editor

Comentarios

Transcripción

editor
Octubre 2015
E-mail: [email protected]
Communications and Publications Division (CPD) of the IFCC
Ibero-American Nomenclature and Translations (WG-IANT)
EDITOR
Dra. María del Carmen Pasquel Carrera
» Chair del Grupo de Trabajo de Iberoamérica de Nomenclatura y traducciones. (WG-IANT)
» Gerente General de CEA.
Quito-Ecuador
GRUPO DE TRABAJO DE IBEROAMÉRICA
DE NOMENCLATURA Y TRADUCCIONES
DIAGNOSTICO IN VITRO
2
ÍNDI
CE
Editorial
03
Descripción de logotipo RIA / DIV
04
Descripción de logotipo XXII Congreso COLABIOCLI 2015
05
Pre Congresos / XXII Congreso COLABIOCLI 2015
06
Intra Congresos / XXII Congreso COLABIOCLI 2015
09
Agenda científica / XXII Congreso COLABIOCLI 2015
10
Ceremonia Inaugural y de Clausura / XXII Congreso COLABIOCLI 2015
12
EXPOLAB y Eventos Sociales / XXII Congreso COLABIOCLI 2015
14
Noticias: Red de instituciones universitarias formadoras de los
profesionales bioquímicos o títulos equivalentes de América Latina y el
16
Caribe
Artículo Científico: Especificaciones de la calidad en el laboratorio
clínico y la seguridad del paciente
18
Artículo Científico: Hígado e inmunidad
21
Jóvenes Investigadores / IFCC - CoReBio: Un espacio para los
“Residentes Bioquímicos” en Argentina
25
Entrevista: El gluten, ¿está relacionado con el Autismo y la
Esquizofrenia? PARTE 1 - Dr. Alessio Fasano
CONSEJO
EDI
TO
RIAL
Director:
María del Carmen Pasquel
Rafael Calafell - España
Patrocinio Chueca - España
Alba Marina Valdes de García - Guatemala
Hernán Fares Taie - Argentina
28
DIAGNOSTICO IN VITRO
EDITORIAL
3
La revista electrónica Diagnóstico in vitro es un
proyecto del Grupo de Trabajo Iberoamericano de
Nomenclatura y Traducciones de la Federación
Internacional de Química Clínica, destinado a
facilitar el intercambio de información científica
entre los países de habla portuguesa y española.
Pretende ser un nexo de unión entre los
países latinoamericanos, Portugal y España, que
contribuya a difundir temas científicos a través de
Internet, facilitando el conocimiento de publicaciones y temas de interés común a las ciencias de
laboratorio clínico.
Para lograr el objetivo anterior que consta como
presentación de nuestra portada electrónica, el
grupo se reúne mínimo dos veces al año, en eventos que IFCC auspicia u organiza, por esta razón
se han realizado hasta el momento bajo esta dirección, dos encuentros de trabajo, el primero en
una ciudad que envuelve la historia de la humanidad, en el marco del WorldLab de IFCC desarrollado en Estambul del 22 al 26 de junio 2014 y la
segunda en otra ciudad donde la majestuosidad
y el encanto se conjugan para hacerla inolvidable
durante el EuroMedLab en París del 21 al 25 de
junio 2015.
En estas dos reuniones de trabajo se puso como
meta la reestructuración y actualización del Rincón Iberoamericano (RIA) y de la revista Diagnostico In Vitro, siendo la revista una fuente interesante
para la actualización y fortalecimiento continuo de
profesionales de ciencias del laboratorio clínico,
pero además se puede dar a conocer temas de
interés para nuestro desempeño diario, apoyando
también a Sociedades de países miembros que
hasta el momento no han logrado implementar
una revista electrónica, especialmente por el factor económico.
Se pretende lograr un nexo de mayor comunicación entre los países que conformar el RIA. Aprovechando la solidaridad y amistad de los profesionales que lo conforman y la sólida estructura de
sociedades científicas que dan soporte para consolidar este objetivo.
Así se genera la información mediante el proporcionar temas de investigación, o información de
eventos científicos importantes, o noticias y novedades de interés profesional.
La edición inicial bajo un nuevo formato, se presenta por primera vez en esta ocasión tomando
Dra. María del Carmen Pasquel
Director del Consejo Editorial
Chair WG – IANT / CPD / IFCC
como tema principal el XXII Congreso de la Confederación Latinoamericana de Bioquímica clínica,
COLABIOCLI 2015, evento que se realizará en Quito, ciudad Patrimonio de la humanidad, del 22-26
de septiembre de 2015.
Profesionales que disertarán temas importantes
durante el desarrollo del congreso han aportado
para esta edición de DIV, trabajos relacionados a
sus exposiciones, así tendremos el de los doctores argentinos, María Angélica Véliz y Roberto Rodríguez con el título Hígado y autoinmunidad.
Sobre la calidad analítica una experta profesional
de Colombia la Dra. Alba Cecilia Garzón presenta
el tema: Especificaciones de la calidad en el laboratorio clínico y la seguridad del paciente.
El Dr. Carlos Navarro, Presidente de COLABIOCLI,
realiza un resumen de los 3 foros de encuentros
de Universidades de Latinoamérica y el Caribe que
se han realizado en, Carlos Paz –Argentina, Bogotá-Colombia, Caracas-Venezuela, e invita al IV
Foro a desarrollarse el día 26 de septiembre en el
XXII Congreso COLABIOCLI 2015.
Se cuenta con el apoyo de la Radio on line “El Microscopio”, que colabora con entrevistas realizadas por ellos y que se transcriben para ser presentados en cada una de las ediciones de la revista
electrónica.
