cambios más significativos y relacionar esto con la fragmentación (similar a Apan
et al, 2000).
Para el análisis del patrón del paisaje, se escogieron los índices más relacionados con la
conectividad y la fragmentación de las coberturas boscosas, utilizando el programa
Fragstats 3.3® (McGarigal y Ene, 2001) especializado en el análisis de los patrones
espaciales en mapas categóricos. Igualmente, se calcularon algunos índices del paisaje a
partir de la extensión Patch Analyst de Arcview®, los cuales fueron empleados en el
análisis por su relevancia particular. En el Anexo 4 aparecen los índices detallados con sus
respectivas fórmulas.
Debido a la importancia que representan los relictos de bosque en zonas tropicales como los
valles interandinos, consideramos este tipo de cobertura como eje focal en el análisis del
paisaje. Fueron evaluados elementos del paisaje que pueden influir en la dispersión y
conectividad de las mariposas como posibles corredores biológicos, o como barreras para la
dispersión. Estos elementos fueron identificados a partir de los mapas temáticos en el
programa Arcview® (Agudelo y Restrepo, 2004).
2
Facilitados por Agudelo y Restrepo, 2004.
27
Los corredores se definieron como franjas o unidades homogéneas contiguas que pueden
ofrecer menor resistencia a la dispersión de organismos como la mariposa H. vanilia. Estas
unidades son las coberturas boscosas como el bosque primario y secundario (Bp y Bs),
rastrojo alto (Ra) y guaduales (G). Además estos corredores se asociaron a las redes de
drenajes, ya que ha sido reconocida su importancia para la movilidad de las mariposas. De
otro lado, se definieron las barreras como aquellas franjas o unidades que pueden ofrecer
mayor resistencia a la dispersión. Estas unidades representan elementos de carácter
antrópico como las coberturas de pastos enrastrojados y pastos limpios, además de
construcciones civiles como la carretera y el embalse.
7.4.
Análisis Molecular
Para obtener la información genética se utilizaron secuencias de ADN mitocondrial. La
selección de los genes a utilizar se basó en los resultados aportados por estudios previos de
genética poblacional y de tasas de evolución del gen que permiten identificarlo como de
utilidad para estimar la subdivisión entre poblaciones y el flujo de genes (Simmons y
Weller, 2001; Bejarano, 2001).
Se analizaron las variaciones en un segmento superior a 500 pares de bases que transcribe
cerca del 50% del citocromo b (Cytb), (Simon et al, 1994, Lougheed et al, 1999 y Caterino
et al, 2000). Para la extracción se utilizó el método del Grind Buffer, protocolos de Porter y
Collins (1991) modificados por Uribe (1999). Esta metodología se ha utilizado
ampliamente y con éxito para la extracción de ADN a partir de insectos de diversos órdenes
incluyendo lepidoptera. Además, se empleo un KIT comercial de extracción para algunos
ejemplares (DNA-Easy, Promega, Inc.). El ADN se extrajo de una pata con el fin de
preservar al máximo los ejemplares.
28
Un vez extraído el ADN, se amplificó usando el procedimiento de amplificación PCR
(reacción en cadena de la Taq polimerasa) Para esto, se utilizaron oligonucleótidos que
fueron diseñados con base en el alineamiento de secuencias obtenidas del GenBank de
varios invertebrados y en especial de Lepidóptera.
La secuencia de los cebadores utilizados es:
CB3FC: CA(T/C)ATTCAACC(A/T)GAATGATA
NINFR: GGTA(C/T)(A/T)TTGCCTCGA(T/A)TTCG(T/A)TATGA
Los productos de PCR se secuenciaron en ambos sentidos de la doble cadena de ADN
utilizando un secuenciador automático ABI 373 en el CDC de Atlanta gracias a trabajos
colaborativos. Las secuencias obtenidas fueron editadas utilizando el programa Bioedit ®
comparando las secuencias en ambos sentidos de la doble cadena para cada espécimen y
posteriormente construyendo la secuencia consenso a ser utilizada en el análisis.
Se comparó la variabilidad haplotípica con base en el polimorfismo del ADN. Esta
información sirvió para estimar el flujo de genes y la subdivisión según los criterios de
Hudson et al (1992) y Hudson (2000).
La diferenciación entre los individuos se determinó teniendo en cuenta la composición en
términos de nucleótidos, la proporción de Adenina-Timina y el número de sitios
polimórficos entre las secuencias. Para estimar la magnitud de la diferenciación se
utilizaron los estadísticos Fst para datos haploides (Roff y Bentzen, 1989; Hudson et al,
1992 y Hudson, 2000), empleando el programa DNAsp versión 4. Este valor se calcula para
estimar el promedio de flujo de genes de individuos muestreados de diferentes localidades
geográficas, con base en secuencias homólogas de ADN. Esta información conjuntamente a
la distancia entre fragmentos, fue analizada con la prueba de Mantel (usando el paquete
29
APE versión.1.4. del programa R versión 2.01) para determinar si había un relación entre
distancia geográfica y genética (Manel et al, 2003).
Se calculó la diversidad nucletídica theta, el valor neto de sustituciones nucleotídicas K y el
porcentaje de transversiones: cambios de purina por pirimidina y viceversa y transiciones:
cambios de purina por purina y/o pirimidina por pirimidina. Los estadísticos de
diferenciación también se calcularon a partir de la prueba de Fu y Li (DNAsp).
30
8. RESULTADOS Y DISCUSIÓN
8.1.
Componente de paisaje
En el anexo 1 se encuentran las imágenes de coberturas del paisaje en la zona de estudio en
las épocas 1961 y 20013. En el anexo 3 aparecen los índices del paisaje calculados por
Fragstats 3.3® (discriminados siguiendo Rutledge, 2003 por: composición, configuración y
forma). Adicionalmente, se presentan las métricas calculadas para la diversidad del paisaje.
8.1.1. Análisis del patrón del paisaje
Inicialmente se presenta una descripción de los índices de paisaje en la actualidad (imagen
del 2001) y luego se compara con el paisaje pasado (imagen de 1961).
8.1.1.1.
Paisaje actual (Imagen 2001)
Composición4
En el paisaje existen 17 parches de bosque primario (Bp), 65 de bosque secundario (Bs), 69
de rastrojo bajo (Rb) y 81 de rastrojo alto (Ra). La zona de embalse para la época fue una
cobertura preponderante (121 ha), dado que apenas comenzaba a llenarse el embalse. Sin
embargo, para cuando el embalse completó su llenado, esta cobertura se convirtió en
3
4
Fuentes digitales cortesía de Agudelo y Restrepo, 2004.
Ver Anexo 3.
31
preponderante (822 ha). Según el índice del parche más grande (LPI), el paisaje está
dominado por los bosques primarios (Bp), debido a la presencia del bosque Normandia. A
partir de la valoración del área (CA) de cada clase, se observa la prevalencia de rastrojos
(Ra: 732,7 ha y Rb: 579,3 ha) y bosques (Bp: 461,4 ha y Bs: 560,9 ha) en el paisaje. La
clase con tamaño medio de área mayor (AREA-MN) fue el Bp (60,83). Basado en esto,
parece que el paisaje en general puede ser considerado adecuado para especies de bosque.
A partir del índice de porcentaje de cobertura (PLAND), el tipo de cobertura vegetal que
proporcionalmente tiene una mayor preponderancia fué Ra con un 24%, seguido por Rb
(19%), Bp (18%), Bs (15%), teniendo las demás coberturas valores marginales. Aunque la
proporción de rastrojos (Ra +Rb) fue mayor (43%), el área de bosques (Bp+Bs) fue
igualmente significativa (33%).
En síntesis el paisaje actual está compuesto por diversos estados sucesionales de
regeneración, lo que podría favorecer el movimiento de mariposas de bosque como
Hypoleria vanilia, especialmente en área de Normandía-San Ignacio13 (ver el mapa
detallado en anexo 1).
Configuración5
El índice de configuración mas simple, la distancia euclidiana entre los parches, reveló que
los pastos (ENN: 237,3) y los bosques primarios (ENN: 236,2) fueron los que presentaron
una mayor distancia entre ellos, solo superados por los cultivos (por efecto de su
distribución y número). De manera consistente el índice del vecino más cercano6, medida
que índica el aislamiento de los parches, reveló que los pastos (MNN: 231,08) y los
bosques primarios (MNN: 229,92) fueron los que tenían un índice más elevado
(excluyendo a los cultivos por su número y ubicación espacial), lo que resulta de alta
criticidad para la conectividad y el mantenimiento de las estructuras poblacionales de
organismos asociados a estas coberturas particulares. Por el contrario, el índice de
5
6
Ver Anexo 3
Índice calculado con ArcView ® por aportar información relevante en el análisis.
32
conectancia muestra un nivel alto para coberturas como bosque primario (CONNECT: 6,6),
superado por los guadales debido a su bajo número y ubicación específica en redes de
drenaje cercanas.
Forma7
El índice de forma (SHAPE_MN) dá una aproximación a la complejidad de la forma de los
parches de cada clase. Este elemento es determinante, tanto en términos de la conectividad
funcional con otros componentes del paisaje, así como con las condiciones de interior de
cada parche. Como es esperable, los cultivos (C) y la infraestructura (I) tenían una forma
más regular (SHAPE_MN=1,4), siendo las coberturas más complejas en términos de su
forma los diversos estados sucesionales (Pr, Ra, Rb, Bs y Bp). Esto resultó concordante con
el análisis de la dimensión fractal (FRACT), otra métrica de complejidad de la forma de las
coberturas, donde aquellas de carácter netamente antrópico (cultivos e infraestructura)
presentaron formas más simples, como ha sido reportado previamente (Turner y Rushler
1988; McGarigal y Marks, 1994).
8.1.1.2.
Dinámica del paisaje durante el período 1961-2001
Debido a su relevancia para el trabajo, en la figura 4 se presentan los cambios sufridos por
la cobertura de bosque primario en la zona durante el período de estudio.
7
Ver Anexo 3
33
CONVENCIONES
Rio Porce
LEYENDA
Bp_2001
Bp_1961-2001
Bp_1961
N
Figura 4. Cambios de las coberturas de bosque primario entre 1961 y 2001.
Los cambios globales de las coberturas de bosque en la zona muestran que en el período de
estudio éstos han conservado su forma y distribución espacial. Sin embargo, algunos
fragmentos que pudieron tener un papel como conectores en la vertiente norte de la
quebrada la Cancana han desaparecido. El bosque Normandía ha fortalecido sus nexos con
los conjuntos de bosques al sur, los que a su vez se conectan en una escala mayor con
masas boscosas de considerable extensión (revisión fotografías aéreas de 1999). Un cambio
significativo fue la separación del bosque San Ignacio del bosque Normandía, lo que
implico una pérdida considerable de cobertura boscosa. Sin embargo, en la actualidad estas
unidades boscosas se encuentran conectadas por bosques secundarios, lo que puede
favorecer la dispersión entre ellos. De un porcentaje de cobertura de bosque primario
(PLAND) en 1961 del 16,5%, se conservó para el 2001 un 15,2%. Adicionalmente, el
bosque Encanto pasó de ser un Bs a un Bp debido al proceso de sucesión continuado.
Se dio un aumento en el número de parches de 141 a 371, contribuyendo a un aumento en
la complejidad paisajística. Partiendo de un escenario dominado por pasturas en 1961,
todos los índices de diversidad se incrementaron consistentemente con el aumento en el
número de parches, así en la tendencia a una mayor equitatividad en las áreas de los
parches de las diferentes clases. Los índices de equitatividad aumentaron paralelamente a la
34
disminución en la dominancia del paisaje de las pasturas, fenómeno relacionado con el
avance del proceso sucesional en el área. Agudelo y Restrepo (2004) adoptaron en la
construcción de los mapas de coberturas vegetales un lapso superior a 40 años de sucesión
para alcanzar la categoría de bosque primario.
Composición
En 1961, el paisaje estuvo dominado por pastos (CA: 2028 ha, PLAND: 67 %) y bosques
primarios (CA: 499 ha, PLAND: 18,5%) y se paso en el 2001 a un paisaje dominado por
los rastrojos y bosques secundarios. Aunque se presentó una leve disminución en la
cobertura de bosque primario (CA: 499 ha en 1961 a CA: 461 ha en 2001), los bosques
secundarios (que pueden favorecer la dispersión de algunas de las especies de bosque)
aumentaron, pasando de ser una cobertura poco representativa en 1961 (CA: 76 ha,
PLAND: 2,5 %) a ser una de las dominantes en el 2001 (CA: 560 ha, PLAND: 18,5 %).
Este proceso general de avance de la sucesión puede relacionarse a una disminución de la
actividad ganadera en la zona, combinado con el establecimiento del proyecto
hidroeléctrico Porce II, cuya zona de embalse representó un nuevo tipo de cobertura, junto
con el de guadua (CA: 114 ha, PLAND: 3,7 %). Patrones similares han sido reportados tras
el abandono de zonas de cultivo (Turner y Rusher, 1988). A la vez que se está
desarrollando la sucesión, se está incrementando la heterogeneidad espacial pasando de 141
parches en 1961 a 321 en el 20018.
El índice del parche más grande ilustra el debilitamiento de los pastos durante el período de
estudio, ya que se pasó en 1961 de un dominio de los pastos (LPI: 62,3%), seguido de lejos
por los bosques primarios (LPI: 8,1%), a una situación en el 2001 donde el tamaño de los
pastos se ha reducido significativamente (LPI: 2,1 %), mientras que el índice se incrementó
para los bosques primarios (LPI: 8,8%).
8
Es importante recalcar que las imágenes digitales de 1961 y 2001 fueron construidas a partir de información
diferente (fotografía e imagen satelital), por lo que se debe tener cuidado con las inferencias realizadas.
35
Los efectos de la fragmentación en el tamaño poblacional de especies de bosque pueden ser
limitados cuando no hay una remoción selectiva de hábitat (Bender et al, 1998). En el área
de estudio este caso, la relativa constancia en el número y las dimensiones de los parches de
bosque, sugieren que para las poblaciones residentes en estos no ha existido una reducción
poblacional debida a las transformaciones del paisaje durante el lapso de estudio. Sin
embargo, debe confirmarse esta asunción a partir de estudios demográficos, ya que ha sido
reportado que fluctuaciones en el tamaño poblacional son comunes en poblaciones
naturales de algunas especies (Frankham, 1995).
Configuración
En su configuración el paisaje evidenció un cambio en el período de estudio. De un lado, el
nivel de aislamiento de los bosques primarios aumentó levemente, al considerar una medida
simple como la distancia euclidiana (ENN_MN: 228,17 a ENN_MN: 236,2). Si se
considera una medida mas compleja, como el índice de proximidad, el aislamiento de los
bosques parece haberse reducido (PROX_MN: 45,9 en 1961 a PROX_MN: 151,7 en
2001)9. Esto concuerda con el índice de conectancia (CONNECT), lo que refuerza la idea
de que la conectividad ha aumentado para las coberturas de bosques primarios y
secundarios, y que la fragmentación ha disminuido, particularmente para bosques
secundarios.
Forma
Ya que el área de los bosques primarios se ha mantenido relativamente constante, es
factible calcular el índice de relación perímetro/área para determinar la complejidad de los
bordes (lo que se relacionará con los efectos de borde y área efectiva para los parches). En
el período de estudio, la complejidad de la forma en los parches de bosque aumentó
(PARA_MN: 307,57 a PARA_MN: 1037,64), lo que podría considerarse crítico para los
9
Asumiendo una circunferencia de radio de 125 m en alrededor de los bosques, considerada como una
distancia conservadora en cuanto a las posibilidades de dispersión de la mayoría de especies de mariposas.
36
organismos de bosque, por la reducción potencial del área de interior efectiva de cada
fragmento. Sin embargo, un índice más complejo indicó que la forma de los bosques
primarios se mantuvo relativamente constante entre 1961 y 2001 (SHAPE_MN: 1,97 a
SHAPE_MN: 1,93), pero aumentó en los bosques secundarios (SHAPE_MN: 1,6 a
SHAPE-MN: 2,1), así como en otros estados sucesionales diferentes a pastos. Turner y
Rusher (1988) señalaron que los usos del suelo que están menos influenciados por
actividades humanas tienden a tener una complejidad mayor en su forma. Esto concuerda
con la tendencia a la disminución de la explotación ganadera en la zona.
8.1.2. Conectividad Estructural: Corredores y Barreras Potenciales
Al superponer la red de drenajes con las coberturas de bosque primario y bosque
secundario, se encuentra una unidad relativamente continua en la vertiente sur de la
quebrada la Cancana, mientras que la vertiente norte aparece más fragmentada (Figuras 5 y
6). Se ha reconocido la importancia del agua permanente para las comunidades de
mariposas tropicales (Brown y Freytas, 2002).
N
Figura 5. Red de drenajes en el área de estudio.
37
CONVENCIONES
Rios
Drenajes
LEYENDA
Bosque primario
Bosque secundario
N
Figura 6. Drenajes, bosques primarios y secundarios.
Las redes de drenaje acompañados por bosques y rastrojos sugieren la existencia de
corredores de ribera (stream corridors) que normalmente poseen estructuras dendríticas
formadas por la intersección de estrechos ramales en la parte alta del cauce y ramales más
amplios en las partes bajas. Esta estructura permite la movilidad de organismos dispuestos a
ingresar a coberturas elongadas (Forman y Godron, 1986). Es así como se identificó una
conexión física entre los parches de bosque primario Tenche y Encanto por el corredor que
forma la quebrada La Frijolera y el drenaje adyacente. Para el bosque Normandía se dio una
conexión con el parche San Ignacio, ya que gran parte de la vertiente sur de la quebrada La
Cancana esta conformada por bosque secundario, estableciendo un área continua y extensa
de cobertura boscosa adyacente al bosque primario. Posiblemente, facilitando también la
dispersión de organismos. En 1961 estos parches pertenecían a una misma unidad de
bosque primario. Al anexar los rastrojos altos la vertiente sur de la quebrada La Cancana,
estas etapas sucesionales conforman casi la totalidad de la cobertura vegetal del área, es
decir conforman una unidad que puede ofrecer baja resistencia para la dispersión de
mariposas. Forman y Godron (1986) denominaron estas formas espaciales corredores
amplios “strip corridors”, los cuales contienen pequeños parches de hábitat interior por los
cuales las especies que evitan bordes pueden dispersarse. Ya que gran parte de los
corredores potenciales en el área de estudio puede mostrar efectos de borde, organismos de
bosque como la mariposa Hipoleria vanilia, posiblemente solo utilizan rastrojos altos para
su dispersión.
38
CONVENCIONES
Rios
Drenajes
LEYENDA
Bosque primario
Bosque secundario
Rastrojo alto
N
Figura 7. Sistema de drenajes en bosques y rastrojo alto.
La distribución de los Guaduales (G), dispersos en la vertiente norte de la quebrada La
Cancana, en su mayoría asociados a drenajes, por el objetivo de su plantación de establecer
zonas de protección para las quebradas en áreas que históricamente tuvieron alta presión
antrópica. En esta vertiente se conforma un corredor más disperso y diverso que el de la
vertiente opuesta de la quebrada. El bosque San Ignacio45 aparentemente evidencia un
mayor aislamiento relativo a los demás, ya que se encuentra inmerso en una matriz de
coberturas hostiles, como pastos limpios, pastos enrastrojados y rastrojo bajo (Figura 9), sin
embargo su posición espacial potencialmente podría servir como conector entre la unidad
Normandía-San Ignacio13 y la unidad Tenche-Encanto.
CONVENCIONES
Rios
Drenajes
LEYENDA
Bosque primario
Bosque secundario
Rastrojo alto
Guadual
N
Figura 8. Sistema de drenajes en bosques, rastrojo alto y guaduales.
El embalse lleno puede representar una barrera significativa (con una longitud máxima
aproximada de 2 Km. de espejo de agua entre las dos vertientes de la quebrada La
39
Cancana), aislando de manera importante el bosque Normandía del conjunto TencheEncanto. La construcción del embalse no afectó los corredores antes existentes, ya que
inundo las laderas (en mayor grado de la vertiente norte) y el cauce de la quebrada La
Cancana donde las coberturas correspondían principalmente a pastos limpios, pastos
enrastrojados y rastrojos bajos. La vertiente opuesta se afectó en menor grado debido a sus
características topografías (pendientes mayores).
CONVENCIONES
Rios
Drenajes
Vias
Embalse
LEYENDA
Bosque primario
Bosque secundario
Rastrojo alto
Guadual
N
Figura 9. Barreras potenciales (vías, río y embalse) para la dispersión de organismos
de bosque.
8.2.
Componente Genético
8.2.1. Flujo de genes y subdivisión poblacional de las mariposas en el área
A partir de la extracción y amplificación del ADN mitocondrial, se obtuvieron secuencias
nucleotídicas con longitudes entre 503 y 550 pares de bases, en un total de 35 mariposas, 22
de Hypoleria vanilia y 13 de Euptychia hermes. La identidad y homología de las secuencias
de ADN se verificó utilizando como secuencia referencia la de Bombix mori (Lepidoptera:
Bombycidae) cuyo genoma completo se encuentra publicado en el banco de genes
GENBANK (http://www.ncbi.nlm.nih.gov/, Código de acceso: AB08339). Al realizar el
alineamiento entre las secuencias provenientes de las mariposas del estudio con la
secuencia del banco de genes, se comprobó que correspondieron a la región del extremo
3´del gen Citocromo B.
40
La edición de las secuencias se realizó mediante el programa Bioedit ®. Posteriormente, y
con base en el alineamiento de las secuencias, se definió 503 pb como el número de
caracteres útiles para el análisis. Los alineamientos para ambas especies aparecen en el
anexo 5. Las comparaciones se realizaron entre las secuencias de los individuos en términos
de sustituciones nucleotídicas. Para efectos de simplicidad, las sustituciones se
mencionarán en adelante como cambios entre las secuencias. Las sustituciones o cambios
pueden ser: de un nucleótido por otro, conocidos como transiciones o transversiones;
ausencia de un nucleótido respecto a la secuencia comparada, conocidos como delecciones;
o inserciones cuando aparece un nucleótido más en una posición al comparar dos
secuencias. El tipo de cambio refleja las diferencias entre los individuos y las poblaciones.
En general, las transiciones son predominantes al comparar unidades evolutivas cercanas.
Para el caso de Hypoleria vanilia, especie con mayor capacidad de dispersión, la
divergencia entre las secuencias fue de 2.33%, encontrándose 78 cambios, de los cuales 45
(57,7%) correspondieron a transiciones 13 (16,6%) a transversiones y 20 (25,6%) a
inserciones. Para Euptychia hermes, con menor capacidad de dispersión, la divergencia
entre las secuencias fue de 7.81%, encontrándose 145 cambios, de los cuales 65 (44,8%)
correspondieron a transiciones, 35 (24,1%) a transverisones y 45 (31,1%) a inserciones o
delecciones.
Al realizar el análisis de las secuencias de cada individuo, aquellas que se diferenciaron de
otra en al menos un cambio se identificaron como un haplotipo. Tanto el número de
haplotipos como los cambios entre estos son indicativos de la diversidad y de la
diferenciación entre los individuos y las poblaciones que representan. Para la especie con
mayor capacidad de dispersión (Hypoleria vanilia) se encontraron 6 haplotipos y para
aquella con menor dispersión (Euptychia hermes) se encontraron 4 haplotipos. Aunque el
número de haplotipos fue mayor en la especie con mayor dispersión, el número de cambios
41
entre los haplotipos fue mayor en la otra especie. La variación haplotípica aparece en el
Anexo 6.
Al comparar los haplotipos de la especie con mayor dispersión, se encontraron 12
sustituciones de nucleótidos, de éstas, solo dos se presentaron en las terceras posiciones del
codón, siete en segundas posiciones y tres en la primera posición. En la otra especie, se
encontraron 19 cambios entre los haplotipos de los cuales ocho correspondieron a terceras
posiciones del codón, cuatro a segundas posiciones y siete a primeras posiciones. Al
considerar las inserciones y /o deleciones estas fueron mayores en la especie con menor
capacidad de dispersión. En el anexo 7 se observa la matriz de distancias genéticas
calculadas con base en el modelo de Kimura dos parámetros y en el anexo 9 se presentan
las comparaciones pareadas entre haplotipos.
En la distribución de algunos de los haplotipos en el paisaje algunos presentan localización
geográfica, en especial los de la especie con menor dispersión. En esta los haplotipos 1 y 4
fueron los más ampliamente distribuidos, el haplotipo 2 sólo se encontró en Normandia y
Encanto y el haplotipo 3 sólo se encontró en San Ignacio. El haplotipo 3 fue el más distante
y el menos frecuente. Los haplotipos más comparables fueron el 1 y el 4, ambos ubicados
en San Ignacio 13 y Encanto.
Para la especie con mayor dispersión, el haplotipo 6 sólo se encontró en el fragmento
Tenche, el haplotipo 4 sólo en el Encanto y los haplotipos 2 y 5 sólo en Normandía. Los
haplotipos 4, 5 y 6 presentaron una baja frecuencia, con los haplotipos 1 y 3 ampliamente
distribuidos. Los más similares, fueron los haplotipos 1 y 5, ambos ubicados en Tenche,
Encanto y Normandía. El haplotipo 3 fue el que se encontró en el mayor número de
individuos y el más distante de los demás. Asumiendo la dispersión como el elemento
responsable de la distribución de los haplotipos, este haplotipo podría ser una variación de
un haplotipo ancestral que ha dispersado a la mayoría de los fragmentos. La distribución de
los haplotipos por especie se detalla en el anexo 8.
42
Para realizar los estimativos de flujo de genes, inicialmente se realizó la prueba de Tajima
para evaluar la neutralidad del marcador y verificar que el polimorfismo encontrado no está
siendo mantenido por selección. Este estimativo fue consistentemente no significativo (P
mayor que 0.1). El estadístico Fu y Li´s arrojó resultados similares. Para estimar el flujo de
genes y la subdivisión poblacional, se consideraron los bosques Normandia y San Ignacio
13 como una sola unidad, ya que en 1961 constituían una unidad que se separó antes de
1979 y volvió a conectarse por rastrojos y bosques secundarios entre 1989 y 2001 (ver
análisis del paisaje). Esta unidad representó para el análisis el área de mayor tamaño con
293,3 ha. También se compararon los dos bosques componentes de esta unidad entre si. La
segunda unidad fue Tenche-Encanto, representando fragmentos pequeños y muy cercanos
(25,88 ha y 7,53 ha, separados por 0,85 Km.). Esta unidad esta separada de los demás
fragmentos por 1,95 Km. de Encanto a Normandia y 3,79 Km. a San Ignacio45. En el
anexo 2 se presentan las distancias euclidianas entre los fragmentos. Además de la corta
distancia entre estos, los conecta un corredor relacionado con la quebrada La Frijolera y el
drenaje adyacente, así como diferentes estados sucesionales avanzados. El bosque San
Ignacio45 se consideró como otra unidad, ya que aunque se encuentra separado de
Normandia y San Ignacio13 por una distancia relativamente corta (0,260 Km.), se
encuentra en un área diferente, pues está separado por la quebrada La Cancana, una
carretera y pastos establecidos desde vieja data. Su tamaño se encuentra en un rango medio
en relación a las otras unidades. Las tablas 2 y 3 presentan los parámetros estimados para
Hypoleria vanilia y para Euptychia hermes que se definen como:
•
Theta= Número de sitios segregantes en la muestra (Tajima, 1993, Ecuación 3).
•
Fst: Diferenciación genética entre las poblaciones (Hudson et al, 1992, Ecuación 3).
•
Pi= Diversidad nucleotídica correspondiente al número promedio de diferencias
nuclotídicas por sitio en dos secuencias (Nei, 1987, Ecuación 10.6).
•
K= Número promedio de sitios polimórficos (Hartl y Clark, 1997).
43
Tabla 2. Variabilidad genética de Hypoleria vanilia y de Euptychia hermes.
Población
Normandia-San Ignacio 13
Tenche-Encanto
San Ignacio 45
H. vanilia
Pi
K
E. hermes
Pi
K
0.0504 2.5 0.02718 13.53
0.00533 2,64 0.02677 13.33
0
0
0
0
Tabla 3. Diferenciación genética entre poblaciones de Hypoleria vanilia y de Euptychia
hermes
H. vanilia
Comparación
E .hermes
Theta
Fst
Theta
Fst
Normandia-San Ignacio13/ Tenche-Encanto
0.00302
0.02857
0.01916
-0.07119
Tenche-Encanto/ San Ignacio45
0.00609
0.11900
0.01512
0.444
Normandia-San Ignacio13/ San Ignacio45
0.00032
0.37500
0.001899
0.248
Los valores de Pi sugieren moderada variabilidad entre los individuos de Normandia-San
Ignacio para la especie con mayor dispersión para la mayoría de las comparaciones en la
especie con menor dispersión. El valor de cero para San Ignacio 45 se debe a que los
individuos muestreados tenían el mismo haplotipo.
Los valores de Fst mayores a 0.135 son indicativos de restricciones de flujo de genes y
valores mayores como el de 0.444 para Euptychia hermes entre Tenche-Encanto y San
Ignacio45 indican casi ningún flujo (de acuerdo a otro estudios realizados con insectos,
incluyendo mariposas, a escalas geográficas amplias comparadas con las del presente
estudio (Rogers et al, 1996).
En general, se documentó mayor restricción al flujo genético entre unidades en la especie
con menor dispersión, con excepción de Normandía-San Ignacio 13 y Tenche-Encanto. Al
recalcular los índices comparando sólo dos grupos geográficos, norte y sur, se encontró
evidencia de una restricción al flujo genético entre grupos. La contribución de la distancia a
44
la diferenciación fue evaluada usando el modelo de aislamiento por distancia (Wright 1946;
Wright, 1951; Slatkin 1987), el cual asume que la migración ocurre con igual probabilidad
en todas las direcciones en un espacio bidimensional y que la distancia es el principal
determinante de la diferenciación. El test de Mantel (1967) fue empleado para inspeccionar
dicho efecto y no se encontró influencia de la distancia en la diferenciación entre unidades
para ninguna de las especies. Para estimar de forma adicional la subdivisión entre las
poblaciones Siguiendo las recomendaciones de Slatkin y Maddison (1989) y Hudson
(2000), se realizó un método de análisis cladístico (usando el programa PAUP, versión
4.0B 10, Swofford, 1990). Este aplica un algoritmo de parsimonia para hallar el mejor árbol
del gen. De acuerdo con la teoría de la coalescencia, si las poblaciones no tienen
restricciones al flujo genético, no se esperaría evidencia de divisiones o CLADES
profundos en el árbol. Si los niveles de flujo genético se acercan a cero, las muestras
formarán un solo clado en un árbol sin raíz. Los árboles se encuentran en el anexo 10.
Los árboles indican que, aunque existe evidencia de restricciones de flujo genético, no han
sido lo suficientemente grandes como para originar clades con localización geográfica
explícita. No obstante, se evidencia una mayor restricción de flujo en Euptychia hermes.
Para esta especie el haplotipo más basal correspondió al haplotipo 1. En la topología hay
tres clados derivados de este haplotipo: los haplotipos 2, 3 y 4, siendo el último el más
derivado y el más distribuido en las poblaciones.
Para Hypoleria vanilia se encontró, que el haplotipo 1 fue el más basal o ancestral, del cual
se derivaron los haplotipos restantes. Dentro de estos haplotipos, el más derivado o reciente
correspondió al haplotipo 2; sin embargo, el haplotipo que se encuentra más disperso fue el
haplotipo 3.
La distribución de los haplotipos, indica que existe algún grado de diferenciación genética,
pero que aún así existe cierto nivel de flujo de genes entre las poblaciones asociadas a estos
bosques, y que es muy probable que los haplotipos más recientes deban su distribución a la
45
capacidad de dispersión de la especie. Para ambas especies, el conjunto Normandia-San
Ignacio13, que fue el de mayor tamaño, poseía mayor diversidad haplotípica y podría
considerarse un fragmento representativo de las condiciones típicas para estas especies
antes de la alteración de su hábitat natural original.
46
9. CONCLUSIONES Y RECOMENDACIONES
Desde el componente ambiental de la dimensión biótica se trabaja con el desarrollo de
inventarios de biodiversidad, evaluación de grupos registrados como amenazados o de
importancia particular y análisis del paisaje para identificar corredores potenciales o
barreras a la movilidad. Adicionalmente, incorporando esta información a las áreas de
mayor diversidad o endemismo y aplicando estrategias de modelación ambiental para
evaluar riesgos potenciales y determinar zonas de importancia estratégica. La biología de la
conservación y en particularmente la genética de la conservación, ha reconocido la
necesidad de incorporar este nivel de información de forma complementaria con elementos
biológicos, ecológicos y del paisaje en los programas de manejo de especies amenazadas.
Empleando las mariposas como sistema modelo, a manera de estudio de caso exploratorio
para la inclusión la información genética en la gestión ambiental, este trabajo se desarrolló
bajo las hipótesis de que los elementos de paisaje, en especial el tamaño, la distribución de
los parches y la distancia geográfica, afectan de manera diferencial las especies con
diferentes capacidades de dispersión, siendo posible identificar estos elementos a partir del
análisis del ADN mitocondrial, siendo posible identificar unidades de manejo. El modelo
analítico y procedimental desarrollado que podría a corto plazo incorporarse en trabajos de
investigación es:
1. Escogencia del marcador molecular, así como del organismo modelo de trabajo mas
apropiado, a partir del problema de investigación, en este caso el estudio de la estructura
genética de poblaciones en un paisaje fragmentado. En lo posible, previa realización de un
47
estudio piloto que permita inferir los niveles de variación genética con el marcador y
después de conocer aspectos biológicos de la especie.
2. Estudio del paisaje actual y de la dinámica espacial de la zona a partir de fotografías
aéreas e imágenes satelitales por medio de análisis cualitativo y cuantitativo de los patrones
observados.
3. Integración de la información genética de las poblaciones con las características del
paisaje, particularmente aquellas relacionadas con la problemática de interés: área, forma y
distancia entre los hábitats, conectividad y contraste de hábitats.
En el presente estudio, al determinar la conexión física por existencia de corredores
ecológicos entre las unidades de bosques primarios Tenche–Encanto en la vertiente norte de
la quebrada La Cancana y el conjunto Normandia–San Ignacio13 en la vertiente sur de la
misma quebrada, se encontró que ambos corredores se diferenciaron en su estructura y
homogeneidad. Mientras el superior en la vertiente norte fié más diverso e irregular, el
inferior fue más homogéneo y extenso, posiblemente por distintas condiciones topográficas
y grado histórico de presión antrópica. Particularmente, el bosque San Ignacio45 fue el más
aislado físicamente, aunque representa una conexión potencial entre las unidades
Normandía-San Ignacio y Tenche-Encanto.
La presencia de redes de drenaje en la zona de estudio y en particular del bosque
Normandia puede explicar los resultados encontrados en términos de la representatividad
de los haplotipos en dicho bosque. Esto unido a su tamaño, diversidad y estabilidad
temporal, sugieren que es la unidad de manejo más representativa. Adicionalmente, los
bosques Tenche y Encanto, aunque son de un tamaño reducido, aparecen como una unidad
de manejo de importancia para la preservación de la diversidad genética. La barrera qué
presenta la quebrada Cancana a la altura de los bosques San Ignacio (con la carretera y la
zona de pasturas) puede representar un punto crítico para el manejo poblacional. Es
importante recalcar que la dinámica del paisaje, así como la variabilidad local, las
48
condiciones ambientales y la calidad del hábitat, imprime un alto grado de complejidad al
estudio de la fragmentación y de la conectividad funcional entre las unidades.