Editores invitados de diferentes países presentan
artículos o entrevistas que dan a conocer novedades en el área de la medicina del laboratorio. Se
posee un comité de redacción que lo integran los
representantes de los países que conformar el
grupo de Trabajo del Rincón de Iberoamérica de
Nomenclatura y traducciones (WG-IANT por sus
siglas en inglés). Todo el equipo tanto el consejo
como el comité editorial tienen la responsabilidad
y sobre todo el deseo de colaborar para generar
esta revista Diagnóstico In vitro que le invitamos a
disfrutar en su edición septiembre 2015.
DIAGNOSTICO IN VITRO
LOGOS
Descripción RIA / DIV
RIA: RINCON IBEROAMERICANO
Dos líneas rectas unidas de forma tangencial, uno de los lados del ángulo forma parte de
la letra R, mientras que el otro sostiene la tilde de
la letra ñ. El anagrama conjuga las letras de los
ámbitos que definen el organismo representado
(RIA), con la virgulilla de la letra ñ, cuyo sonido en
portugués se consigue con el dígrafo “nh”, como
símbolo de la comunidad hispano y portuguesa
hablante y con la representación del concepto rincón. Se utiliza el negro como diferenciador de la
actividad. El fondo del logo RIA, es naranja y se
relacionaría con el color institucional de la Confederación Latinoamericana de Bioquímica Clínica
(COLABIOCLI).
4
Siguiendo una secuencia real de ADN, GTTCAATGGCTCCAGCATCG se ha asignado los nucleótidos de la siguiente forma: T color verde, G color
azul, C color rojo y A color amarillo. La fuente de
la letra es antigua y es similar a la primera que se
empleo en la representación de las secuencias en
los primeros artículos científicos que trataban el
tema. El fondo de la secuencia se sitúa el color negro para facilitar el contraste. Los colores también
simbolizan las banderas de los diferentes países
que conforman el Rincón Ibero Americano (RIA).
DIV: REVISTA DIAGNOSTICO IN VITRO
DIV La cabecera está compuesta de dos
partes. En la izquierda aparece un cuadrado de
fondo azul. Dentro del mismo aparece el globo terráqueo que contiene en su interior la virgulilla de
la letra ñ, signo distintivo de la lengua española y
tilde de la portuguesa, cuyo sonido en portugués
se consigue con el dígrafo “nh”.
El uso del globo terráqueo da continuidad al logo
de la IFCC En la zona de la derecha aparece el texto DIAGNÓSTICO IN VITRO en dos líneas. El color
azul se relaciona sicológicamente con las cualidades intelectuales: inteligencia, ciencia y concentración y el acorde cromático típico es azul-blanco.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
Descripción de logotipo
Congreso COLABIOCLI 2015
5
Congreso
Latinoamericano de
Bioquímica Clínica y
Ciencias de Laboratorio
COLABIOCLI
24, 25 y 26 Septiembre, Quito - Ecuador
» La Línea Equinoccial
Divide a Ecuador y el Mundo en hemisferio Norte y Hemisferio Sur. Conocida
también como Ecuador da nombre a nuestro país que se encuentra el la
Latitud 0° - 0’ - 0’’.
» El ADN
Está presente en todos los seres vivos del planeta, por eso en el logotipo el
símbolo del ADN envuelve a monumento de la Mitad del Mundo.
» El ser humano aspira siempre el progreso y la superación
Nosotros como bioquímicos y profesionales de la salud aspiramos que la
vida del ser humano esté siempre en una mejora continua, con tendencia
ascendente.
El logotipo simboliza el mundo, la vida que lo envuelve y la bioquímica que
es la vida misma en el ADN.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
Pre congresos
Técnicas avanzadas de calidad analítica
A U S P I C I O: Este taller es auspiciado casi en su totalidad por Fundación Wallace Coulter
Núcleo SEBIOCLI Azuay
6
19 Y 20 SEPTIEMBRE
HOTEL ORO VERDE
CUENCA
Dr. Gabriel Migliarino (Arg)
Dr. Benjamín Fernández (Chile)
Dra. Evangelina Hernández (Arg)
90 participantes provenientes del Ecuador y varios países
de la región participaron de este evento.
DE IZQUIERDA A DERECHA - Dr. Benjamín Fernández (Chile) expositor, Dr. Elías Caro –
Fundación Wallace Coulter, Sr. Eduardo Callejas – Fundación Wallace Coulter, Dra. María
del Carmen Pasquel – Presidenta Comité Organizador, Dra. Sonia Domínguez – Presidenta
SEBIOCLI Núcleo Azuay, Dra. Evangelina Hernández (Argentina) expositora, Dra. Patricia
Ochoa y Dra. María Alvarez , Comité Científico Congreso COLABIOCLI, Dr. Gabriel Migliarino
(Argentina) expositor.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
Pre congresos
Técnicas avanzadas de calidad analítica
A U S P I C I O: Este taller es auspiciado casi en su totalidad por Fundación Wallace Coulter
Núcleo SEBIOCLI Pichincha
7
22 Y 23 SEPTIEMBRE
HOTEL JW. MARRIOTT
QUITO
Dr. Gabriel Migliarino (Arg)
Dr. Benjamín Fernández (Chile)
Dra. Evangelina Hernández (Arg)
En el Hotel JW Marriott durante la clausura del Pre
Congreso en Quito. Participaron profesionales de Ecuador,
México, Chile, Argentina, Perú, Guatemala.
Autoridades de la Fundación Wallace Coulter, Expositores del taller junto con
parte del Comité Organizador del Congreso COLABIOCLI.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
Pre congresos
Biomarcadores en las enfermedades cardiovasculares y cerebro
vasculares - Factores de riesgo
A U S P I C I O: Este taller es auspiciado casi en su totalidad por Fundación Wiener Lab.