La información obtenida aparece como una línea base para evaluaciones futuras para el
seguimiento en el tiempo, tanto de la evolución del paisaje como de la genética de las
poblaciones que soporta, en aras de alcanzar un mayor conocimiento de las dinámicas
espaciales y su influencia en los organismos. Esto es altamente significativo en una zona de
importancia estratégica para la generación de hidroenergía, así como para el campo de la
conservación de la biodiversidad, al tratarse de relictos de bosque tropical en un valle
interandino, reconocido como de alta prioridad a nivel internacional.
De gran importancia sería explorar los efectos del aumento en el tamaño muestral y la
implementación de técnicas aún más finas como los microsatélites para refinar los
resultados y precisar los efectos encontrados en esta escala del paisaje. Al respecto se está
trabajando empleando simulación del mismo sistema.
Desde la perspectiva de la gestión ambiental relacionada con los elementos genéticos, se
presentan diversas líneas de trabajo para el desarrollo de investigaciones futuras. Por un
lado, se debería explorar la utilización de la información genética a una escala del paisaje
más amplia, así como la modelación del paisaje para de terminar potenciales puntos críticos
para la conectividad de unidades poblacionales, y la utilidad de las técnicas moleculares.
Debería evaluarse un número mayor de poblaciones y de individuos, así como de diferentes
elementos del paisaje que puedan servir para la suplementación y complementación de
hábitat.
Por otra parte, el desarrollo de estudios directos sobre la dispersión de estos u otros
organismos modelo, permitiría fortalecer el nexo entre la información biológica, la genética
y el paisaje. Adicionalmente, debe explorarse a mayor profundidad los nexos entre la
49
conectividad funcional de las unidades poblacionales con la permeabilidad de las diferentes
coberturas del paisaje para el movimiento de los organismos.
Otro aspecto a profundizar es la aplicación de diferentes técnicas de análisis espacial como
la suma de mapas, que involucre otras variables diferentes a la biótica que puedan ser de
importancia en modelación de los impactos en la genética de los organismos,
particularmente en la conectividad poblacional.
Con base en este estudio, consideramos pertinente y válido la incorporación de la
información genética en la toma de decisiones relacionadas con la intervención de los
hábitats naturales, como un elemento indispensable para lograr un desarrollo sustentable a
partir de las estrategias de gestión. Las especies con diferentes capacidades de dispersión y
preferencias ecológicas presentaron diferencias en su diversidad genética, que se
relacionaron con el paisaje. Estos elementos complementan el estudio actual de los efectos
de la toma de decisiones sobre el manejo en la zona y en los hábitats fragmentados
50
10. BIBLIOGRAFÍA
ÁLVAREZ, E.; POSADA, F. y GOMEZ, O. 2000. Prevención de impactos sobre la
biodiversidad en el diseño de líneas de transmisión de energía en Colombia. Programa de
biodiversidad de ISA. En: VII CONFERENCIA LATINOAMERICANA DE USUARIOS
ESRI-ERDAS (2000: Costa Rica).
ALVAREZ, E.; JARAMILLO, S.; GOMEZ, A.M.; VELEZ, H. y POSADA, F., 2003.
Diversidad biológica en el páramo de Santurban, Santander: amenazas y oportunidades para
su
conservación.
ISA,
Equipo
de
Gestión
Ambiental.
En:
I
CONGRESO
INTERNACIONAL DE CONSERVACIÓN Y MANEJO DE FAUNA SILVESTRE.
(2003: Medellín).
AGUDELO R., E.A. y RESTREPO M., J.C. 2004. Análisis multitemporal de coberturas
vegetales en un bosque húmedo tropical (Rio Porce, Colombia). Trabajo de grado
(Ingeniería Forestal). Universidad Nacional de Colombia sede Medellín. 41 p.
AKÇAKAYA, M. B. y GINZBURG, L. 1999. Applied Population Ecology. Sinauer,
Sunderland, Massachusetts, USA. 280 p.
ANDRADE C., N.G. 1994. Annoted list of butterflies at Tinalandia seen between 8 –14 of
May 1994 [En línea] <<http://www.tinalandia.net/html/butterfly_report.html>> Consulta
el: 3 de mayo de 2002.
51
ARAUJO R., F. 2000. Nymphalid butterfly communities in an amazonian forest fragment.
En: Journal of research on the Lepidoptera. No 35. p. 29-41.
APAN, A.A.; RAINE, S.S. y PATERSON, M.S. 2000. Quantifying landscape
fragmentation in the Lockyer Valley Catchment, Queensland: 1973-1997. En: 28 th Annual
conference of AURISA.
AUSTRALIAN AND NEW ZEALAND ENVIRONMENT AND CONSERVATION
COUNCIL, ANZECC. 2000. State of the Environment Reporting Task Force. Core
Environmental Indicators for Reporting on the State of the Environment. Canberra,
Australia. 92 p.
AVISE, J.C. 1996. Introduction: The scope of conservation genetics. En: AVISE, J.C. y
HAMRICK, J.L. Conservation genetics. Case histories from nature. Chapman & Hall, New
York. p. 1-9.
BAGUETTE, M. 2003. Long distance dispersal and landscape occupancy in a
metapopulation of the cranberry fritillary butterfly. En: Ecography. Vol. 26, No 2. p. 153160.
BAGUETTE, M.; MENNECHEZ, G., PETIT, S. y SCHTICKZELLE, N. 2003. Effect of
habitat fragmentation on dispersal in the butterfly Proclossiana eunomia. En: C.R.
Biologies. No 326. p. 200–209.
BEJARANO M., E.E. 2001. Variabilidad genética y especiación en Lutzomyia
(verrucarum) evansi (Nuñez Tovar, 1924), vector de leishmaniasis visceral americana.
Trabajo de grado (M.Sc.) PECET / Universidad de Antioquia.
52
BENDER, D.J.; CONTRERAS, T.A. y FAHRIG, L. 1998. Habitat loss and population
decline: a meta-analysis of the match size effect. En: Ecology. Vol. 79, No 2. p. 517-533.
BOHONAK, A.J. y JENKINS, D.G. 2003. Ecological and evolutionary significance of
dispersal by freshwater invertebrates. En: Ecology letters. No 6. p. 783-796.
BROWN, K.S. y FREITAS, A.V.L. 2002. Butterfly communities of urban forest fragments
in Campinas, Sao Paulo, Brazil: structure, instability, environmental correlates, and
conservation. En: Journal of insect conservation. No 6. p. 217-231.
CALCAGNOTTO, D.; EGAN, M.G. y LEHN, C. (Compiladoras). 2001. Conservation
Genetics Sessions Guide. Center for Biodiversity and Conservation. American Museum of
Natural
History,
2001
Spring
Symposium.
[En
línea]
<<http://research.amnh.org/biodiversity/symposia/archives/conservationgenetics/session.html>> Consulta el: 7 de Septiembre del 2001
CATERINO, M.S.; CHO, S.; SPERLING, F.A. 2000. The current state of insect molecular
systematics: a thriving tower of Babel. En: Annual review of entomology. No 45. p. 1-54.
COLLINGE, S.K.; PRUDIC, K.L. y OLIVER, J.C. 2003. Effects of local habitat
characteristics and landscape context on grassland butterfly diversity. En: Conservation
biology. Vol. 27, No 6. p. 178- 187
COOPERATIVE RESEARCH CENTRE FOR FRESHWATER ECOLOGY. 2000.
Managing Biodiversity in the Sydney Water Supply Catchments. Sydney Catchment
Authority, Technical Report 9/2000. Outcomes of a Workshop held at Warragamba
Conference Centre, 12th and 13th October 2000. 21p.
CHUVIECO E. 2000. Fundamentos de teledetección espacial. Tercera edición. p. 451-468
53
DEUTSCH, L.; FOLKE, C. y SKANBERG, K. The critical natural capital of ecossystem
performance as insurance for human well-being. s.f. Stocholm Universty; Beijer
international institute of ecological economics, Swedish National Institute of Economic
Research. [En línea] <<http://www.beijer.kva.se/publications/pdf-archive/Disc156.pdf>>
Consulta el 25 de enero de 2005.
DIAZ L., A.N. y DIETER-GILLWALD, I. 2003. GIS-Landscape modeling of a regional
green corridor in tropical Argentina. En: CONFERENCE ON INTERNATIONAL
AGRICULTURAL RESEARCH FOR DEVELOPMENT, DEUTSCHER TROPENTAG.
(2003: Gottingen, October 8-10). 8 p.
DONOVAN, T.M. y WELDEN, Ch.W. 2002. Spreadsheet exercises in conservation
biology and landscape ecology. Sinauer Associates, Massachusetts, U.S.A. p. 327-341 y
380-390.
DUQUE V., P. 2000. Diversidad de mariposas diurnas en diferentes fragmentos de bosque
en la zona de influencia del proyecto hidroeléctrico Porce II. Trabajo de grado (M.Sc.
Entomología). Universidad Nacional de Colombia sede Medellín. 121 p.
EHRLICH, P.R. y EHRLICH, A.H. 1961. How to know the buttterflies. WM.C. Brown
Company Publishers. p. 86-106.
EHRLICH, P.R. 1961. Intrinsic barriers to dispersal in the checkerspot butterfly
Euphydryas editha. En: Science. No l34. p. l08-l09.
EHRLICH, P.R. 1992. Population biology of checkerspot butterflies and the preservation of
global biodiversity. En: Oikos. Vol. 63, No 1. p. 6-12.
54
EHRLICH, P.R. 2003. Introduction: butterflies, test systems, and biodiversity. En:
BOGGS, C.L.; WATT, W.B. y EHRLICH, P.R. Butterflies. Ecology and evolution taking
flight. Chicago University Press. Chicago. p. 1-6.
EHRLICH, P.R. y MURPHY, D.D. 1987. Conservation lessons from long-term studies of
checkerspot butterflies. En: Conservation biology. Vol. 1, No 2. p.122-131.
EKINS, P.; FOLKE, C. y DE-GROOT, R. 2003. Identifying critical natural capital. En:
Ecological Economics. No 44. p. 159-163.
EMMEL, T.C. 1970. The population biology of the neotropical satyrid butterfly, Euptychia
hermes. I. Interpopulation movement, general ecology, and population sizes in Lowland
Costa Rica. En: journal of research on the Lepidóptera. Vol 7, No 3. p. 153-165
EMPRESAS PUBLICAS DE MEDELLÍN E.S.P. 2000a. Investigaciones ambientales y
arqueológicas en Porce II. Medellín. 15 p.
__________________________________________.
2000b.
Gestión
social
integral.
Proyecto hidroeléctrico Porce II. Medellín. 391 p.
ERHARDT, A. y THOMAS, J.A. 1991. Lepidoptera as indicators of change in the seminatural grasslands of lowland and upland Europe. En: COLLINS, N.M. Y THOMAS, J.A.
The conservation of insects and their habitats. Academic Press, New York. p.. 213–236.
EUBANKS,
T.
s.f.
Nature
photography.
Fermata
photo
gallery.
[En
línea]
<<http://www.fermatainc.com/coppermine/displayimage.php?album=random&cat=&pos=200>> Consulta el 15 de marzo de 2003.
55
FORMAN R., T.T. y GODRON, M. 1981. Patches and structural components for a
landscape ecology. En: BioScience, No 31. p. 733-740.
FOX, R.M. 1949. The evolution and systematics of the ithomiidae (lepidoptera). En:
University of Pittsburgh bulletin, Vol.45, No 8. p. 36-47.
FRANKHAM, R. 1995. Conservation genetics. En: Annual Review of Genetics. Vol. 29. p.
305-323.
FRANKHAM, R. 2003. Genetics and conservation biology. En: C.R. Biologies. No 326. p.
S22-S29.
FUTUYMA, D.J. 1998. Evolutionary biology. En: The evolution of behavior. Sinauer,
Sunderland, Massachusetts, USA. 763 p.
GASTON, K.J. 1996. What is biodiversity. En: GASTON, K.J. Biodiversity. A biology of
numbers and difference. Blackwell science. p. 1-9.
GOIGEL T., M. 1987. Spatial simulation of landscape changes in Georgia: a comparison of
3 transition models. En: Landscape ecology. Vol. 1, No 1. p. 29-36.
GILLET, E.M. 1999. Purposes - Classification and desired marker characteristics. Chapter
3: Which DNA Marker for Which Purpose? Final Compendium of the Research Project
Development, optimization and validation of molecular tools for assessment of biodiversity
in forest trees in the European Union DGXII Biotechnology FW IV Research Programme
Molecular
Tools
for
Biodiversity.
GILLET,
E.M.
[En
línea]
<<http://webdoc.sub.gwdg.de/ebook/y/1999/whichmarker/index.htm>> Consulta el: 24 de
Febrero de 2001.
56
GUILLOT, G.; ESTOUP, A.; MORTIER, F. Y COSSON, J.F. 2004. A spatial statistical
model
for
landscape
genetics.
INAPG
/
INRA,
Francia.
[En
línea]
<<http://www.inapg.inra.fr/ens_rech/mathinfo/personnel/guillot/spatial_genetics_guillot_et
_al.pdf>> Consulta el 22 de Octubre de 2004.
GUSTAFSON, E.J. 1998. Quantifying Landscape Spatial Pattern: What Is the State of the
Art? En: Ecosystems, Vol. 1. p. 143–156.
HAILA, Y.; SAUNDERS, D.A. y HOBBS, R.J. 1993. What do we presently understand
about ecosystem fragmentation? En: SAUNDERS, D.A.; HOHHS, R.J. y EHRLICH, P.R.
Nature conservation 3: Reconstruction of fragmented ecosystems. Surrey Beatty & Sons. p.
45-55.
HALFFTER,
G.
2000.
Medir
la
biodiversidad.
[En
línea]
<<
http://entomologia.rediris.es/pribes/pribes2000/medirdiversidad.htm >> Consulta el: 14 de
Julio de 2001.
HAMER, K.C.; HILL, J.K.; LACE, L.A. y LANGHAM, A.M. 1997. Ecological and
biogeographical effects of forest disturbance on tropical butterflies on Sumba, Indonesia.
En: Journal of biogeography, No 24. p. 65-75.
HANSKI, I. 2003. Biology of extinctions in butterfly metapopulation. En: BOGGS, C.L.;
WATT, W.B. y EHRLICH, P.R. Butterflies. Ecology and evolution taking flight. Chicago
University Press. Chicago. p. 577-602.
HARRISON, S.; MURPHY, D.D. y EHRLICH, P.R. 1988. Distribution of the bay
checkerspot butterfly, Euphydryas editha bayensis: evidence for a metapopulation model.
En: The american naturalist. Vol. 132, No 3. p. 360-382.
57
HARTL, D.L. y CLARK, A.G. 1997. Principles of population genetics. Sinauer,
Massachusetts. 542 p.
HAYDON, D.T. y PIANKA, E.R. 1999. Metapopulation theory, landscape models, and
species diversity. En: Ecoscience. Vol. 6, No 3. `p. 316-328.
HILLIS, D.M.; MORITZ, C y MABLE, B.K. 1996. Molecular systematics. Sinauer.
Sunderland, Massachusetts, U.S.A. 655 p.
HEDRICK, P.W. y GILPIN, M.E. 1997. Genetic effective size of a metapopulation. En:
HANSKI, I.A. y GILPIN, M.E. Metapopulation biology. Academic press. p. 165-181.
HEDRICK, P.W. y KALINOWSKI, S. 2000. Inbreeding depression and conservation
biology. En: Annual review of ecology and systematics. No 31. p. 139-162.
HOY, M.A. 1994. Insect molecular genetics. Academic Press, San Diego. 546 p.
HUDSON, R.R. 2000. A new statistic for detecting genetic differentiation. En: Genetics.
No 155. p. 2011-2014.
HUDSON, R.R.; BOSS, D.D. y KAPLAN, N.L. 1992. A statistical test for detecting
geographic subdivision. En: Molecular biology and evolution. Vol. 9, No 1. p. 138-151.
IVITS, E; KOCH, B.; BLASCHKE, T y WASER, L. 2002. Landscape connectivity studies
on segmentation based classification and manual interpretation of remote sensing data. En:
ECOGNITION USER MEETING (2002, Muchen). 10 p.
58
JOYCE, D.A. y PULLIN, A.S. 2003. Conservation implications of the distribution of
genetic diversity at different scales: a case study using the marsh fritillary butterfly
(Euphydryas aurinia). En: Biological conservaton. No 114, p. 453-461.
KATTAN, G.H.; ALVAREZ-LOPEZ, H. y GIRALDO, M. 1994. Forest fragmentation and
bird extinctions: San Antonio eighty years later. En: Conservation biology. Vol. 8, No 1. p.
138-146.
KAWATA, M. 1997. Loss of genetic variability in a fragmented continuously distributed
population. En: Researches on population ecology. Vol. 39, No 2. p. 227-237.
KEYGHOBADI, N.; ROLAND, J.; FOWNES, S. y STROBECK, C. 2003. Ink marks and
molecular markers: examining the effects of landscape on dispersal using both markrecapture and molecular methods. En: BOGGS, C.L.; WATT, W.B. y EHRLICH, P.R.
Butterflies. Ecology and evolution taking flight. Chicago University Press. Chicago. p. 169183.
KLIMAITIS, J.F. 2000. Cien mariposas argentinas. Albatros. 128 p.
KRAUSS, J.; STEFFAN-DEWENTER, I. y TSCHARNTKE, T. 2003. How does landscape
context contribute to effects of habitat fragmentation on diversity and population density of
butterflies? En: Journal of biogeography. No 30. p. 889-900.
KREMEN, C. 1992. Assessing the indicator properties of species assemblages for natural
areas monitoring. En: Ecological applications. Vol. 22, No 2. p. 203-217.
59
KREMEN, C.; COLWELL, R.K.; ERWIN, T.L., MURPHY, D.D.; NOSS, R.F. y
SANJAYAN, M.A. 1993. Terrestrial arthropod assemblages: their use in conservation
planning. En: Conservation biology. Vol 7, No 4. p. 796-808.
LANDE, R. 1998. Anthropogenic, ecological and genetic factors in extinction and
conservation. En: Researches on population ecology. Vol. 40, No 3. p. 259-269.