Núcleo SEBIOCLI Pichincha
8
22 Y 23 SEPTIEMBRE
Colegio de QBFP
QUITO
Dra. Lida Morisoli (Arg)
Dra. Stella Daniele (Arg)
Los participantes recibieron un taller técnico científico de alto nivel.
Estuvieron presentes de varias provincias del Ecuador y profesionales de
Cuba, Venezuela y Estados Unidos.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
9
Intra congresos
INTRACONGRESO Nº4
INTRACONGRESO Nº5
HOTEL JW. MARRIOTT
SALÓN: AMAZONAS (A)
HOTEL JW. MARRIOTT
SALÓN: AMAZONAS (D-E)
Dra. María Lasta
Dra. Liliana Roquel
Procedencia: Argentina
Dra. Graciela Pennacchiotti
Dra. Silvia Benozzi
Dra. Gisela Unger
Procedencia: Argentina
Enfermedad celiaca
Nuevos conceptos, diagnóstico
inmunológico y patologías
asociadas.
INTRACONGRESO Nº7
Aseguramiento de la calidad en la
Etapa Pre - Analítica
INTRACONGRESO Nº8
HOTEL JW. MARRIOTT
SALÓN: ESMERLADAS
HOTEL JW. MARRIOTT
SALÓN: BIBLIOTECA
Dra. Rosana Acheme
Procedencia: Argentina
Dr. Enrique de Jesús
González Cruz
Procedencia: México
Control de calidad en equipos
de laboratorio clínico FBA
Control de instrumental
Patrocinador:
Fundación Bioquímica Argentina
Dr. Enrique de Jesús González Cruz
Expositor, Intra congreso - Hematología
Hematología
• Interpretación de Histogramas
de equipos automatizados en el
área de hematología diagnóstica,
• Serie Eritroide : Anemias,
Talasemias Hemoglobinopatías
• Serie Blanca: Patologías.
• Leucemias mieloides y
leucemias linfoides
INTRACONGRESO Nº6
HOTEL JW. MARRIOTT
SALÓN: AMAZONAS (H)
Dr. Gabriel Lima Oliveira
Dr. José Abol
Dra. Andrea Piazza
Dra. Karina Chavez de Abán
Procedencia: Brasil
Preparación de Auditores
Internos PNCQ
• Preparación de Auditores
en las Etapas analíticas en los
laboratorios clínicos (Acreditación
de los laboratorios clínicos por la
Norma ISO 15189)
• Conocimientos teóricos prácticos
para el auditor interno
• Preparación de auditores
Internos. Herramienta
informatizada para la gestión de
la calidad y acreditación (PNCQ
Gestor)
• Entrenamiento teórico y práctico
de los auditores Internos (Teatro)
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
10
Agenda Científica
Durante los días 24, 25 y 26 de 09h00 a
18h00 se desarrollaron una extensa agenda científica que incluían mesas redondas, simposios,
conferencias magistrales, mini cursos y plenarias.
Participantes provenientes de los 22 países confederados a COLABIOCLI, de toda América, Europa,
África y Asia, asistieron a cinco salas que de forma simultáneas presentaban temas actualizados
que abarcaban todas las ciencias y medicina del
laboratorio. Se realizó con el apoyo científico de 70
expositores extranjeros y 30 profesionales prestigiosos del Ecuador.
Tuvo auspicio de Organismos internacionales
como IFCC, OPS/OMS, AACC, Fundación Wallace
Coulter, Fundación Wiener Lab, Fundación Bioquímica Argentina y COLABIOCLI. Organismos
Nacionales como Servicio de Acreditación Ecuatoriano (SAE), Ministerio de Salud Pública (MSP)
y contó con el Aval Académico de las Facultades
de Ciencias Químicas de la Universidad Central del
Ecuador y Universidad de Cuenca.
Durante el mini curso de control de calidad en hematología
presentado por el Dr. Gabriel Migliarino de Argentina
Al finalizar la mesa redonda sobre el Programa de
Evaluación Externa de Calidad y las experiencias en
América Latina, Dr. Antonio Antúnez de Mayolo – Perú,
Dra. Miriam Fernández y Dra. María Olga – Ecuador, Dra.
Alba Marina Valdéz de García – Guatemala, Dra. María del
Carmen Pasquel Carrera – Ecuador, Dr. Roberto García –
Argentina (moderador), Dr. Raúl Girardi – Argentina y Dr.
José Abol – Brasil.
Expositores del Simposio Avances en la medicina del
laboratorio pediátrico: Dr. Edgard Delvin – Canadá, Dr.
Thair Pillay – Sudáfrica, Dr. Khosrow Adeli – Canadá,
junto con las doctoras: María del Carmen Pasquel y Reina
López integrantes del Comité Organizador.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
Agenda Científica
11
Dr. Antonio Ríder – moderador del Simposio Seguridad
del paciente en la fase pos analítica que presentó la
Asociación Española de Farmacéuticos Analistas (AEFA).
Dr. Tomas Zima – República Checa, en su exposición de
marcadores tumorales utilizados en la práctica general,
detección, seguimiento y eficacia.
Dr. Maurizio Ferrari – Italia, Presidente de IFCC
en su exposición Biopsia líquida una nueva
tendencia en el diagnóstico del cáncer, en el
Simposio Innovaciones en el Laboratorio de
Diagnóstico Molecular.
Dr. Edgar Becerra (Ecuador) – luego de concluir
su conferencia referida a Diagnóstico de
patologías onco-hematológicas, en el Simposio
Ciencias del Laboratorio.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
Ceremonia Inaugural
En la ceremonia inaugural se dio la bienvenida a todos los participantes a través de una carta
enviada por el Sr. Alcalde del Distrito Metropolitano de Quito, Dr. Mauricio Rodas, se dirigieron al auditorio el Dr. Maurizio Ferrari - Presidente de IFCC,
Dr. Carlos Navarro – Presidente de COLABIOCLI,
QF. María Saldarreaga – Presidenta de SEBIOCLI
Nacional, Dr. Jean Marc Gabastou – Representante OPS/OMS, Dra. María del Carmen Pasquel –
Presidenta Comité Organizador.
La Dra. María del Carmen Pasquel declaró oficialmente inaugurado el XXII Congreso Latinoamericano de Bioquímica Clínica y Ciencias del Laboratorio COLABIOCLI 2015, “Desde la Mitad del
Mundo hacia la Bioquímica del nuevo milenio”.
Un acto emotivo representó el que por primera vez
el Himno de COLABIOCLI fuese entonado concluyendo la Ceremonia de Inauguración.
12
Se entregó el Premio Wiener Lab al mejor trabajo
de Investigación, lo recibió la Dra. Ana Isabel Sánchez Bermúdez de Chile, residente en España, con
el Tema: “Evaluación de RAD51C como predictor
de susceptibilidad genética en familias con síndrome de cáncer de mama y ovario hereditario”. El
premio fue entregado por el Dr. Juan Tomás Nesprías. Gerente Product Team Wiener Lab.
Ceremonia de clausura
QF. María Saldarreaga – Presidenta de SEBIOCLI
Nacional agradeció a todos los participantes, expositores, industria por su aporte valioso al culminar con éxito el evento.
QF. María Saldarreaga – Presidenta SEBIOCLI, Dr. Roberto
García – Argentina, Presidente FBA / Vicepresidente
COLABIOCLI, Dr. Maurizio Ferrari – Presidente IFCC, Dr.
Carlos Navarro – Presidente COLABIOCLI, Dra. Isabel
Fierro – Decana de la Facultad de Ciencias Químicas de la
Universidad Central del Ecuador.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
El Premio Fundación Wiener Lab y SEBIOCLI para
posters, se presentó en la ceremonia de clausura,
el ganador fue seleccionado de entre 60 trabajos
participantes y lo obtuvo el grupo de la Universidad
Católica de Quito, tema: Epidemiología molecular de Klebsiella pneumoniae productora del gen
blaKPC, en cepas de muestras invasivas del Ecuador, autores: Carolina E. Satán, Córdova .D, Tamayo.Villacís. J, Villavicencio.F,Zabala.A,Reyes.J
13
Dra. Zuley Tamayo representante de NIPRO, recibe
Certificado y Placa de reconocimiento por parte de la
Dra. Consuelo Valencia – Presidenta SEBIOCLI Núcleo
Pichincha.
Dra. Cecilia Paula – Presidenta SEBIOCLI Núcleo
Chimborazo, realizó la entrega del reconocimiento
por el aporte importante de la industria para el éxito del EXPOLAB COLABIOCLI 2015, todas las empresas en su categoría de Auspiciante PLATINUM,
ORO, PLATA y ESTÁNDAR, recibieron sendos reconocimientos.
Un homenaje especial recibió el Dr. Roberto Chediak, por su aporte nacional e internacional en
beneficio de los profesionales bioquímicos del
Ecuador quién gestionó la inclusión de Ecuador
en COLABIOCLI desde hace 43 años.
Jurado calificador durante la presentación de los trabajos
de investigación para el concurso POSTER, estuvo
integrado por representantes de Guatemala, Perú, OPS/
OMS y Comité Organizador.
Dra. María del Carmen Pasquel – Asesora para el Ecuador
de la Fundación Wiener Lab hace la entrega del trofeo
para el ganador premio POSTER.
DIAGNOSTICO IN VITRO
XXII CONGRESO COLABIOCLI 2015
Un reconocimiento especial recibió Anita
de Pérez – Secretaria Ejecutiva del Congreso COLABIOCLI y la Dra. María del Carmen Pasquel por
el arduo trabajo realizado que contribuyó al éxito
del Congreso, en la gráfica consta también la Dra.
Rosa Vélez – miembro del Comité Científico del
Congreso.
EXPOLAB
Se presentó un EXPOLAB con lo último de tecnología para el laboratorio clínico, 20 casas comerciales recibieron la visita de los asistentes nacionales
y extranjeros.
14
La Dra. Paola Audicio – Presidenta de la Asociación Bioquímica de Uruguay (ABU), Dra. Graciela
Borthagaray – Presidenta del Comité Organizador
del XXIII Congreso COLABIOCLI 2017, Dra. Graciela Queiruga – Expositora de Uruguay y Dr. Carlos
Navarro – Presidente de COLABIOCLI.
Representantes de Argentina, República Dominicana y
Ecuador.
La delegación de Uruguay, presentó a la nueva
sede Punta del Este e invitó a los participantes a
concurrir al próximo Congreso COLABIOCLI 2017.
El Lic. Santiago Fares Taie, maestro de Ceremonia perteneciente a los jóvenes investigadores de
IFCC dio paso a la Dra. María del Carmen Pasquel
para que declare oficialmente la clausura del XXII
Congreso COLABIOCLI.
Actividades sociales y
culturales
Se desarrolló la cena de COLABIOCLI y autoridades Internacionales, con un mini city tour en la noche quiteña. Expositores y autoridades internacionales junto con el Comité Organizador disfrutaron
el encanto del casco colonial.