LAURANCE, W.E.; FERREIRA, L.V.; RANKIN-DE-MERONA, J.M. y LAUPANO, S.G.
1998. Rain forest fragmentation and the dynamics of amazonian tree communities. En:
Ecology. Vol. 79, No 6. p. 2032-2040.
LENTSCH, L.D.; TOLINE, C.A.; KERSHNER, J.; HUDSON, J.M.; MIZZI, J. 2000.
Range-wide conservation agreement and strategy for Bonneville cutthroat trout
(Oncorhynchus clarki utah). Publication Number 00-19, Utah Division of Wildlife
Resources, Salt Lake City. 90 p.
LIU J. y TAYLOR W. W. 2002. Integrating Landscape Ecology into Natural Resource
Management.
Cambridge
Univesity
Press.
[En
línea]
<<http://www.wilderness.org/Library/Documents/upload/Landscape-Connectivity-AnEssential-Element-of-Land-Management.pdf>> Consulta el 24 de Agosto de 2004.
LOPERA C., S.H. 2003. Capital natural crítico: un instrumento de política ambiental para
los recursos naturales. En: IV SEMINARIO DESARROLLO SOSTENIBLE, ENERGÍA Y
PAZ: ECOSISTEMAS
ESTRATÉGICOS. Agosto 2003. Universidad Nacional de
Colombia sede Medellín. Medellín, Colombia. 31 p.
LOUGHEED, S.C.; GASCON, C.; JONES, D.A., BOGART, J.P. y BOAG, P.T. 1999.
Ridges and rivers: a test of competing hypotheses of Amazonian diversification using a
60
dart-poison frog (Epidobates femoralis). En: Proceedings of the royal society of London B.
No 266.p. 1829-1835.
MANEL, S.; SCHWARTZ, M.K.; LUIKART, G. y TABERLET, P. 2003. Landscape
genetics: combining landscape ecology and population genetics. En: TRENDS in ecology
and evolution. Vol. 118, No 4. p. 189-197.
MANTEL, N. 1967. The detection of disease clustering and generalized regression
approach. En: Cancer research. No 27. p. 209-220.
MARSHALL, T.C.; SUNNUCKS, P.; SPALTON, J.A. GRETH, A. y PEMBERTON, J.M.
1999. Use of genetic data for conservation management: the case of the Arabian oryx. En:
Animal conservation. No 2. p. 269–278.
McDOWALL, R.M. 2004. What biogeography is: a place for process. En: Journal of
biogeography. No 31, 2004. p. 345-351.
McGARIGAL, K y ENE, E. 2001. Fragstats: Spatial pattern analysis program for
quantifying landscape structure, version 3.3. Corvallis: Oregon State University.
McGARIGAL, K y MARKS, B.J.F. 1994.Fragstat: Spatial pattern analysis program for
quantifying landscape structure, version 2.0. Corvallis: Oregon State University.
METZGER, J.P. 1998. Changements de la structure du paysage et richesse spécifique des
fragment forestiers dans le sud-est du Bresil. En: C.R. Académie de sciences, Paris,
Sciences de la vie. No 321. p. 319-333.
MEYER, C.L. y SISK, T.D. 2001. Butterfly response to microclimatic conditions following
ponderosa pine restoration. En: Restoration ecology. Vol. 9, No 4. p. 453-461.
61
MONAGHAN, M. T.; SPAAC, R. y ROBINSON, C.T. 2002a. Habitat fragmentation and
genetic diversity. What we can learn by studying alpine aquatic insects. En: EAWAG
News, No 54. p. 24-26.
MONAGHAN, M.T.; SPAAK, P.; ROBINSON, C.T. y WARD, J.V. 2002b. Population
genetic structure of three alpine stream insects: influences of gene flow, demographics, and
habitat fragmentation. En: Journal of the national american bentholgyst Society. Vol. 21,
No 1. p. 114–131.
MORITZ, C. y HILLIS, D.M. 1996. Molecular systematics: context and controversies. En:
HILLIS, D.M.; MORITZ, C. y MABLE, B.K. Molecular systematics. Sinauer, Sunderland,
Massachusetts, U.S.A. p. 1-13.
NEW, T.R.; PYLE, R.M.; THOMAS, J.A.; THOMAS, C.D. y HAMMOND, P.C. 1995.
Butterfly conservation management. En: Annual review of entomology. No 40. p. 57-83.
NORBERG, U.y LEIMAR, O. 2002. Spatial and temporal variation in flight morphology in
the butterfly Melitaea cinxia (Lepidoptera: Nymphalidae). En: Biological journal of the
linnean Society. No 77. p. 445–453.
ORTEGA, O.E. y DUQUE, P. 1998. Las mariposas: historia natural y conservación.
Empresas Públicas de Medellín. 31 p.
PORTER CH. y COLLINS F.H. 1991. Species-diagnostic differences in a ribosomal DNA
internal transcribed spacer from the sibling species Anopheles freeborni and Anopheles
hermsi (Diptera: Culicidae). En: American journal of tropical medicine and hygiene. No 45.
p. 271–279.
62
RAMAS, 2001. A short introduction to population viability analysis. De: Akcakaya, H.R.;
Burgman,
M.
y
Ginzburg,
L.
Applied
population
ecology.
[en
línea]
<<http://www.ramas.com/pva.htm>> RAMAS. Ecological and environmental software.
Consulta el: 27 de Agosto de 2001.
REED, R.D. y SPERLING, F.A.H. 1999. Interaction of process partitions in phylogenetic
analysis: an example from the swallowtail butterfly genus Papilio. En: Molecular biology
and evolution. Vol. 16, No 2. p. 286-297.
RENGIFO, L.M. 2001. Effect of natural and anthropogenic landscape matrices on the
abundance of subandean bird species. En: Ecological applications. Vol. 11, No 1. p. 14-31.
RICKETTS, T.H. 2001. The matrix matters: effective isolation in fragmented landscapes.
ROFF, D.A. y BENTZEN, P. 1989. The statistical analysis of mitochondrial DNA
polymorphisms: X2 and the problem of small samples. En: Molecular biology and
evolution. Vol. 6, No 5. p. 539-545
ROGERS, D.L.; MILLAR, C.I. y WESTFALL, R.D. 1996. Genetic diversity within
species. Cap 28. En: ERMAN, D.C. Sierra Nevada ecosystem project: final report to
congress, Vol. II, Assessments and scientific basis for management options. Davis:
University of California, Centers for Water and Wild land Resources. p. 759-838.
SAARINEN, K. 2002. Butterfly communities in relation to changes in the management of
agricultural environments. University of Joensuu, Tesis (PhD in Biology). [En línea]
<<http://www.joensuu.fi/biologia/PhD/saarinen.pdf>> Consulta el 24 de noviembre de
2004.
63
SAUNDERS, D.A.; HOBBS, R.J. y MARGULES, CH.R. 1991. Biological consequences
of ecosystem fragmentation: a review. En: Conservation Biology. Vol. 5, No 1. p. 18-32.
SAWCHIK, J.; DUFRENE, M.; LEBRUN, P.; SCHTINCKZELLE, N. y BAGUETTE, M.
2002. Metapopulation dynamics of the bog fritillary butterfly: modeling the effect of
habitat fragmentation. En: Acta oecologica. No 23. p. 287-296.
SIMMONS, R. B. y WELLER, S. J. 2001. Utility and evolution of cytochrome b in insects.
En Molecular phylogenetics and evolution. Vol. 20. No 2. p. 193-210.
SIMON, C.; FRATI, F.; BECKENBACH, A.; CRESPI, B.; LIU, H.; FLOOK, P. 1994.
Evolution weighting and phylogenetic utility of mitochondrial gene sequences and a
compilation of conserved PCR primers. En: Annals of the entomological society of
America. No 87. p. 651-701.
SINGER, M.C. y EHRLICH. P.R. 1991. Host specialization of satyrine butterflies and their
responses to habitat fragmentation in Trinidad. En: Journal of research in lepidoptera. Vol.
30. p. 248-256.
SLATKIN. M. 1987. Gene flow and the geographic structure of natural populations. En:
Science. Vol. 236. p. 787-792.
SLATKIN, M. y N.H. BARTON. 1989. A comparison of three indirect methods for
estimating average levels of gene flow. En: Evolution. Vol. 43, No 7. p. 1349-1368.
SYDNEY CATCHMENT AUTHORITY. 2000. Managing Biodiversity in the Sydney
Water Supply Catchments. Outcomes of a Workshop held at Warragamba Conference.
Technical Report 9/2000. Cooperative Research Centre for Freshwater Ecology. 21 p.
64
TEMPLETON, A.R.; ROBERTSON, R.J.; BRISSON, J. y STRASBURG, J. 2001.
Disrupting evolutionary processes: the effect of habitat fragmentation on collared lizards in
the Misouri Ozarks. En: Proceedings of the national academy of sciences, USA. Vol. 98,
No 10. p. 5426-5432.
THOMAS, C.D.; HILL, J.K. y LEWIS, O.T. 1998. Evolutionary consequences of habitat
fragmentation in a localized butterfly. En: Journal of animal ecology. No 67. p. 485-497.
TURNER, M.G. 1989. Landscape ecology: The effect of pattern on process. En: Annual
review ecologycal systems. Vol. 20. p 171-197.
TURNER, M.G. y RUSHER, C.L. 1988. Changes in landscape patterns in Georgia, USA.
En: Landscape ecology. Vol. 1, No 4. p. 241-251.
UNIÓN INTERNACIONAL PARA LA CONSERVACIÓN DE LA NATURALEZA,
UICN.
s.f.
Getting
to
grips
with
biodiversity.
[En
línea]
<<http://www.iucn.org/bil/grip_TEST.htm>> Consulta el 24 de agosto de 2004.
_________________________________________________________________________
____. 2002. IUCN technical guidelines on the management of ex situ populations for
conservation. Approved at the 14th Meeting of the Programme Committee of Council,
Gland
Switzerland,
10
December
2002.
[En
línea]
<<http://www.iucn.org/themes/ssc/pubs/policy/exsituen.htm>> Consulta el 24 de agosto de
2004.
URIBE H.,C. y SALAZAR E., J.A. 1998. Mariposas del llano. Cristina Uribe Editores.
99p.
65
URIBE S., S.I. 1999. Population structure and speciation in the morphospecies Lutzomyia
longipalpis (Lutz & Neiva) as derived from mitochondrial ND4 gene. Tesis (Ph.D. Biología
molecular). Universidad de Antioquia-Center for Diseases Control. Medellín. 73 p.
VAN-DYCK, H. y MATTHYSEN, E. 1999. Habitat fragmentation and insect flight: a
changing “design” in a changing landscape? En: Tree. Vol. 14, No 5. p. 172-174.
VELEZ, J. y SALAZAR, J. 1991. Mariposas de Colombia, Villegas. Santafé de Bogotá,
Colombia. 167 p.
WATT, W.B. y BOGGS, C.L. Synthesis: Butterflies as model system in ecology and
evolution. Present and future. En: BOGGS, C.L.; WATT, W.B. y EHRLICH, P.R.
Butterflies. Ecology and evolution taking flight. Chicago University Press. Chicago. p. 561576.
WRIGHT, S. 1946. Isolation by distance under diverse systems of mating. En: Genetics.
No 31. p. 39-59.
WRIGHT, S. 1951. The genetical structure of populations. En: Annals eugenics. No 15. p.
323-354.
WYSER, N. 2003. A qualitative and quantitative structural landscape analysis case study in
Monteverde, Costa Rica. Diploma February 2003. Ecole polytechnique fédérale de
Lausanne. Section Sciences et Ingénierie de L'environnement. Laboratoire de Gestion des
Ecosystèmes. Laboratoire de Systèmes d'Information à Référence Spatiale.
66
ANEXOS
Anexo 1. Imágenes de coberturas del paisaje en la zona de estudio en las épocas 1961
y 2001
Información de referencia de los mapas de coberturas de las páginas siguientes:
Escala:
1:45.000
Proyección:
Conforme de Gauss
Esferoide:
Internacional 1909
Datum:
Observatorio astronómico de Bogota
Origen de zona:
Centro
Coordenadas geográficas:
4°35´57.57” N
74º04´51.30” E
Coordenadas planas de Gauss:
1´000.000 N
1´000.000 E
Fuente:
Agudelo y Restrepo (2004)
67
68
69
Anexo 2. Distancias Euclidianas entre bosques de interes
Se presentan las distancias entre los puntos más cercanos y entre los centroídes de los
bosques
Hacienda
San Ignacio
Tenche
Encanto
Hda./Normandia San Ignacio
Tenche
Encanto
Punto Centr. Punto Centr. Punto Centr. Punto Centr.
0
0
------0,166
2,048
0
0
----2,701
3,814
4,462 5,048
0
0
--1,951
3,268
3,652 4,043 0,850 1,303
0
0
70
Anexo 2. Índices del Paisaje Calculados
Índices de Composición
Indice
CA
Cobert. 1961
Bp
I
499,9
NP
PD
PLAND
LPI
2001
1961
2001 1961
2001
1961
2001
1961
461,49
14
17
0,4637
0,563
16,556
15,2837 8,1766
AREA_MN
2001
1961
2001
8,877
35,707
27,1465
Bs
76,87
560,93
18
65
0,5961
2,1527
2,5458
18,5769 0,4767
5,0301
4,2706
8,6297
Ra
180,5
732,745
72
81
2,3846
2,6826
5,9778
24,2671 1,2795
3,7208
2,5069
9,0462
Rb
121,78
579,3725 16
3,5042
7,6109
8,3967
9
69
0,5299
2,2851
4,033
19,1877 1,7584
28
0,2981
0,9273
67,1794
6,9931
62,3302 2,1966
225,381 7,5413
44
0,3974
1,4572
3,7079
7,5909
0,7527
1,3384
9,329
5,2093
P
2028,44 211,155
Pr
111,96
G
N/A
114,2825 N/A
12
N/A
0,3974
N/A
3,7848
N/A
1,0907
N/A
9,5235
C
N/A
5,7825
N/A
2
N/A
0,0662
N/A
0,1915
N/A
0,1817
N/A
2,8913
E
N/A
121,6775 N/A
1
N/A
0,0662
N/A
4,0297
N/A
4,0268
N/A
121,6775
N/A
2,855
2
N/A
0,0662
N/A
0,0946
N/A
0,0576
N/A
1,4275
229,2075 12
N/A
Índices de Configuración
Indice
Cobertura
Bp
Bs
Ra
Rb
P
Pr
G
C
E
I
PROX_MN
1961
2001
45,9075
151,7476
3,6565
161,0323
13,7679
371,1486
6,2993
268,312
4503,576 122,2815
5,1023
65,0968
N/A
90,2638
N/A
0
N/A
0
N/A
0
ENN_MN
1961
2001
228,1753
236,2975
548,3099
98,0227
151,6990
82,6304
515,2938
87,9377
134,4597
237,3672
433,4486
184,5266
N/A
73,789
N/A
1347,1637
N/A
N/A
N/A
220,9072
CONNECT 125
1961
2001
5,4945
6,6176
1,3072
2,1635
1,0955
2,5617
3,0303
2,4723
11,1111
3,1746
2,5
2,6427
N/A
12,1212
N/A
0
N/A
0
N/A
0
COHESION 125
1961
2001
99,5248
99,5872
98,1064
99,0871
97,8315
99,0762
98,7555
99,0438
99,9614
99,1201
98,803
98,406
N/A
98,7316
N/A
97,4873
N/A
99,6342
N/A
95,8937
71
Índices de Forma
Indice
Cobertura
Bp
Bs
Ra
Rb
P
Pr
G
C
E
I
SHAPE_MN
1961
2001
1,9735 1,9361
1,6009 2,2491
1,7198 2,2781
1,8298 2,3048
2,6708 2,1574
1,6778 2,1105
N/A
1,8983
N/A
1,4458
N/A
3,342
N/A
1,4373
FRAC_MN
1961
2001
1,1099
1,1252
1,0861
1,1457
1,1068
1,1456
1,1141
1,1502
1,1307
1,1379
1,0962
1,139
N/A
1,114
N/A
1,0838
N/A
1,1644
N/A
1,0783
PARA_MN
1961
2001
307,5745 1037,6475
472,4585 657,7359
825,9411 953,9413
487,1026 655,7505
486,5451 661,8532
505,5858 604,8022
N/A
351,1408
N/A
712,6081
N/A
1011,5388
N/A
499,9871
Índices de Paisaje Global
Índice
NP
SHDI
SIDI
SHEI
SIEI
Año
1961
141
1,0785
0,5141
0,6019
0,6169
2001
322
1,9138
0,8327
0,8312
0,9252
Índice del vecino más cercano (2001)
TYPE
Bp
Bs
Ra
Rb
P
Pr
G
C
E
I
MNN
229,92
91,93
76,43
81,92
231,08
178,36
67,41
1340,82
5,00
215,52
Calculado con Patch-analyst de Arcview
72
Anexo 3. Descripción de índices del paisaje10
Índices de Composición
Los índices de composición describen características básicas de fragmentación. Sin
embargo, proveen una visión incompleta de este concepto ya que están afectadas por la
resolución y la extensión del área de estudio. Los índices a continuación, son medidas de
los atributos del parche y no necesariamente tienen una base ecológica aunque algunas
estén relacionas con el área requerida por un organismo particular.
Área de clase (CA)
Es una medida de la composición del paisaje, establece cuanta área de este esta
comprendida en una clase de hábitat.
n
 1 
CA = ∑ aij 

 10000 
j =1
CA>0,
Unidades: ha.
Numero de Parches. (NP)
Es una medida simple de la subdivisión o fragmentación del tipo de hábitat. Nivel
de clase, numero de parches de una clase particular.
NP ≥ 1
NP= ni
ni= numero de parches de la clase i.
Unidades: ninguna
Densidad de parches (PD)
Calculada como el número de parches por unidad de superficie. Esto nos ofrece
una primera valoración sobre la complejidad paisajística de la zona. Un área con
una densidad alta de parches indicará un espacio muy fragmentado.