DIAGNOSTICO IN VITRO
15
La Noche Latina presento música, grupo folklórico - ASAMBLEA DE COLABIOCLI. El Comité Ejecutiy juegos de luces se acompañó de bocaditos con vo de COLABIOCLI, realizó su Asamblea General el
comida típica ecuatoriana. Se desarrolló en el Mu- día 25 de septiembre, presentando su informe de
seo del Agua “YAKU”.
actividades durante el período 2013 – 2015, también se realizaron las elecciones cuya Presidencia
recayó sobre la delegación de Uruguay.
- ELECCIÓN DE SEDE COLABIOCLI 2019, el país
que realizará el XXIV Congreso COLABIOCLI 2019
es Panamá. Su presentación fue sobre sus alcanReuniones adicionales
ces en los avances científicos y también presentaron un stand de todas las valiosas riquezas turísticas que este país centroamericano ofrece a sus
- Se realizó el IV FORO DE UNIVERSIDADES donde visitantes. La designación se dio en el marco de la
estuvieron presentes representantes de las Uni- Asamblea General de COLABIOCLI.
versidades de Latinoamérica y el Caribe, la reunión
estuvo presidida por el Dr. Carlos Navarro – Presidente de COLABIOCLI.
- TALLER DE TRAZABILIDAD, auspiciado por PTB y
con el apoyo del Comité de Trazabilidad para medicina del laboratorio de IFCC, se desarrolló este
importante taller con presencia de representantes
de Latinoamérica, el Caribe y Europa, lo presidió el
Dr. Lothar Siekman.
DIAGNOSTICO IN VITRO
NOTICIAS
16
“RED DE INSTITUCIONES UNIVERSITARIAS
FORMADORAS DE LOS PROFESIONALES
BIOQUÍMICOS O TÍTULOS EQUIVALENTES DE
AMÉRICA LATINA Y EL CARIBE”
Dr. Carlos Daniel Navarro
Presidente de COLABIOCLI
Se sabe que la denominación o título de
grado que habilita para la dirección de los laboratorios de salud en América Latina es muy diversa, es así que el título de bioquímico se otorga
en Argentina, Bolivia, Ecuador, Chile y Paraguay,
mientras que en otros países el título otorgado
es el de bioanalista, Tecnólogo médico, Químicos
Biólogos entre otros, partiendo de ésta realidad
en el periodo 2011 – 2013 se inició un trabajo de
acercamiento con las unidades académicas de
la región, elaborando conjuntamente con el Ente
Coordinador de Unidades Académicas de Farmacia y Bioquímica de la República Argentina (ECUAFyB) una encuesta, que es parte del acuerdo con
la Organización Panamericana de la Salud (OPS), El Dr. Carlos Navarro en el segundo Foro de Universidades
en Santa Marta-Colombia
la misma se distribuyó a la totalidad de los países
miembros obteniendo escasa respuesta, a pesar
de lo cual a través de la mismas se pudieron co- ya que a partir del origen propio de la actividad,
rroborar diferencias que se extendían más allá de que nace como analistas químicos de materiala denominación de los títulos otorgados.
les biológicos y orientados hacia la investigación
cuyo objetivo primordial consistía en descubrir la
Esto motivo la planificación, organización y ejecu- relación entre los resultados obtenidos y las enferción de talleres y jornadas de trabajo orientadas, medades y, también en desarrollar nuevas técnino a unificar la denominación de las carreras o tí- cas analíticas que utilizaran menores volúmenes
tulos, sino a definir un piso curricular exigible en la de muestra primaria.
región para dirigir los laboratorios de salud, éste ha
sido uno de los ejes centrales de la Confederación La formación profesional fue incorporada en faLatinoamericana de Bioquímica Clínica (COLA- cultades o academias de ciencias exactas, de
BIOCLI), ya que se han concretado tres Jornadas ciencias químicas o, de la salud, otorgando caracde Educación, denominadas “Foro de Unidades terísticas propias en el proceso enseñanza aprenAcadémicas Formadoras de Bioquímicos o Títu- dizaje con diferencias en las mayas curriculares
los Equivalentes de América Latina y el Caribe”, el exigidas para desarrollar una idéntica o similar
primero se desarrolló en la ciudad de Villa Carlos actividad profesional. No menos importante es
Paz- Córdoba – Argentina, el segundo en la ciu- la diversidad de ofertas académicas que existen
dad de Santa Marta – Colombia y el tercero en la en cada uno de los países mencionados y por
ciudad de Caracas – Venezuela. Se ha trabajado supuesto que se multiplican en la región, lo que
centrando la atención en los puntos de coinciden- dificultó en un principio detectar interlocutores vácia y también en reconocer las diferencias que en lidos y representativos para el trabajo conjunto.
algunos casos son insalvables a corto plazo.
Una de las características principales es que en
la mayoría de los países que conforman la COLABIOCLI se considera el estudio de grado como
disciplina y no como especialidad de la carrera de
medicina, como ocurre en otras regiones del mundo. Esto ha jerarquizado de alguna manera la actividad profesional desarrollada en los laboratorios
de salud y también ha impactado de diversas maneras en nuestro extenso y heterogéneo territorio,
DIAGNOSTICO IN VITRO
17
A partir de esta realidad se coincidió en la necesidad de generar un espacio que permitiera al sector
académico centralizar información y fundamentalmente que permitiera debatir y consensuar políticas tendientes a:
6. Impulsar la movilidad académica y científica de
estudiantes y profesionales bioquímicos o títulos
equivalentes de ALAC.
7. Trabajar coordinadamente con todas las instituciones y entidades representativas de la profesión
1. Propiciar acciones tendientes al intercambio de bioquímica y títulos equivalentes.
experiencia para la acreditación y certificación de
programas académicos en ALAC.
De esta manera en la ciudad de Caracas – Venezuela, como conclusión del “III Foro de Educación”,
2. Favorecer acciones y estrategias para contex- desarrollado los días 24 y 25 de Abril de 2015, se
tualización de procesos de acreditación interna- coincidió en la imperiosa necesidad de crear la
cional de Unidades Académicas en ALAC.
“Red de Instituciones Universitarias Formadoras
de los Profesionales Bioquímicos o Títulos Equiva3. Armonizar contenidos de las áreas de conoci- lentes de América Latina y el Caribe”, cuya primer
miento para el desarrollo de las competencias del actividad será convocar al “IV Foro de Educación”
profesional bioquímico o títulos equivalentes en que se desarrollará en el marco del “XXII Congreso
ALAC.
Latinoamericano de Bioquímica”, el día 25 de Septiembre de 2015 en la ciudad de Quito – Ecuador
4. Promover la actualización y educación continua y, desde su creación se ha convertido en el refeen ciencia y tecnología en el área del bioquímico o rente académico de la región vinculado a nuestra
títulos equivalentes en ALAC.
profesión.
5. Fortalecer la investigación y las políticas editoriales dirigidas a los profesionales y estudiantes de
bioquímica y títulos equivalentes en ALAC.
Tercer Foro de Universidades en Caracas-Venezuela
ARTÍCULOS CIENTÍFICOS
DIAGNOSTICO IN VITRO
Dra. Alba C Garzón G.
18
Directora científica ACG Quelite control
Docente Universitario Bogotá - Colombia
ESPECIFICACIONES DE LA CALIDAD
EN EL LABORATORIO CLINICO Y LA
SEGURIDAD DEL PACIENTE
Palabras Claves
Seguridad, especificaciones de calidad,
riesgo, precisión, Exactitud, modelo de
atención.
Resúmen
En la última década, los laboratorios han
concentrado todos sus esfuerzos en la
medición del desempeño de sus métodos
en términos de precisión, exactitud
y error total con la incorporación
de estándares internaciones como
CLIA, Especificaciones de variabilidad
biológica, entre otros. Se ha observado
un gran desarrollo de herramientas
estadísticas que evidencia la estabilidad
y confiabilidad en la ejecución de los
ensayos.
Pero las especificaciones
de calidad en laboratorio clínico no
pueden limitarse a un tema meramente
analítico y estadístico, el profesional del
laboratorio debe retomar el concepto
integral humanizado centrado en el
paciente y en las necesidades clínicas
asistenciales, donde basadas en la mejor
evidencia disponible y con el recurso
limitado que se tiene , se trabaje en la
obtención de unas especificaciones de
calidad individualizadas que respondan
a un enfoque de riesgo , seguridad
analítica y seguridad clínica, como meta
fundamental del proceso de atención del
laboratorio , mas allá de la estimación de
parámetros absolutamente estadísticos
,los cuales son importantes y necesarios,
pero que para la seguridad del paciente
se hacen insuficientes.
Correspondiente al autor:
Calle 99 No 71-21 Bogotá Colombia
Teléfono 3143585870 COD 571
E .mail: [email protected]
www.acgcalidad.com
Introducción
El reto del siglo XXI es la medicina del laboratorio, basado en la evidencia (toma de decisiones en base a hechos y datos) y la eficiencia
(contención y optimización de los recursos). Para
planificar las especificaciones de la calidad es
necesario partir de la interacción entre: el conocimiento, la experiencia y el sentido común. Una
meta de calidad, no puede obedecer únicamente
a incorporar las variables de tipo analítico, una
meta de calidad debe responder variables como
características de su modelo de atención, características operacionales y desde luego las características propias asociadas a la competencia
técnica desde su personal, sistemas analíticos, y
estructura de control. Las especificaciones de calidad describen los atributos y características de la
prestación del servicio de laboratorio clínico que
garantizan la confiabilidad de los resultados y una
atención segura y humanizada de los pacientes
atendidos.
Planificacion de las especificaciones
de calidad
La planificación de la especificaciones de calidad
debe partir de dos escenarios distintos, pero que
interactúan entre si permanentemente, el escenario clínico (El uso previsto del Análisis de laboratorio) y escenario analítico (Qué sucede en el laboratorio). En ambos participan diferentes actores,
responsabilidades y requisitos.
Para definir las metas y especificaciones de calidad partiendo de los escenarios clínico y analítico
se debe determinar primero cuáles son las necesidades clínicas asistenciales y luego establecer
de acuerdo a esas necesidades, los requisitos que
deben cumplir nuestros métodos de ensayo para
dar respuesta a las mismas.
Necesidades clínicas: Para que se solicita el análisis de Laboratorio, cual es el uso previsto de la
prueba:
• Diagnosticar y detectar
• Confirmar y descartar
• Control terapéutico, Blanco de tratamiento
• Pronóstico
DIAGNOSTICO IN VITRO
19
Dependiendo de estas necesidades clínicas las biológico y naturaleza propia del mensurando.
especificaciones analíticas pueden variar, se ne- Entender la diferencia asociadas a:
cesita incorporar métodos analíticos que tengan
mayor o menor:
• Variabilidad biología interindividual e interindividual.
• Sensibilidad diagnostica
• Índice de individualidad.
• Sensibilidad analítica/ Limite de Detección / lími- • Método de ensayo y sus variables (Colorimetría,
te de Cuantificación
Método enzimático, Inmunoensayo).
• Especificidad diagnostica.