PD =
ni
A
ni= numero de parches de la clase i.
A= Area total (ha)
PD=(unidades parches/ha)
Índice de parche más grande. (LPI)
Cuantifica el porcentaje del área total del paisaje comprendido por el parche mayor. Una
simple medida de dominancia. Nivel de clase.
LPI =
a i , max
A
* 100
ai,max=Area (m2) del parche i mayor
A= area total (m2)
0 < LPI ≤ 100, unidades= %
LPI ≈0 cuando el parche mayor de la correspondiente clase no es significativo.
LPI≈ 100 cuando el paisaje completo consiste de un único tipo de hábitat.
10
Se recomienda consulta en Fragstats.
73
Proporción de clase (PLAND)
Cuantifica la abundancia proporcional de cada tipo de parche en el paisaje. Es una
medida relativa y puede ser más apropiada para medir la composición del paisaje y
comparar paisajes de diferentes tamaños.
n
PLAND =
∑a
j =i
ij
(100)
A
Pi= Proporción de paisaje ocupado por la clase de
parche i.
aij= área (m2)del parche ij
A= área total del paisaje (m2)
0 < PLAND ≤ 100 unidades= %
Índices de configuración
Los índices de configuración miden el grado de conectividad o aislamiento entre los
parches el paisaje, pueden ser divididos dentro de dos categorías: índices basados en
distancias entre parches y los índices que comparan la “textura” de un paisaje.
Índice de proximidad (PROX)
Este índice considera el tamaño y la proximidad de todos los parches cuyos bordes
estan entre un radio de estudio especifico a un parche focal.
aijs= área (m2) del parche ijs entre vecinos
n a
ijs
especificados
PROX = ∑ 2
hijs= distancia (m) entre parches ijs basados en
h
s =1 ijs
distancia euclidiana.
Unidades= ninguna
Índice de proximidad medio (PROX_MN)
Es lo mismo que el anterior pero dividido el número de parches que se encuentran en el
radio.
Distancia media del vecino más cercano (ENN_MN)
ENN =
dij
n
dij= distancia (m) desde el parche ij al parche vecino más
próximo de la misma clase, distancia Euclidiana de borde a
borde.
Unidades= m
ENN se aproxima a 0 como la distancia al vecino más cercano decrece. El mínimo
ENN esta limitado por el tamaño del píxel.
74
Media de la distancia al vecino más cercano (MNN)
Medida de aislamiento de los parches, es el promedio de las distancias (borde a
borde) en metros de una clase particular a los parches mas cercanos.
n
MNN =
∑ d ij
j =1
ni
dij= distancia (m) desde el parche ij al parche vecino más
próximo de la misma clase, distancia Euclidiana de borde a
borde.
MNN=unidades m
Conectividad (CONNECT)
La conectividad es definida en el numero de “uniones” funcionales entre los
parches de la clase correspondiente, donde cada par de parches esta o no conectado
con base en un criterio de distancia requerida.

 n
 ∑cijk 
j =k
(100)
CONNECT= 
 ni (ni −1) 
 2 


cijk = unión entre el parche j y k (0= no-unido y 1=
unido) de el tipo (i) de parche correspondiente, basado
en un limite de distancia.
ni = numero de parches en el paisaje de la clase
correspondiente.
0 ≤ CONNECT ≤ 100
CONNECT = 0 Cuando la clase focal consiste de un único parche o ninguno de los
parches de la clase de interés están “conectados”. CONNECT = 100 cuando muchos
parches de la clase de interés están “conectados”.
Cohesión (COHESION)
Medida física de conectabilidad de un tipo de parche, es sensible a la agregación de
los parches, este se incrementa cuando están más unidos.
N

p IJ
∑

J =1
COHESION = 1 − N

p IJ aij
 ∑
J =1
Pij= Perimetro (# celdas o pixeles)

a
ai= Área del parche (# celdas o
−1

1 
pixeles)
 1 −
 (100 ) A= Área total del paisaje
A



Dispersión
Hace referencia a la fragmentación de la imagen, y se calcula como la distancia
promedio entre los centroides de los distintos parches.
Índices de forma
Los índices de forma intentan cuantificar la complejidad de parche. Muchas medidas se
enfocan en alguna variación de las relaciones perímetro-área simple o referida a una forma
75
particular (cuadrado o círculo), otras como la dimensión fractal determinada por la
pendiente de la regresión LOG entre su perímetro y la forma de los parches el paisaje.
Índice de forma (SHAPE_MN)
Medida promedio de la complejidad de los parches
SHAPE ≥ 1, sin limite.
PIJ
SHAPE =
minPij
SHAPE = 1 cuando el parche es muy compacto (regular como un cuadrado) y se
incrementa sin limite cuando el parche es muy irregular
Índice de dimensión fractal FRAC
FRAC =
2 ln(0.25Pij
ln a ij
Refleja la complejidad de las formas a través de un
rango de escalas espaciales.
1≤ FRAC ≤ 2
La dimensión fractal varia entre 1 y 2, desde formas muy regulares hasta altamente
complejas respectivamente.
Relación perímetro-área (PARA)
La relación perímetro-área es una medida simple de la complejidad de la forma, sin
estandarización a una forma simple Euclidiana
Pij= Perímetro (m) del parche ij
Pij
2
2
PARA =
a
ij= área (m ) del parche ij (m )
aij
PARA= (sin unidades)
Índices de Diversidad
Diversidad del paisaje para este parámetro se utiliza el índice de Shannon-W (SHDI)
SHDI = − ∑ pi * ln pi
pi = proporción de cada uno de las clases o tipos de
habita establecidos.
Índice de diversidad de Simpson (SIDI)
Esta medida de diversidad representa la probabilidad que en 2 pixeles seleccionados
al azar podrían ser de diferentes tipos de parches.
M
SIDI = 1 − ∑ p I2
I =1
0 ≤ SIDI < 1
Unidades: ninguna
76
SIDI=0 cuando el paisaje contiene solo un tipo de parches (no hay diversidad), se
aproxima a 1 cuando se incremente el numero de diferentes tipos de parches y la
distribución proporcional del área a través de los parches llega a ser mas equitativa.
Índice de Equidad de Shannon (SHEI)
m
SHEI =
− ∑ (Pi * ln Pi )
0 ≤ SHEI ≤ 1
i =1
ln m
SHDI = 0 cuando el paisaje contiene solo un tipo de parches (no hay diversidad) se
aproxima a 0 a medida que la distribución del área entre los diferentes tipos de
parches es menos equitativa (e.j., dominada por 1 tipo). SHDI = 1 cuando la
distribución del area entre los tipos de parches es perfectamente equitativa (e.j.
abundancias proporcionales son las mismas).
Indice de Equidad de Simpson (SIEI)
m
SIEI =
1 − ∑ Pi 2
i =1
1
1−  
m
77
Anexo 4. Secuencias de Haplotipos
Secuencias de Haplotipos de Hypoleria vanilia
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
Haplotipo_5
Haplotipo_6
10
20
30
40
50
60
70
80
90
100
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
..T..R..F..Y..T..F..H..F..L..L..P..F..I..I..L..I..L..T..I..I..H..L..L..F..L..H..Q..T..G..S..N..N..P.
TATTTTTTAAATCAATTCGAAAAACACACCCAATTTTTAAAATCATTAACAACTCATTAATTGACTTACCTAGCCCATCTAATATTTCTTCTTGATGAAA
TATTTTTTATTTGCTTATGCTATTTT--ACGATCAATCCCCAATAAATTAGGAGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAGCAATTTTACC
TATTTTTTATTTGCTTATGCTATTTT--ACGATCAATCCCTAATAAATTAGGAGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAGCAATTTTACC
TATTTTTTATTTGCTTATGCTATTTT--ACGATCAATCCCTAATAAATTAGGGGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAGCAATTTTACC
TATTTTTTATTTGCTTATGCTATTTT--ACGATCAATCCCTAATAAATTAGGAGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAGCAATTTTACC
TATTTTTTATTTGCTTATGCTATTTT--ACGATCAATCCCCAATAAATTAGGAGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAGCAATTTTACC
TATTTTTTATTTGCTTATGCTATTTT--ACGATCAATCCCTAATAAATTAGGGGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAGCAATTTTACC
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
Haplotipo_5
Haplotipo_6
110
120
130
140
150
160
170
180
190
200
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
.L..G..L..N..R..N..L..D..K..I..P..F..H..P..F..F..T..F..K..D..L..I..G..F..I..I..L..I..K..I..L..T..L..
TATAGGATCCCTACTAGCTTTATGTCTAATAATTCAAATTATTACTGGATTATTTTTAACAATATATTACACAGCAAATATTGAAATAGCTTTTTATAGA
ATTTTCAAATAATAAAAAAATTCAAGGAATTCAATTTTATCC---CTTAAATC---AAATTTTATTTTGATCCTTAATTTCAATTA------TTTTTTTA
ATTTTCAAATAATAAAAAAATTCAAGGAATTCAATTTTATCC---CTTAAATC---AAATTTTATTTTGATCCTTAATTTCAATTA------TTTTTTTA
ATTTTCAAATAATAAAAAAATTCAAGGAATTCAATTTTATCC---CTTAAATC---AAATTTTATTTTGATCCTTAATTTCAATTA------TTTTTTTA
ATTTTCAAATAATAAAAAAATTCAAGGAATTCAATTTTATCC---ATTAAATC---AAATTTTATTTTGATTCTTAATTTCAATTA------TTTTTTTA
ATTTTCAAATAATAAAAAAATTCAAGGAATTCAATTTTATCC---CTTAAATC---AAATTTTATTTTGATCCTTAATTTCAATTA------TTTTTTTA
ATTTTCAAATAATAAAAAAATTCAAGGAATTCAATTTTATCC---CTTAAATC---AAATTTTATTTTGATCCTTAATTTCAATTA------TTTTTTTA
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
Haplotipo_5
Haplotipo_6
210
220
230
240
250
260
270
280
290
300
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
L..T..L..I..N..P..Y..L..L..G..D..P..D..N..F..T..P..A..N..P..L..V..T..P..V..H..I..Q..P..E..*..Y..F..L
GTAAATTATATTTGCCGAAATGTAAACTATGGTTGAATAATTCGAACATTACATGCTAATGGAGCTTCATTTTTTTTTATTTGCATTTATTTACATATCG
TTAACTTGAATTGGAGCTCGACCTGTAGAAACTCC------TTATATTTTAACTGGACAATTATTAACAATTATATATTTTT-----------CTTATTT
TTAACTTGAATTGGAGCTCGACCTGTAGAAACTCC------TTATATTTTAACTGGACAATTATTAACAATTATATATTTTT-----------CTTATTT
TTAACTTGAATTGGAGCTCGACCTGTAGAAACTCC------TTATATTTTAACTGGACAATTATTAACAATTATATATTTTT-----------CTTATTT
TTAACTTGAATTGGAGCTCGACCTGTAGAAACTCC------TTATATTTTAACTGGACAATTATTAACAATTATATATTTTT-----------CTTATTT
TTAACTTGAATTGGAGCTCGACCTGTAGAAACTCC------TTATATTTTAACTGGACAATTATTAACAATTATATATTTTT-----------CTTATTT
TTAACTTGAATTGGAGCTCGACCTGTAGAAACTCC------TTATATTTTAACTGGACAATTATTAACAATTATATATTTTT-----------CTTATTT
78
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
Haplotipo_5
Haplotipo_6
310
320
330
340
350
360
370
380
390
400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
..F..A..Y..A..I..L..R..S..I..P.....*..I..R..R..S..N..C..L..N..Y..I..N.....*..F..*..L..S..Y..H..L..H.
GACGAGGAATTTACTATGAATCTTTTAACTTAAAATATGTATGATTAATTGGAATTATAATTTTATTTATACTAATAGCAACTGCTTTCATAGGTTATGT
CATTA--TTAGACCTTTATTAAATAAATTTTGAGATAAATTAATTTTTA-AAATTAATTAAT---------TAAT----GAGCTTGTAAAAGCATTTGTT
CATTA--TTAGACCCTTATTAAATAAATTTTGAGATAAATTAATTTTTA-AAATTAATTAAT---------TAAT----GAGCTTGTAAAAGCATTTGTT
CATTA--TTAGACCTTTATTAAATAAATTTTGAGATAAATTAATTTTTA-AAATTAATTAAT---------TAATTAATGAGCTTGTAAAAGCATTTGTT
CATTA--TTAGACCCTTATTAAATAAATTTTGAGATAAATTAATTTTTA-AAATTAATTAAT---------TAAT----GAGCTTGTAAAAGCATTTGTT
CATTA--TTAGACCTTTATTAAATAAATTTTGAGATAAATTAATTTTTA-AAATTAATTAAT---------TAAT----GAGCTTGTAAAAGCATTTGTT
CATTA--TTAGACCTTTATTAAATAAATTTTGAGATAAATTAATTTTTA-AAATTAATTAAT---------T----AATGAGCTTGTAAAAGCATTTGTT
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
Haplotipo_5
Haplotipo_6
410
420
430
440
450
460
470
480
490
500
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
.L..K..K..K..F..K..E..F..N..F..I..Q..L..I..K..L..F..F..E..Y..S..*..*..L..*.....L..L..T..*..I..G..A..
CTTACCCTGAGGTCAAATATCTTTTTGGGGGGCAACCGTAATTACAAATCTATTATCTGCAATCCCTTATTTAGGAACTATATTAGTAAATTGAATTTGA
TTGAAAACTTAAG---AAAGAATTTTTT---GTTCTATTAAT----TTAT-TTATATAAATACTAAA--ATTATTTTATTTAATAAAA--AATTAATTTT
TTGAAAACTTAAG---AAAGAATTTTTT---GTTCTATTAAT----TTAT-TTATATAAATACTAAA--ATTATTTTATTTAATAAAA--AATTAATTTT
TTGAAAACTTAAG---AAAGAATTTTTT---GTTCTATTAAT----TTAT-TTATATAAATACTAAA--ATTATTTTATTTAATAAAA--AATTAATTTT
TTGAAAACTTAAG---AAAGAATTTTTT---GTTCTATTAAT----TTAT-TTATATAAATACTAAA--ATTATTTTATTTAATAAAA--AATTAATTTT
TTGAAAACTTAAG---AAAGAATTTTTT---GTTCTATTAAT----TTAT-TTATATAAATACTAAA--ATTATTTTATTTAATAAAA--AATTAATTTA
TTGAAAACTTAAG---AAAGAATTTTTT---GTTCTATTAAT----TTAT-TTATATAAATACTAAA--ATTATTTTATTTAATAAAA--AATTAATTTA
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
Haplotipo_5
Haplotipo_6
510
520
530
540
550
560
....|....|....|....|....|....|....|....|....|....|....|....|...
R..P..V..E..N..P..Y..I..I..T..G..Q..L..L..T..I..I..Y..F..L..Y..
GGGGGATTTGCTGTAGATAATGCTACATTAACCCGATTTTACACATTTCATTTTTTATTACCG
AAACCTAAAAAAAATA-ATAAATAATTAAGTGAAACAGGCAAAT-ATCTTTTTCAACATAAAT
AAACCTAAAAAAAATA-ATAAATAATTAAGTGAGACAGGTAAAT-ATCTTTTTCAACATAAAT
AAACCTAAAAAAAATA-ATAAATAATTAAGTGAAACAGGTAAAT-ATCTTTTTCAACATAAAT
AAACCTAAAAAAAATA-ATAAATAATTAAGTGAGACAGGTAAAT-ATCTTTTTCAACATAAAT
AAACCTAAAAAAAATA-ATAAATAATTAAGTGAAACAGGCAAAT-ATCTTTTTCAACATAAAT
AAACCTAAAAAAAATA-ATAAATAATTAAGTGAAACAGGTAAAT-ATCTTTTTCAACATAAAT
79
Secuencias de Haplotipos de Euptychia hermes
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
10
20
30
40
50
60
70
80
90
100
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
..T..R..F..Y..T..F..H..F..L..L..P..F..I..I..L..I..L..T..I..I..H..L..L..F..L..H..Q..T..G..S..N..N..P.
TATTTTTTAAATCAATTCGAAAAACACACCCAATTTTTAAAATCATTAACAACTCATTAATTGACTTACCTAGCCCATCTAATATTTCTTCTTGATGAAA
TATTTTTTATTTGCTTATGCTATTTT--ACGTTCAATTCCTAATAAACTAGGAGGAGTAATTGCTTTAATTATATCAATTTTAATTTTATTTATTTTACC
TATTTTTTATTTGCTTATGCTATTTT--ACGTTCAATTCCTAATAAACTAGGAGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAATTATTCTTCC
TATTTTTTATTTGCTTATGCTATTTT--ACGATCAATTCCTAATAAATTAGGAGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAACTATTCTTCC
TATTTTTTATTTGCTTATGCTATTTT--ACGCTCAATTCCTAATAAATTAGGAGGAGTAATTGCTTTAATTATATCAATTTTAATTTTAATTATTCTACC
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
110
120
130
140
150
160
170
180
190
200
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
.L..G..L..N..R..N..L..D..K..I..P..F..H..P..F..F..T..F..K..D..L..I..G..F..I..I..L..I..K..I..L..T..L..