• Estructura molecular (¿Qué mido , Una glicopro• Especificidad analítica.
teína, Un Ion,? etc. )
Adicionalmente los requisitos analíticos de des- Las especificaciones de calidad, están asociadas
empeño deben responder a cada escenario de también a la expresión del resultado así:
uso previsto; así dependiendo del escenario:
• Ensayo cuantitativo: Tiene metas definidas con
• Para monitorear: Se requiere de Mayor precisión una tolerancia admisible porque arroja sus resul(mayor o menor impacto)
tados en variables continúas y su interpretación
• Para diagnosticar; El requisito de mayor impacto está asociado a Umbrales de decisión y no a valoserá la exactitud.
res absolutos.
• Ensayo cualitativo: Requiere exactitud diagnósY desde luego se debe considerar en el estableci- tica, porque la decisión cambia de ser una pruemiento de las especificaciones el comportamiento ba positiva a negativa. Y cualquier cambio puede
afectar la decisión clínica para el paciente.
Seguridad analítica y seguridad del paciente
Los requisitos analíticosde desempeño de un método analítico son de responsabilidad compartida
y se presenta de manera sinérgica una interacción
entre el laboratorio y su accionar y lo que por manufactura nos ofrecen las casas comerciales de
tal forma que la seguridad analítica, es decir cómo
detecto el error en tiempo real, cuantos niveles de
control debo procesar y con qué frecuencia los
debo procesar , el manejo de los reactivos, el uso
adecuado de los equipos, su mantenimiento y estado de calibración , la aplicación correcta de los
procedimientos de medición es responsabilidad
directa del laboratorio, las estrategias estadísticas
e informáticas que se implementan para cuantificar el error, mientras que las especificaciones
intrínsecas de la prueba, linealidad, especificidad,
sensibilidad, calidad del calibrador y trazabilidad
son responsabilidad directa de manufactura. Esta
corresponsabilidad se traduce en la seguridad
analítica en los proceso del laboratorio clínico.
Los requisitos funcionales de gestión son responsabilidad únicamente del laboratorio, que se
interpretan en como garantiza el laboratorio su
accionar de cara al paciente en la prestación del
servicio; es lo que articulado con la seguridad analítica impactan la seguridad del paciente. Es aquí
donde el laboratorio debe haber definido muy claramente sus especificaciones de calidad en términos de oportunidad en entrega de resultados con
priorización por riesgo clínico, como ha establecido sus especificaciones de calidad para garantizar accesibilidad y continuidad en la prestación
del servicio.
De la sinergia perfecta entre la seguridad analítica y las especificaciones funcionales depende la
Seguridad del paciente. En la medida en que un
resultado del laboratorio, refleja la verdadera condición del paciente, y con este resultado el Medico
toma la decisión clínica que mejora la calidad de
vida del paciente, es lo que hoy conocemos como
OUTCOME, que se traduce explícitamente en seguridad del paciente, en seguridad clínica. Pero el
resultado debe ser entregado con la oportunidad
que se requiere, al paciente correcto, en el momento correcto, con la información necesaria y
correcta para la toma de las decisiones.
En este contexto entonces podemos concluir que
Las especificaciones de calidad las podemos entonces definir en estas dimensiones:
1. Especificaciones de calidad analítica:
Que son los atributos que el profesional del laboratorio debe garantizar en el día a día cuando realiza
el proceso de medición de una magnitud biológica, el desempeño analítico del ensayo centrados
en la precisión la veracidad y la exactitud del resultado así como en la habilidad de detección del
error, lo cual depende de su estructura de control
de calidad (número de niveles, concentración en
niveles de decisión clínico, frecuencia de montaje.
Sin dejar de mencionar que estas especificaciones de calidad analítica deben estar aseguradas
desde la selección del método y que por ello juega
aquí un papel muy importante las herramientas de
validación verificación evaluación de los métodos.
DIAGNOSTICO IN VITRO
20
2. Especificaciones de calidad operacionales:
dación e integración del sistema de información y
muy importante como ha definido los requisitos
Especificaciones asociadas a su funcionamien- de competencia e idoneidad de su personal con
to y a su estructura de gestión. Por ejemplo de enfoque de riesgo para la asignación de responsaacuerdo a su modelo de atención: Ambulatorio, bilidades dentro del proceso.
hospitalario, de Referencia; De acuerdo a su nivel
de estandarización de procesos e implementación
de buenas prácticas de laboratorio; de acuerdo a
su nivel de automatización, así como de consoliConclusión
El concepto de Especificaciones de calidad, es
en actualidad el punto de partida para establecer
los requisitos de calidad técnica y funcional que
deben cumplir los laboratorios clínicos para garantizar la seguridad analítica y así aportar a seguridad del paciente. El planteamiento de estas
especificaciones debe surgir de la interrelación de
las características operacionales y técnicas del la-
boratorio clínico, teniendo como base fundamental el escenario de uso clínico de la pruebas. Esto
implica un concepto de planificación individualizado, con enfoque de riesgo, y por ende una mejor
comprensión del modelo holístico, y una visión
más sistémica de lo que es la prestación del servicio de laboratorio clínico y su responsabilidad en
la seguridad del paciente.
Referencias
• GP33-A: Accuracy in Patient and Sample
Identification .
• Risk Management Tools for Improved
Patient Safety Workshop Announced
by Clinical and Laboratory Standards
Institute
• Calidad y Gestión en el Laboratorio
Clínico. Alba C Garzón G . Colombia
DIAGNOSTICO IN VITRO
ARTÍCULO
21
HÍGADO E INMUNIDAD
María Angélica Véliz
Profesora Facultad de Bioquímica Química y Farmacia.
Universidad Nacional de Tucumán. Argentina.
Ayacucho 471. S.M. de Tucumán. CP 4000.
E-mail: [email protected]
Roberto Rodríguez
Jefe Servicio de Gastroenterología y Hepatología
Sanatorio Sarmiento. Tucumán. Argentina.