TATAGGATCCCTACTAGCTTTATGTCTAATAATTCAAATTATTACTGGATTATTTTTAACAATATATTACACAGCAAATATTGAAATAGCTTTTTATAGA
ATTTTCATTTAATAAAAAAATCCAAGGAATTCAATTTTATCC---TATTAATC---AAATTTTATTTTGATTTTTTATTATTTCAA------TTATTTTA
ATTTTCATTTAATAAAAAAATCCAAGGAATTCAATTTTATCC---TATTAATC---AAATTTTATTTTGATTTTTTATTATTTCAA------TTATTTTA
ATTTTCTTTTAATAAAAAAATTCAAGGAATTCAATTTTATCC---TATTAATC---AAATTTTATTTTGATTTTTTATTATTTCAA------TTATTTTA
ATTTTCATTTAATAAAAAAATTCAAGGAATTCAATTTTATCC---TATTAATC---AAATTTTATTTTGATTTTTTATTATTTCAA------TTATTTTA
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
210
220
230
240
250
260
270
280
290
300
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
L..T..L..I..N..P..Y..L..L..G..D..P..D..N..F..T..P..A..N..P..L..V..T..P..V..H..I..Q..P..E..*..Y..F..L
GTAAATTATATTTGCCGAAATGTAAACTATGGTTGAATAATTCGAACATTACATGCTAATGGAGCTTCATTTTTTTTTATTTGCATTTATTTACATATCG
TTAACTTGAATTGGAGCTCAACCTGTAGAAAATCT------TTACGTAATTTTAAGTCAATTATTAACTATATTTTACTTTT-----------CATATTT
TTAACTTGAATTGGAGCTCAACCCGTAGAAAATCT------TTATGTAATTTTAAGTCAATTATTAACTATATTTTACTTTT-----------CATATTT
TTAACTTGAATTGGAGCTCAACCTGTTGAAAATCT------TTATGTAATTTTAAGTCAATTATTAACCATATTTTATTTTT-----------CATATTT
TTAACTTGAATTGGAGCTCAACCTGTAGAAAATCT------TTATGTAATTTTAAGTCAATTATTAACCATATTTTACTTTT-----------CATATTT
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
310
320
330
340
350
360
370
380
390
400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
..F..A..Y..A..I..L..R..S..I..P.....*..I..R..R..S..N..C..L..N..Y..I..N.....*..F..*..L..S..Y..H..L..H.
GACGAGGAATTTACTATGAATCTTTTAACTTAAAATATGTATGATTAATTGGAATTATAATTTTATTTATACTAATAGCAACTGCTTTCATAGGTTATGT
TATTA--TTAACCCAATTTTAAATAAATTTTGAGATAATTTAATTTTTAAAAACTAAATTAT---------TAATTAATGAGCTTGTTAAAGTATTTGTT
TATTA--TTAATCCAATCTTAAATAAATTCTGAGATAATTTAATTTTTAAAAATTAATTTAT---------TAATTAATGAGCTTGTTAAAGTATTTGTT
TATTA--TTAATCCAATTTTAAATAAATTTTGAGATAATCTAATTTTTAAAAACTAAATTATCTAAATTATTAATTAATGAGCTTGTTAAAGTATTTGTT
TATTA--TTAATCCAATTCTAAACAAATTTTGAGATAATTTAATCTTTATAAACTAAATTAT---------TAATTAATGAGCTTGTTAAAGTATTTGTT
80
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
410
420
430
440
450
460
470
480
490
500
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
.L..K..K..K..F..K..E..F..N..F..I..Q..L..I..K..L..F..F..E..Y..S..*..*..L..*.....L..L..T..*..I..G..A..
CTTACCCTGAGGTCAAATATCTTTTTGGGGGGCAACCGTAATTACAAATCTATTATCTGCAATCCCTTATTTAGGAACTATATTAGTAAATTGAATTTGA
TTGAAAACTTAAG---AAAGAATTAAA----ATTCTATTAAT----TTATACTAAATTTATTTTATAT-ATAATTATCTTTATTATTAT-TATTATTTTT
TTGAAAACTTAAG---AAAGAATTAAA----ATTCTATTAAT----TTATACTAAATATATTTTATAT-ATAATTATTTCTATTATCAT-------TTTT
TTGAAAACTTAAG---AAAGAATTAAA----ATTCTATTAAT----TTATACTAAATTTATTTTATAT-ACAATTATATTTATTATTAT-TATTATTTTT
TTGAAAACTTAAG---AAAGAATTAAA----ATTCTATTAAT----TTATACTAAATTTATTTTATAT-ATAATTATTTTTATTACCCT-AATTATTTTT
Prot.
Bombyx mori
Haplotipo_1
Haplotipo_2
Haplotipo_3
Haplotipo_4
510
520
530
540
550
560
....|....|....|....|....|....|....|....|....|....|....|....|...
R..P..V..E..N..P..Y..I..I..T..G..Q..L..L..T..I..I..Y..F..L..Y..
GGGGGATTTGCTGTAGATAATGCTACATTAACCCGATTTTACACATTTCATTTTTTATTACCG
ATCCCAATAAAAAATA-ATAAATAATTTAAAGAAATAGGTAAAT-ATCTTTTTCAACATAAAT
ATCCCAATAAAAAATA-ATAAATAATTTAAAGAAATAGGTAAAT-ATCTTTTTCAACATAAAT
AATCCAATAAATAATA-ATAAATAATTTAAAGAAACAGGTAAAT-ATCTTTTTCAACATAAAT
ATTCCAATAAAAAATA-ATAAATAATTTAAAGAAATAGGTAAAT-ATCTTTTTCAACATAAAT
81
Anexo 5. Variación Haplotípica
Haplotipos de H. vanilia y posición de los cambios
# Individuos Hapl/Pos 5960 5972 6065 6091 6234 6299-6302
6
H1
C
a
C
c
t
---3
H2
T
a
C
c
c
---11
H3
T
g
C
c
t
ttaa
1
H4
T
a
A
t
c
---1
H5
C
a
C
c
t
---1
H6
T
g
C
c
t
----
#
Hapl/Pos 5951
H1
t
H2
t
H3
a
H4
c
Hapl/Pos 6259
H1
T
H2
T
H3
C
H4
T
5967
c
c
t
t
6415
t
t
t
t
a
a
Haplotipos de E. hermes y posición de los cambios
6009 6010 6015 6817 6026 6041 6140 6188
t
t
t
A
a
c
c
t
a
t
c
T
a
c
t
t
a
c
c
T
t
t
t
c
a
t
c
A
a
t
t
c
6461 6467
a
c
g
t
a
t
g
t
a
c
a
t
6197
c
c
t
c
6231
c
t
t
t
6237
t
c
t
t
Haplotipos de E. hermes y posición de los cambios (Continuación)
6264 6269 6273 6280 6285-6293 6375 6387 6394 6396
T
A
c
A
--------t
t
c
t
T
A
t
T
--------a
t
t
c
T
A
c
A
ctaaattat
t
c
a
t
C
t
c
A
--------t
t
t
t
6402
t
t
t
c
6403
t
c
t
c
6243
t
t
t
c
82
Haplotipos de E. hermes y posición de los cambios (Continuación)
Hapl/Pos 6404 6405 6406 6407-6409 6417 6418 6431 6463
H1
a
t
T
att
t
c
a
t
H2
--t
c
a
t
H3
a
t
T
att
a
t
t
c
H4
c
t
A
att
t
t
a
t
83
Anexo 6. Matriz de identidades de secuencias de Individuos
H. vanilia
84
16.1
16.2
16.1 ID
16.3
16.5
0.991 0.991
16.2 0.991 ID
16.3 0.991
16.5
16.7 16.11 16.12 16.14 16.16 16.17 16.18 16.19 16.21 16.25 16.21 16.26 16.27 16.28 16.29
1 0.991 0.986
1 0.991
1 ID
0.991
1 0.991 0.991 ID
16.7 0.991
1
1
0.98 0.986 0.986 0.986
1 0.986 0.991 0.986 0.995 0.986 0.986 0.991 0.986 0.997 0.986 0.986 0.989 0.991 0.986 0.991
0.98 0.986 0.986 0.986
1 0.986 0.991 0.986 0.995 0.986 0.986 0.991 0.986 0.997 0.986 0.986 0.989 0.991 0.986 0.991
0.98 0.986 0.986 0.986
0.991 0.986
1 0.991 ID
1 0.991 0.991
1 0.986 0.987 0.986 0.986
0.986 0.991 0.986 0.995 0.986 0.986 0.991 0.986 0.997 0.986 0.986 0.989 0.991 0.986 0.991
0.98 0.986 0.986 0.986
0.986
1 0.982
1
1 0.986 ID
0.982
1
1 0.986
1 0.982 ID
16.18 0.986 0.986 0.986 0.986 0.986
1 0.986
1 0.982
1 0.991 0.986
16.21 0.986 0.986 0.986 0.986 0.986
1 0.986
1 0.982
1
1 0.984 0.986
1 0.986 0.989 0.986 0.986 0.997
1 0.986
1 0.984
1 0.986
1 ID
0.986
1 0.986 0.987 0.986 0.986 ID
1 0.986
1 0.984
1
1 0.984 0.986
1
1 0.984
1
1 0.984 0.986
1 0.986
0.986 0.989 0.986 0.986 0.997
1 0.986 ID
0.984
1
1 0.986
1 0.984 ID
16.26 0.986 0.986 0.986 0.986 0.986
1 0.986
1 0.982
1
1 0.986
1 0.984
16.3
16.31
1 0.991 0.991
0.98
0.98
0.98
1 0.991 0.986
0.98
0.98
1 0.986 0.987 0.986 0.986
0.99
1
1 ID
1
1
1
0.99
1
1
1
0.99
1 0.984
1
1 0.986
0.99
1
1
1
0.99
1
1
1
0.98 0.986 0.986 0.986
0.99
1
1
1
1 0.984 0.986
1 0.986
0.99
1
1
1
0.984 0.986
1 0.986
0.99
1
1
1
0.997 0.984 0.997 0.982 0.984 0.984 0.984
1 0.986 0.989 0.986 0.986 0.997 ID
1 0.986
1 0.986 0.987 0.986 0.986
1 0.986
1 0.984 0.986
16.27 0.997 0.989 0.989 0.997 0.989 0.984 0.997 0.984 0.985 0.984 0.984 0.997 0.984 0.987 0.984 0.984 ID
1 0.982
0.99
0.98 0.986 0.986 0.986
0.984 0.984 0.987 0.989 0.984 0.989 0.978 0.984 0.984 0.984
1
1 0.986
1 0.986
1 0.986
1 0.982
16.29 0.986 0.986 0.986 0.986 0.986
1
1 0.984 0.986
1 0.986
1 0.991 0.986
1 0.986
1
16.21 0.986 0.986 0.986 0.986 0.986
1 0.991 0.991
1 0.986
1 0.984
16.25 0.989 0.997 0.997 0.989 0.997 0.984 0.989 0.984 0.995 0.984 0.984 0.989 0.984 ID
16.28
1 0.986
0.982 0.982 0.987 0.982 0.995 0.982 0.982 0.985 0.987 0.982 0.987 0.976 0.982 0.982 0.982
16.17 0.986 0.986 0.986 0.986 0.986
1 0.991 0.991
1 0.986 0.989 0.986 0.986 0.997
0.986 0.987 0.986 0.986
16.16 0.987 0.995 0.995 0.987 0.995 0.982 0.987 0.982 ID
16.19
1 0.986
0.98 0.986 0.986 0.986
1 0.991 0.986 ID
16.14 0.986 0.986 0.986 0.986 0.986
1 0.986 0.989 0.986 0.986 0.997
1
16.11 0.986 0.986 0.986 0.986 0.986 ID
16.12
1 0.986 0.987 0.986 0.986
16.3 16.31 16.32 16.33 16.35
1
0.986
1 0.984 0.986 ID
1 0.986 0.989 0.986 0.986 0.997
0.99 0.982
1
0.986
1 0.986 ID
0.98
0.99
0.98 0.986 0.986 0.986
0.99
1
1
1
0.98 0.986 0.986 0.986
0.98
0.99 0.976
0.99
0.98
0.99 0.978
0.99
16.32 0.986 0.986 0.986 0.986 0.986
1 0.986
1 0.982
1
1 0.986
1 0.984
1
1 0.984 0.986
1 0.986
0.98 ID
0.99 ID
0.99
0.99
0.99
1
16.33 0.986 0.986 0.986 0.986 0.986
1 0.986
1 0.982
1
1 0.986
1 0.984
1
1 0.984 0.986
1 0.986
0.99
1 ID
1
16.35 0.986 0.986 0.986 0.986 0.986
1 0.986
1 0.982
1
1 0.986
1 0.984
1
1 0.984 0.986
1 0.986
0.99
1
1
1 ID
85
E. hermes
14.2
14.4
14.8
14.9
14.1
14.11
14.12
14.13
14.14
14.16
14.3
14.7
14.7
14.2 ID
0.943
1
0.964
0.964
0.964
0.96
1
0.964
0.96
0.964
0.943
0.964
14.4
0.943 ID
0.943
0.943
0.943
0.943
0.926
0.943
0.943
0.926
0.943
1
0.943
14.8
1
0.943 ID
0.964
0.964
0.964
0.96
1
0.964
0.96
0.964
0.943
0.964
14.9
0.964
0.943
0.964 ID
1
1
0.95
0.964
1
0.95
1
0.943
1
14.1
0.964
0.943
0.964
1 ID
1
0.95
0.964
1
0.95
1
0.943
1
14.11
0.964
0.943
0.964
1
1 ID
0.95
0.964
1
0.95
1
0.943
1
14.12
0.96
0.926
0.96
0.95
0.95
0.95 ID
0.96
0.95
1
0.95
0.926
0.95
14.13
1
0.943
1
0.964
0.964
0.964
0.96 ID
0.964
0.96
0.964
0.943
0.964
14.14
0.964
0.943
0.964
1
1
1
0.95
0.964 ID
0.95
1
0.943
1
14.16
0.96
0.926
0.96
0.95
0.95
0.95
1
0.96
0.95 ID
0.95
0.926
0.95
14.3
0.964
0.943
0.964
1
1
1
0.95
0.964
1
0.95 ID
0.943
1
14.7
0.943
1
0.943
0.943
0.943
0.943
0.926
0.943
0.943
0.926
0.943 ID
0.943
14.7
0.964
0.943
0.964
1
1
1
0.95
0.964
1
0.95
1
0.943 ID
86
Anexo 7. Individuos empleados en al análisis molecular, haplotipo y procedencia
Ejemplares Hypoleria vanilia
# Consec
16,1
16,2
16,3
16,5
16,7
16,11
16,12
16,14
16,16
16,17
16,18
16,19
16,21
16,26
16,27
16,28
16,29
16,30
16,31
16,32
16,33
16,35
Haplotipo
Hh1
Hh2
Hh2
Hh1
Hh2
Hh3
Hh1
Hh3
Hh4
Hh3
Hh3
Hh1
Hh3
Hh3
Hh5
Hh1
Hh3
Hh1
Hh6
Hh3
Hh3
Hh3
Procedencia
Normandia
Normandia
Normandia
Normandia
Normandia
Normandia
Normandia
Encanto
Encanto
Encanto
Encanto
Encanto
San Ignacio45
Normandia
Normandia
Normandia
Normandia
Tenche
Tenche
Tenche
San Ignacio13
San Ignacio13
Ejemplares Euptychia hermes
# Consec
14,2
14,3
14,4
14,8
14,9
14,10
14,11
14,12
14,13
14,14
14,16
14,17
14,18
Haplotipo
He1
He4
He3
He1
He4
He4
He4
He2
He1
He4
He2
He4
He4
Procedencia
San Ignacio13
San Ignacio13
San Ignacio13
San Ignacio13
San Ignacio45
Normandia/Normandia
Normandia/Normandia
Encanto.
Encanto.
Normandia
Normandia
Tenche
San Ignacio45
87
Distribución de Haplotipos de Hypoleria vanilia.
Distribución de Haplotipos de Euptychia hermes.
88
Anexo 8. Diferencias pareadas entre haplotipos
Comparaciones pareadas entre haplotipos en H. vanilia
Comparación
H1 vs. H5
H2 vs. H4
H5 vs. H6
H1 vs. H2
H1 vs. H6
H2 vs. H6
H2 vs. H5
H3 vs. H6
H1 vs. H4
H4 vs. H6
H4 vs. H5
H2 vs. H3
H1 vs. H3
H3 vs. H5
H3 vs. H4
# Cambios Tansición Transversión Inserción/Deleción
1
2
3
4
4
4
5
5
6
6
7
7
7
8
9
78
0
1
3
4
3
3
4
0
5
4
5
3
3
3
4
45
1
1
0
0
1
1
1
1
1
2
2
0
0
1
1
13
0
0
0
0
0
0
0
4
0
0
0
4
4
4
4
20
Comparaciones pareadas entre haplotipos en E. hermes
Comparación #
Transición Transversion Inserción/Deleción
Cambios
H1 vs. H4
17
13
4
0
H1 vs. H2
18
8
4
6
H2 vs. H4
21
11
4
6
H1 vs. H3
27
11
7
9
H3 vs. H4
27
9
9
9
H2 vs. H3
35
13
7
15
145
65
35
45
89
Anexo 9. Arboles de relaciones filogenéticos entre los conjuntos poblacionales.
H. vanilia
E. hermes
90
Anexo 11. Glosario11:
ADN mitocodrial: Material geonómico extranuclear. Ubicada en la mitocondria que
codifica para unos pocos genes, la cual presenta una tasa de evolución alta en comparación
con el ADN nuclear.
Alelo: Una de varias formas alternativas de cada gen.
Centroíde: Concepto relacionado al centro de gravedad de un objeto que reprenda el punto
medio entre varias líneas trazadas entre varios puntos extremos del mismo.
Codón: Secuencia de tres pares de bases que especifica qué tipo de aminoácido debe ser
incorporado a una proteína en particular. Ciertos codones también señalan el inicio y e
termino de la síntesis de proteínas.
Conectividad: Se refiere a las conexiones o continuidad entre parches, determinada como
el grado por el cual un paisaje facilita o impide el flujo ecológico.
Corredor: Elementos predominantemente lineales del paisaje que pueden ser definidos a
partir de su estructura o función
Deme: Subpoblaciones parcialmente aisladas cuyos imites no están bien definidos.
Deriva genética: Cambios al azar en las frecuencias alélicas.
Endocría: Reproducción continuada de individuos emparentados.
11
Se recomienda consulta en Fragstats, Audesirk y Audesirk (1997), Begon et al (1999), Donovan y Welden
(2002), Harttl y Clark (1997), Hoy (1994), Hillis et al (1996).
91
Enzimas de restricción: Proteína catalizadora que corta el DNA de doble hélice en una
secuencia de nucleótidos especifica, la secuencia de segmentación difiere dependiendo de
la enzima.
Especiación: Proceso de formación de una especie a partir de una preexistente.
Estructura genética: Nivel de integración de subpoblaciones en una unidad global,
medido a través del flujo de genes entre estas.
Fenotipo: Características físicas de un organismo.
Filogeografía: Estudio de los patrones evolutivos de organismos emparentados que reflejan
la persistencia de eventos históricos en el pool genéticos de los organismos, a través del
análisis de las relaciones entre linajes y del contexto geográfico donde se encuentran.
Fisiográfico: Relativo a las formas del relieve y otros elementos estructurales de un
paisaje.
Flujo genético: Movimiento de alelos de una población a otra debida a la migración de
individuos.
Genoma: Información genética que porta un individuo.
Grid: Objeto (imagen) que almacena datos espaciales en una matriz de columnas y filas en
donde el espacio esta divido en celdas y cada una almacena un valor numérico.
Haplotipo: Secuencia de nucleótidos o aminoácidos que difiere de cualquier secuencia
homóloga por al menos una sustitución nucleotídica o aminoacídica.
92
Heteroplasmia: Diferencias dentro y entre individuos en la longitud del ADN
mitocondrial, producto de orígenes diferenciales de las copias de ADN.
Heterocigosidad: Proporción de alelos diferentes de un gen que puede servir para
caracterizar una población.
Hibridación: Proceso de cruce entre dos organismos de especies diferentes.
Homologia: Similaridad en apariencia o información.
Homocigosidad: Proporción de alelos iguales de un gen que puede servir para caracterizar
una población.
Intrón: Segmento de ADN que no codifica aminoacidos en proteínas.
Linaje: Ascendencia o descendencia de una familia.
Marcador molecular: Moléculas orgánicas que se pueden relacionar con información
genética particular.
Matriz: Componente principal de un paisaje en términos de su dimensión, conectividad y
funcionamiento del paisaje.
Metapoblacion: Una población que se concibe como un conjunto de subpoblaciones
unidas entre si por la migración limitada entre ellas y donde se desarrollan eventos locales
de extinción y recolonización.
93
Oligonucleotido: Conjunto reducido de nucleótidos que es utilizado para iniciar o terminar
la replicación del ADN.
Parche: Elemento del paisaje que difiere de los alrededores en su naturaleza o apariencia.
Pares de bases: En los ácidos nucleicos las bases nitrogenadas que se aparean mediante
enlaces de hidrógeno.
PCR: Reacción en cadena de la polimerasa. Proceso mediante el cual se utiliza una copia
molde de ADN para producir copias exactas de este, aumentando su cantidad y permitiendo
su análisis.
Píxel: Elemento o unidad básica que componen una imagen categórica, posee componentes
y valores espaciales.
Población: Grupo de individuos de una misma especie que comparten un lugar y tiempo,
los cuales están entrecruzándose.
Polimorfismo de secuencias: Variación en las bases nitrogenadas que componen una
cadena de ADN.
Pool genético: Conjunto genes que se encuentran presentes en una población otorgándole
variabilidad.
Potencial evolutivo: Variabilidad genética que permite la capacidad de adaptarse a
cambios en el ambiente
94
Anexo 12. Resumen ejecutivo
Elementos de estructura genética de
evaluó la información sobre el estado actual y
poblaciones y de paisaje: una
dinámica del paisaje en Porce (Antioquia,
aproximación a la conservación y manejo
Colombia). Se seleccionaron cinco parches de
en el área de Porce
bosque para obtener información genética.
Empleando secuencias de ADN mitocondrial,
Carlos Federico Álvarez Hincapié, I.A., Esp.
de
mariposas
con
diferente
dispersión
Gestión Ambiental
(Hypoleria vanilia y Euptychia hermes). En
Brian C. Bock. Biólogo, Ph.D.
un paisaje dinámico, se encontró que la zona
Sandra I. Uribe. I.A., M.Sc., Ph.D
presento aumento en complejidad espacial
debido a la disminución de la dominancia de
Tesis de Maestría en Medio Ambiente y
los pastos. Se determinó la existencia de
Desarrollo, Facultad de Minas, Universidad
corredores biológicos análizando el paisaje,
Nacional de Colombia, Sede Medellín
así como unidades de manejo, con la
información
molecular.
Los
resultados
RESUMEN
obtenidos muestran que la incorporación de
El impacto de las actividades humanas sobre
información genética en toma de decisiones
los ecosistemas y la premura para reducir los
relacionadas con la intervención de los
efectos nocivos de las transformaciones
hábitats, es indispensable para un desarrollo
antrópicas requiere que la gestión ambiental
sustentable en las estrategias de gestión.
incorpore desarrollos recientes en diversas
Especies
áreas del conocimiento, como la Ecología y la
dispersión presentaron diferencias en su
Conservación molecular, que sugieren que la
diversidad genética, relacionadas con el
apropiación de la información genética y del
paisaje. Esto complementan el estudio de los
componente evolutivo del medio biótico, son
efectos de la toma de decisiones sobre el
elementos útiles en la gestión ambiental
manejo en la zona y en los hábitats
especialmente en ecosistemas fragmentados.
fragmentados.
con
distintas
capacidades
de
En la presente investigación se recopiló y
95
Palabras claves: Fragmentación, genética
management
del paisaje, mariposas, Hypoleria vanilia,
information. The results suggest that genetic
Euptychia
information incorporation in decision making
hermes,
ADN
mitocondrial,
Gestión ambiental, Porce
units
using
molecular
related with habitat modifications is a
necessary element to achieve sustainable
development management strategies. Species
ABSTRACT
The
impact
of
human
activities
on
with different dispersal capabilities presented
ecosystems and the need to reduce the
genetic differences related to landscape.
noxious effects of transformations, requires
These elements complement the studies of the
the incorporation of recent developments of
effects of management in the particular area
diverse areas of knowledge, those include
and in the fragmented habitats in general.
ecology and molecular conservation in the
Key
environmental
genetics,
butterflies,
Hypoleria
appropriation of genetic information and the
Euptychia
hermes,
mitochondrial
evolutionary
Environmental management, Porce.
management.
component
of
The
biotic
words:
Fragmentation,
landscape
vanilia,
DNA,
environment are useful elements for the
Introducción
environmental
in
La fragmentación del paisaje es un proceso
fragmented ecosystems. We evaluate the
que cada vez cobra más importancia a nivel
status and the dynamics of a landscape in
mundial, ya que afecta la cantidad, la
Porce (Antioquia, Colombia). Five patch of
distribución, la ubicación espacial y la
forest where selected in order to obtain
diversidad de las coberturas y usos del suelo.
genetic
Conjuntamente con la pérdida de hábitat,
management, specially
information
using
mitochondrial
DNA. The subdivision of populations was
pueden
analyzed, in two butterfly species with
variabilidad
different dispersal capabilities (Hypoleria
organismos (Sawchik et al, 2002). Áreas de
vanilia and Euptychia hermes). In a dynamic
desarrollo recientes como la Ecología y la
landscape, the area presented an increasing
Conservación molecular, sugieren que la
spatial complexity, related to the reduction in
apropiación de la información genética y del
the grass dominance. The presence of
componente evolutivo del medio biótico, son
biological corridors was determinated by
elementos útiles en la gestión ambiental y en
landscape analysis, as well as population
especial
influir
para
negativamente
poblacional
ecosistemas
de
en
la
diversos
fragmentados.
96
Aspectos
como
la
las
dinámica del paisaje de un área de 3021
poblaciones y la dispersión de los organismos
hectáreas desde 1961 al 2001, haciendo una
estimada como flujo de genes, proporcionan
evaluación
información valiosa y complementaria a los
empleando diversos índices del paisaje
inventarios de especies y análisis de paisaje.
usando el programa Fragstats 3.3®. Se
Si bien los desarrollos prácticos de las áreas
emplearon fotografías aéreas de diferentes
moleculares son relativamente recientes, es
épocas, mapas topográficos e imágenes
frecuente su incorporación en estudios de
digitales
conservación y su utilización para la toma de
(proporcionadas por Agudelo y Restrepo,
decisiones.
2004),
Los
subdivisión
estudios
de
sobre
las
cualitativa
de
para
y
cuantitativa,
coberturas
un
análisis
vegetales
cualitativo
y
consecuencias de la fragmentación del paisaje
cuantitativo. Los fragmentos de bosque están
en la viabilidad de las poblaciones son
inmersos en una matriz de pastos y de
prioritarios en conservación
regeneraciones
En la presente investigación se recopiló y
estados sucesionales, que se han desarrollado
evaluó la información sobre el estado actual y
después de varias etapas de explotación
dinámica del paisaje de un área de Porce y se
(Agudelo y Restrepo, 2004). Se exploró el
exploró el estado de subdivisión de las
estado de subdivisión de poblaciones de 5
poblaciones
un
fragmentos de bosque primario, en dos
análisis molecular. Esto se realizó en un
especies de mariposas (34 ejemplares) con
intento por analizar de forma conjunta,
diferentes
capacidades
elementos
(Hypoleria
vanilia:
de
de
mariposas
paisaje
y
mediante
genética
de
secundarias
en
de
distintos
dispersión
dispersión
alta
y
poblaciones y aportar información relevante
Euptychia hermes: dispersión baja) mediante
para el área de estudio
el
Materiales y Métodos
mitocondrial con una longitud de 503 pares
La investigación se desarrollo en el área de
de bases (gen citocromo b). La selección del
influencia del embalse Porce II (Amalfi,
gen se basó en resultados de estudios previos
Antioquia, Colombia), donde el bosque
que permiten identificarlo como de utilidad
húmedo tropical, ha sido intervenido para el
para estimar la subdivisión entre poblaciones
desarrollo
hace
y el flujo de genes (Simmons y Weller, 2001;
aproximadamente 150 años. Se recopiló y
Bejarano, 2001). Para la extracción se utilizó
evaluó la información sobre el estado actual y
el método del Grind Buffer, protocolos de
ganadero
desde
análisis
de
secuencias
de
ADN
97
Porter y Collins (1991) modificados por
paisaje que la literatura registra determinantes
Uribe (1999). Además, se empleo un KIT
para las mariposas.
comercial
Resultados y Discusión
de
extracción
para
algunos
ejemplares (DNA-Easy, Promega, Inc.). El
Análisis del patrón del paisaje
ADN amplificó usando el procedimiento de
En el paisaje actual (2001) existen 17 parches
amplificación PCR (reacción en cadena de la
de bosque primario (Bp), 65 de bosque
Taq polimerasa), utilizando oligonucleótidos
secundario (Bs), 69 de rastrojo bajo (Rb) y 81
diseñados con base en el alineamiento de
de rastrojo alto (Ra). La zona de embalse para
secuencias
de
la época fue una cobertura preponderante
invertebrados y en especial de Lepidóptera.
(121 ha), dado que apenas comenzaba a
Los productos de PCR se secuenciaron en
llenarse el embalse. Sin embargo, para
ambos sentidos de la doble cadena de ADN y
cuando el embalse completó su llenado, esta
las secuencias fueron editadas utilizando el
cobertura se convirtió en preponderante (822
programa Bioedit ® comparándolas en ambos
ha). Según el índice del parche más grande
sentidos de la doble cadena para cada
(LPI), el paisaje está dominado por los
espécimen y posteriormente construyendo la
bosques primarios (Bp), debido a la presencia
secuencia consenso a ser utilizada en el
del bosque Normandia. A partir de la
análisis, empleando el programa DNAsp
valoración del área (CA) de cada clase, se
versión 4. Se practico la prueba de Mantel
observa la prevalencia de rastrojos (Ra: 732,7
(paquete APE versión.1.4. del programa R
ha y Rb: 579,3 ha) y bosques (Bp: 461,4 ha y
versión 2.01) para determinar si había un
Bs: 560,9 ha) en el paisaje. La clase con
relación entre distancia geográfica y genética
tamaño medio de área mayor (AREA-MN)
(Manel et al, 2003). Así mismo, se calcularon
fue el Bp (60,83). Basado en esto, parece que
diversos índices para estimar el flujo de genes
el paisaje en general puede ser considerado
y la subdivisión según los criterios de Hudson
adecuado para especies de bosque. A partir
et al (1992). Se analizó de forma conjunta la
del índice de porcentaje de cobertura
conectividad genética entre las mariposas y la
(PLAND), el tipo de cobertura vegetal que
conectividad física entre los fragmentos de
proporcionalmente
bosque. Así mismo, se interpretó el flujo de
preponderancia fue Ra con un 24%, seguido
genes en relación con las características del
por Rb (19%), Bp (18%), Bs (15%), teniendo
obtenidas
del
GenBank
tiene
una
mayor
las demás coberturas valores marginales.
98
Aunque la proporción de rastrojos (Ra +Rb)
(revisión fotografías aéreas de 1999). Un
fue mayor (43%), el área de bosques (Bp+Bs)
cambio significativo fue la separación del
fue igualmente significativa (33%).
bosque San Ignacio del bosque Normandía, lo
En síntesis el paisaje actual está compuesto
que implico una pérdida considerable de
por
cobertura boscosa. Sin embargo, en la
diversos
estados
sucesionales
de
regeneración, lo que podría favorecer el
actualidad
movimiento
encuentran
de
mariposas
de
bosque,
estas
unidades
conectadas
boscosas
por
se
bosques
especialmente en área de Normandía-San
secundarios, lo que puede favorecer la
Ignacio13 (ver el mapa detallado en anexo 1).
dispersión entre ellos. De un porcentaje de
El índice de configuración mas simple, la
cobertura de bosque primario (PLAND) en
distancia euclidiana entre los parches, reveló
1961 del 16,5%, se conservó para el 2001 un
que los pastos (ENN: 237,3) y los bosques
15,2%. Adicionalmente, el bosque Encanto
primarios (ENN: 236,2) fueron los que
pasó de ser un Bs a un Bp debido al proceso
presentaron una mayor distancia entre ellos,
de sucesión continuado.
solo superados por los cultivos (por efecto de
Se dio un aumento en el número de parches
su distribución y número). El índice de
de 141 a 371, contribuyendo a un aumento en
conectancia muestra un nivel alto para bosque
la complejidad paisajística. Partiendo de un
primario (CONNECT: 6,6).
escenario dominado por pasturas en 1961,
Dinámica del paisaje durante el período
todos
1961-2001
incrementaron
Los cambios globales de las coberturas de
aumento en el número de parches, así en la
bosque en la zona muestran que en el período
tendencia a una mayor equitatividad en las
de estudio éstos han conservado su forma y
áreas de los parches de las diferentes clases.
distribución espacial. Sin embargo, algunos
Los índices de equitatividad aumentaron
fragmentos que pudieron tener un papel como
paralelamente
conectores en la vertiente norte de la
dominancia del paisaje de las pasturas,
quebrada la Cancana han desaparecido. El
fenómeno relacionado con el avance del
bosque Normandía ha fortalecido sus nexos
proceso sucesional en el área. Este proceso
con los conjuntos de bosques al sur, los que a
general de avance de la sucesión puede
su vez se conectan en una escala mayor con
relacionarse
masas boscosas de considerable extensión
actividad ganadera en la zona, combinado
los
índices
de
diversidad
consistentemente
a
a
la
una
disminución
disminución
con
en
de
se
el
la
la
99
con
el
establecimiento
del
proyecto
de estudio. Sin embargo, debe confirmarse
hidroeléctrico Porce II, cuya zona de embalse
esta
representó un nuevo tipo de cobertura, junto
demográficos, ya que ha sido reportado que
con el de guadua (CA: 114 ha, PLAND: 3,7
fluctuaciones en el tamaño poblacional son
%). Patrones similares han sido reportados
comunes en poblaciones naturales de algunas
tras el abandono de zonas de cultivo (Turner
especies (Frankham, 1995).
y Rusher, 1988). A la vez que se está
En el período de estudio, la complejidad de la
desarrollando
forma en los parches de bosque aumentó
la
sucesión,
se
está
asunción
a
partir
de
estudios
incrementando la heterogeneidad espacial
(PARA_MN:
pasando de 141 parches en 1961 a 321 en el
1037,64), lo que podría considerarse crítico
2001.
para los organismos de bosque, por la
El índice del parche más grande ilustra el
reducción potencial del área de interior
debilitamiento de los pastos durante el
efectiva de cada fragmento. Sin embargo, un
período de estudio, ya que se pasó en 1961 de
índice más robusto indicó que la forma de los
un dominio de los pastos (LPI: 62,3%),
bosques primarios se mantuvo relativamente
seguido de lejos por los bosques primarios
constante entre 1961 y 2001 (SHAPE_MN:
(LPI: 8,1%), a una situación en el 2001 donde
1,97 a SHAPE_MN: 1,93), pero aumentó en
el tamaño de los pastos se ha reducido
los bosques secundarios (SHAPE_MN: 1,6 a
significativamente (LPI: 2,1 %), mientras que
SHAPE-MN: 2,1), así como en otros estados
el índice se incrementó para los bosques
sucesionales diferentes a pastos. Turner y
primarios (LPI: 8,8%). Los efectos de la
Rusher (1988) señalaron que los usos del
fragmentación en el tamaño poblacional de
suelo que están menos influenciados por
especies de bosque pueden ser limitados
actividades humanas tienden a tener una
cuando no hay una remoción selectiva de
complejidad mayor en su forma. Esto
hábitat (Bender et al, 1998). En el área de
concuerda con la tendencia a la disminución
estudio este caso, la relativa constancia en el
de la explotación ganadera en la zona.
número y las dimensiones de los parches de
Conectividad
bosque, sugieren que para las poblaciones
Barreras Potenciales
residentes en estos no ha existido una
Al superponer la red de drenajes con las
reducción
coberturas de bosque primario y bosque
poblacional
debida
a
las
transformaciones del paisaje durante el lapso
secundario,
307,57
a
Estructural:
se
encuentra
PARA_MN:
Corredores
una
y
unidad
100
relativamente continua en la vertiente sur de
importante el bosque Normandía del conjunto
la quebrada la Cancana, mientras que la
Tenche-Encanto.
vertiente norte aparece más fragmentada. Se
embalse no afectó los corredores antes
ha reconocido la importancia del agua
existentes, ya que inundo las laderas (en
permanente
de
mayor grado de la vertiente norte) y el cauce
mariposas tropicales (Brown y Freytas,
de la quebrada La Cancana donde las
2002).
coberturas correspondían principalmente a
Se identificó una conexión física entre los
pastos
parches de bosque primario Tenche y
rastrojos bajos. La vertiente opuesta se afectó
Encanto. Para el bosque Normandía se dio
en menor grado debido a sus características
una conexión con el parche San Ignacio, ya
topografías (pendientes mayores).
que gran parte de la vertiente sur de la
Componente Genético
quebrada La Cancana esta conformada por
Al
bosque secundario, estableciendo un área
secuencias provenientes de las mariposas del
continua y extensa de cobertura boscosa
estudio con secuencias del banco de genes
adyacente al bosque primario. En 1961 estos
(GenBank),
parches pertenecían a una misma unidad de
correspondieron a la región del extremo 3´del
bosque primario. El bosque San Ignacio45
gen Citocromo B. Para H. vanilia, especie
aparentemente
mayor
con mayor capacidad de dispersión, la
aislamiento relativo a los demás, ya que se
divergencia entre las secuencias fue de
encuentra
2.33%, encontrándose 78 cambios, de los
para
las
comunidades
evidencia
inmerso
en
un
una
matriz
de
limpios,
realizar
construcción
pastos
enrastrojados
alineamiento
se
comprobó
las
que
pastos enrastrojados y rastrojo bajo, sin
transiciones 13 (16,6%) a transversiones y 20
embargo su posición espacial potencialmente
(25,6%) a inserciones. Para E. hermes, con
podría servir como conector entre la unidad
menor
Normandía-San
unidad
divergencia entre las secuencias fue de
Tenche-Encanto. El embalse lleno puede
7.81%, encontrándose 145 cambios, de los
representar una barrera significativa (con una
cuales
longitud máxima aproximada de 2 Km. de
transiciones, 35 (24,1%) a transverisones y 45
espejo de agua entre las dos vertientes de la
(31,1%) a inserciones o delecciones.
la
capacidad
65
(44,8%)
correspondieron
y
cuales
y
(57,7%)
entre
del
coberturas hostiles, como pastos limpios,
Ignacio13
45
el
La
de
dispersión,
correspondieron
a
la
a
quebrada La Cancana), aislando de manera
101
En H. vanilia se encontraron 6 haplotipos y
fueron los haplotipos 1 y 5, ambos ubicados
en E. hermes se encontraron 4 haplotipos.
en Tenche, Encanto y Normandía. El
Aunque el número de haplotipos fue mayor
haplotipo 3 fue el que se encontró en el
en la especie con mayor dispersión, el
mayor número de individuos y el más
número de cambios entre los haplotipos fue
distante
mayor en la otra especie. Al comparar los
dispersión como el elemento responsable de
haplotipos
mayor
la distribución de los haplotipos, este
dispersión, se encontraron 12 sustituciones de
haplotipo podría ser una variación de uno
nucleótidos.
ancestral que ha dispersado a la mayoría de
de
En
la
especie
la
otra
con
especie,
se
de
los
demás.
Asumiendo
la
encontraron 19 cambios entre los haplotipos.
los fragmentos.
Al considerar las inserciones y /o deleciones
Para estimar el flujo de genes y la subdivisión
estas fueron mayores en la especie con menor
poblacional, se consideraron los bosques
capacidad de dispersión. En la distribución de
Normandia y San Ignacio 13 como una sola
algunos de los haplotipos en el paisaje
unidad, ya que en 1961 constituían una
algunos presentan localización geográfica, en
unidad que se separó antes de 1979 y volvió a
especial los de la especie con menor
conectarse
dispersión. En esta los haplotipos 1 y 4
secundarios entre 1989 y 2001 (ver análisis
fueron los más ampliamente distribuidos, el
del paisaje). Esta unidad representó para el
haplotipo 2 sólo se encontró en Normandia y
análisis el área de mayor tamaño con 293,3
Encanto y el haplotipo 3 sólo se encontró en
ha. La segunda unidad fue Tenche-Encanto,
San Ignacio. El haplotipo 3 fue el más
representando fragmentos pequeños y muy
distante y el menos frecuente. Los haplotipos
cercanos (25,88 ha y 7,53 ha, separados por
más comparables fueron el 1 y el 4, ambos
0,85 Km.). Esta unidad esta separada de los
ubicados en San Ignacio 13 y Encanto. Para
demás fragmentos por 1,95 Km. de Encanto a
la especie con mayor dispersión, el haplotipo
Normandia y 3,79 Km. a San Ignacio45.
6 sólo se encontró en el fragmento Tenche, el
Además de la corta distancia entre estos, los
haplotipo 4 sólo en el Encanto y los
conecta un corredor relacionado con la
haplotipos 2 y 5 sólo en Normandía. Los
quebrada La Frijolera y el drenaje adyacente,
haplotipos 4, 5 y 6 presentaron una baja
así como diferentes estados sucesionales
frecuencia, con los haplotipos 1 y 3
avanzados. El bosque San Ignacio45 se
ampliamente distribuidos. Los más similares,
consideró como otra unidad, ya que aunque
por
rastrojos
y
bosques
102
se encuentra separado de Normandia y San
comparaciones en la especie con menor
Ignacio13 por una distancia relativamente
dispersión. El valor de cero para San Ignacio
corta (0,260 Km.), se encuentra en un área
45 se debe a que los individuos muestreados
diferente, pues está separado por la quebrada
tenían el mismo haplotipo. Los valores de Fst
La
mayores
Cancana,
una
carretera
y
pastos
a
0.135
son
indicativos
de
establecidos desde vieja data. Su tamaño se
restricciones de flujo de genes y valores
encuentra en un rango medio en relación a las
mayores como el de 0.444 para E. hermes
otras unidades.
entre Tenche-Encanto y San Ignacio45
Las tablas 1 y 2 presentan los parámetros
indican casi ningún flujo, de acuerdo a otros
estimados para H. vanilia y para E. hermes:
estudios realizados con insectos, incluyendo
mariposas, a escalas geográficas amplias
Tabla 1. Variabilidad genética de H. vanilia y
comparadas con las del presente estudio
de E. hermes.
(Rogers et al, 1996).
H. vanilia
En general, se documentó mayor restricción
E. hermes
Población
Pi
K
Pi
K
al flujo genético entre unidades en la especie
Normandia-San Ignacio 13
0.0504
2.5
0.0271
13.53
con menor dispersión, con excepción de
Tenche-Encanto
0.0053
2,64
0.0267
13.33
San Ignacio 45
0
0
0
0
Tabla
2.
Diferenciación
genética
entre
poblaciones de H. vanilia y de E. hermes
H. vanilia
Comparación
Normandia-San Ignacio13
Encanto.
recalcular
Al
13
y
Tenche-
los
índices
comparando sólo dos grupos geográficos,
norte y sur, se encontró evidencia de una
Theta
Fst
Theta
Fst
contribución
0.0030
0.028
0.0191
0
diferenciación fue evaluada usando el modelo
0.0060
0.119
0.0151
0.444
de
la
distancia
a
la
de aislamiento por distancia (Wright 1946).
El test de Mantel no encontró influencia de la
San Ignacio45
Normandia-San Ignacio13
0.0003
0.375
0.0018
0.248
San Ignacio45
distancia en la diferenciación entre unidades
para ninguna de las especies. Para estimar de
Los valores de Pi sugieren moderada
variabilidad
Ignacio
restricción al flujo genético entre grupos. La
E .hermes
Tenche-Encanto
Tenche-Encanto
Normandía-San
entre
los
individuos
de
Normandia-San Ignacio para la especie con
mayor dispersión para la mayoría de las
forma adicional la subdivisión entre las
poblaciones siguiendo recomendaciones de
Slatkin y Maddison (1989) se realizó un
método de análisis cladístico (usando el
103
programa PAUP, versión 4.0B 10), aplicando
considerarse un fragmento representativo de
un algoritmo de parsimonia para hallar el
las condiciones típicas para estas especies
mejor árbol del gen. Los árboles indican que,
antes de la alteración de su hábitat natural
aunque existe evidencia de restricciones de
original.
flujo genético, no han sido lo suficientemente
Conclusiones y Recomendaciones
grandes como para originar clades con
Desde el componente ambiental de la
localización
No
dimensión biótica se trabaja con el desarrollo
obstante, se evidencia una mayor restricción
de inventarios de biodiversidad, evaluación
de flujo en E. hermes. Para esta especie el
de grupos registrados como amenazados o de
haplotipo más basal correspondió al haplotipo
importancia particular y análisis del paisaje
1. En la topología hay tres clados derivados
para identificar corredores potenciales o
de este haplotipo: los haplotipos 2, 3 y 4,
barreras a la movilidad, incorporando esta
siendo el último el más derivado y el más
información a las áreas de mayor diversidad o
distribuido en las poblaciones. Para H. vanilia
endemismo
se encontró, que el haplotipo 1 fue el más
modelación ambiental para evaluar riesgos
basal o ancestral, del cual se derivaron los
potenciales
haplotipos
importancia estratégica.
geográfica
restantes.
explícita.
Dentro
de
estos
y
y
aplicando
estrategias
determinar
zonas
de
de
haplotipos, el más derivado o reciente
Empleando las mariposas como sistema
correspondió al haplotipo 2; sin embargo, el
modelo, a manera de estudio de caso
haplotipo que se encuentra más disperso fue
exploratorio para la inclusión la información
el haplotipo 3. La distribución de los
genética en la gestión ambiental, este trabajo
haplotipos, indica que existe algún grado de
se desarrolló bajo las hipótesis de que los
diferenciación genética, pero que aún así
elementos de paisaje, en especial el tamaño,
existe cierto nivel de flujo de genes entre las
la distribución de los parches y la distancia
poblaciones asociadas a los bosques, y que es
geográfica, afectan de manera diferencial las
muy probable que los haplotipos más
especies con diferentes capacidades de
recientes deban su distribución a la capacidad
dispersión, siendo posible identificar estos
de dispersión de la especie. Para ambas
elementos a partir del análisis del ADN
especies,
mitocondrial,
el
conjunto
Normandia-San
siendo
posible
identificar
Ignacio13, que fue el de mayor tamaño,
unidades de manejo. El modelo analítico y
poseía mayor diversidad haplotípica y podría
procedimental desarrollado que podría a corto
104
plazo
incorporarse
de
Las redes de drenaje en la zona de estudio, en
investigación es (1) Escogencia del marcador
particular del bosque Normandia pueden
molecular, así como del organismo modelo
explicar
de trabajo mas apropiado para el problema de
haplotipos.
investigación, (2) Estudio del paisaje actual y
diversidad y estabilidad temporal, sugieren
de la dinámica espacial de la zona por medio
que
de análisis cualitativo y cuantitativo de los
representativa. Adicionalmente, los bosques
patrones observados, (3) Integración de la
Tenche y Encanto, aunque son de un tamaño
información genética de las poblaciones con
reducido, aparecen como una unidad de
las características del paisaje, como área,
manejo de importancia para la preservación
forma
de la diversidad genética. La barrera qué
y
distancia
en
entre
trabajos
los
hábitats,
es
la
representatividad
Esto
la
unido
unidad
a
de
de
su
los
tamaño,
manejo
más
conectividad y contraste de hábitats.
presenta la quebrada Cancana a la altura de
En el presente estudio, al determinar la
los bosques San Ignacio, puede representar
conexión física por existencia de corredores
un punto crítico para el manejo poblacional.
ecológicos entre las unidades de bosques
Es importante recalcar que la dinámica del
primarios Tenche–Encanto en la vertiente
paisaje, así como la variabilidad local, las
norte de la quebrada La Cancana y el
condiciones ambientales y la calidad del
conjunto Normandia–San Ignacio13 en la
hábitat,
vertiente sur de la misma quebrada, se
complejidad al estudio de la fragmentación y
encontró
de la conectividad funcional entre las
que
diferenciaron
ambos
en
su
corredores
se
estructura
y
imprime
un
alto
grado
de
unidades.
homogeneidad. Mientras el de la vertiente
La información obtenida aparece como una
norte fié más diverso e irregular, el inferior
línea base para evaluaciones futuras para el
fue más homogéneo y extenso (posiblemente
seguimiento en el tiempo, tanto de la
por distintas condiciones topográficas y grado
evolución del paisaje como de la genética de
histórico de presión antrópica). El bosque San
las poblaciones que soporta, en aras de
Ignacio45 fue el más aislado, aunque
alcanzar un mayor conocimiento de las
representa una conexión potencial entre las
dinámicas espaciales y su influencia en los
unidades Normandía-San Ignacio y Tenche-
organismos. Esto es significativo en una zona
Encanto.
de
importancia
estratégica
para
la
conservación de la biodiversidad, al tratarse
105
de relictos de bosque tropical en un valle
decisiones sobre el manejo en la zona y en los
interandino,
hábitats fragmentados
reconocidos
como
de
alta
prioridad a nivel nacional e internacional.
Bibliografía
De importancia sería explorar los efectos del
AGUDELO R., E.A. y RESTREPO M., J.C.
aumento en el tamaño muestral y la
Análisis
implementación de otras técnicas como los
vegetales en un bosque húmedo tropical (Rio
microsatélites. Se presentan diversas líneas de
Porce,
trabajo para el desarrollo de investigaciones
(Ingeniería Forestal). Universidad Nacional
futuras. Se debería la modelación del paisaje
de Colombia sede Medellín. 41 p. 2004.
para de terminar potenciales puntos críticos
para
la
conectividad
de
unidades
poblacionales, y la aplicación de técnicas
moleculares. Igualmente estudios sobre la
dispersión
los
organismos,
permitiría
fortalecer el nexo entre la información
biológica,
la
genética
y
el
paisaje.
multitemporal
Colombia).
de
Trabajo
coberturas
de
grado
BEJARANO M., E.E. Variabilidad genética y
especiación
en
Lutzomyia
(verrucarum)
evansi (Nuñez Tovar, 1924), vector de
leishmaniasis visceral americana. Trabajo de
grado (M.Sc.) PECET / Universidad de
Antioquia. 2001.
Adicionalmente, debe explorarse a mayor
BENDER, D.J.; CONTRERAS, T.A. y
profundidad
las
FAHRIG, L. Habitat loss and population
coberturas del paisaje para el movimiento de
decline: a meta-analysis of the match size
los organismos, así como la aplicación de
effect. En: Ecology. Vol. 79, No 2. p. 517-
técnicas de análisis espacial para involucrar
533. 1998.
la
permeabilidad
de
variables diferentes a la biótica que puedan
influir en la conectividad poblacional.
Consideramos que la incorporación de la
información
genética
en
la
toma
de
decisiones relacionadas con la intervención
de los hábitats naturales, es un elemento
indispensable para lograr un desarrollo
BROWN, K.S. y FREITAS, A.V.L. Butterfly
communities of urban forest fragments in
Campinas, Sao Paulo, Brazil: structure,
instability, environmental correlates, and
conservation.
En:
Journal
of
insect
conservation. No 6. p. 217-231. 2002.
sustentable a partir de las estrategias de
FRANKHAM, R. Conservation genetics. En:
gestión. Estos elementos complementan el
Annual Review of Genetics. Vol. 29. p. 305-
estudio actual de los efectos de la toma de
323. 1995.
106
HUDSON, R.R.; BOSS, D.D. y KAPLAN,
N.L.
A
geographic
statistical
test
subdivision.
for
En:
detecting
Molecular
biology and evolution. Vol. 9, No 1. p. 138-
fritillary butterfly: modeling the effect of
habitat fragmentation. En: Acta oecologica.
No 23. p. 287-296. 2002.
SIMMONS, R. B. y WELLER, S. J..Utility
151. 1992.
MANEL,
M. Metapopulation dynamics of the bog
S.;
SCHWARTZ,
M.K.;
LUIKART, G. y TABERLET, P. Landscape
genetics: combining landscape ecology and
and evolution of cytochrome b in insects. En
Molecular phylogenetics and evolution. Vol.
20. No 2. p. 193-210. 2001.
population genetics. En: TRENDS in ecology
SLATKIN,
and evolution. Vol. 118, No 4. p. 189-197.
comparison of three indirect methods for
2003.
estimating average levels of gene flow. En:
PORTER CH. y COLLINS F.H. Speciesdiagnostic differences in a ribosomal DNA
M.
y
N.H.
BARTON.
A
Evolution. Vol. 43, No 7. p. 1349-1368.
1989.
internal transcribed spacer from the sibling
TURNER, M.G. y RUSHER, C.L. Changes
species Anopheles freeborni and Anopheles
in landscape patterns in Georgia, USA. En:
hermsi (Diptera: Culicidae). En: American
Landscape ecology. Vol. 1, No 4. p. 241-251.
journal of tropical medicine and hygiene. No
1988.
45. p. 271–279. 1991.
ROGERS,
D.L.;
URIBE S., S.I. Population structure and
MILLAR,
C.I.
y
speciation in the morphospecies Lutzomyia
WESTFALL, R.D. 1996. Genetic diversity
longipalpis (Lutz & Neiva) as derived from
within species. Cap 28. En: ERMAN, D.C.
mitochondrial
Sierra Nevada ecosystem project: final report
Biología
to congress, Vol. II, Assessments and
Antioquia-Center
scientific basis for management options.
Medellín. 73 p. 1999.
Davis: University of California, Centers for
Water and Wild land Resources. p. 759-838.
SAWCHIK, J.; DUFRENE, M.; LEBRUN,
ND4
molecular).
for
gene.
Tesis
(Ph.D.
Universidad
Diseases
de
Control.
WRIGHT, S. Isolation by distance under
diverse systems of mating. En: Genetics. No
31. p. 39-59. 1946.
P.; SCHTINCKZELLE, N. y BAGUETTE,
107

Documentos relacionados