Palabras Claves
Células hepáticas, auto anticuerpos,
inmunidad, citoquinas, inmunodeficiencia
Introducción
Las propiedades inmunológicas del hígado
se confrontan con las variedades del antígeno mayor de histocompatibilidad, tolerancias sistémicas
a antígenos alimentarios, infecciones virales persistentes, y una amplia gama de enfermedades
inmunes con especial afectación hepática.
Cualquier componente de la célula del hígado
puede disparar la producción de autoanticuerpos
patológicos, y sus reactividades se pueden encontrar contra proteínas nucleares, microsomales,
citosólicas y mitocondriales. Estos antígenos intracelulares pueden expresarse en la superficie de
la membrana celular, y el hepatocito presentaría
Esta revisión intenta resumir la información exis- autoantígenos generando autoanticuerpos.
tente sobre las funciones, las células inmunes y
autoanticuerpos del hígado sano y en situaciones Una intrincada red con un endotelio sinusoidal no
de patología. Se hace mención a los sistemas in- continuo y un flujo sanguíneo lento en ella, permite
munes innato y adaptativo, los receptores celula- una interacción entre linfocitos circulantes no conres y sus blancos moleculares, con una relación vencionales (natural killer T-cells) y las células del
directa a las hepatopatías autoinmunes.
hígado, pudiendo determinar el inicio de acciones
inmunológicas intrahepáticas.
Se mencionan a la superfamilia de los mediadores químicos con el factor de necrosis tumoral, las
citoquinas y las células linfoides innatas con sus
subconjuntos funcionales.
DIAGNOSTICO IN VITRO
22
Los mecanismos de producción de autoanticuerpos patológicos incluyen a los propios antígenos
que fueron pobremente reconocidos o secuestrados en la ontogenia (epitopes crípticos y secuestrantes), o la generación de nuevos antígenos por
degradación de virus, xenobióticos y químicos en
el hepatocito (neoepitopes).
En la tabla siguiente se aprecian algunas de las
características de los autoanticuerpos naturales y
patológicos.
En cambio en otros pacientes con hepatitis crónica C, o inclusive en el mismo en momentos diferentes, los autoanticuerpos están asociados con
cambios histológicos de: hepatitis de interfase,
hepatitis panacinar e inflamación portal linfoplasmocitaria, que reflejarían vías patogénicas mediadas por la inmunidad. La hepatitis autoinmune de
tipo 2 es infrecuente. Según los criterios de Trey
y Davidson la falla hepática fulminante de origen
autoinmune es una entidad que afecta a mujeres
en la tercera década de la vida.
Autoanticuerpos
Autoanticuerpos
Patológicos
Naturales
Reflejos de procesos inmunes
No asociados a enfermedad
Indices de enfermedad
Laboratorio normal
Tipo IgG
Tipo IgM
Fuerte afinidad autoantigénica
Débil afinidad autoantigénica
Fijan el complemento
No fijan el complemento
Independientes de la edad y sexo Comunes en mujeres > 60 años
Con títulos altos
Con títulos bajos
La relación entre la producción de autoanticuerpos, la enfermedad y la predisposición genética,
aún está en discusión, pues múltiples factores
podrían interactuar en diferentes momentos en el
curso de la enfermedad.
El sistema inmune innato y el sistema inmune
adaptativo están íntimamente relacionados entre
sí, y constituyen el eje del sistema inmune del hígado. La primera puede activar los mecanismos
de la inmunidad adaptativa. Hoy en día se reconocen como blancos de acción de la inmunidad
innata a los receptores de reconocimiento de patrones (PRRs), de los que se destacan cuatro de
ellos, como se aprecia en la tabla siguiente.
Receptores de reconocimiento de patrones
Tipo Toll (TLRs)
Lectina tipo C (CLRs)
NOD-NLRs
RLR (RIG1 helicasa receptor)
Otros receptores
Asimismo hay ligandos, correceptores, adaptadores, factores de transcripción, y efectores humorales, cuyas intervenciones darían lugar a distintas
respuestas en los mecanismos de la inmunidad
adaptativa. Se acepta que la inflamación sería un
elemento preexistente indispensable para la rotura de la tolerancia.
Por ejemplo en algunos pacientes con hepatitis
crónica C, la asociación de autoanticuerpos con
cambios histológicos de cirrosis y marcada actividad histológica y bioquímica, serían consecuencia
de una inflamación hepatocelular.
Núcleo
Blancos
Centrómero
Clínica
HAI tipo 1
Ribonucleoproteínas
Complejos ribonucleop.
dsDNA
Músculo liso
dsDNA
Actina
HAI tipo 1
HAI tipo 1
Tubulina
Vimentin
Desmina
Esqueletina
LKM1
Mitocondria
P450 IID6 (CYP2D6)
PDH-E2
HAI tipo 1
CBP
pANCA
Antígenos Granulocíticos-específico
CEP y CU
en la lámina nuclear
HAI tipo 1
Actina
Hepatitis criptogénica?
HAI = hepatitis autoinmune; CBP = cirrosis biliar primaria;
CEP = colangitis esclerosante primaria; CU = colitis ulcerosa
Las propiedades inmunológicas del hígado se
confrontan en una única combinación de fenómenos. Algunas de ellas son la sobrevida del injerto
en el transplante a pesar de disparidades con el
antígeno mayor de histocompatibilidad, la inducción de tolerancias sistémicas contra antígenos
alimentarios, la persistencia de infecciones virales
por décadas, y un amplio espectro de enfermedades hepáticas inmune-específicas.
Y otras son circunstancias de la patología médica
que…
- Los nódulos linfáticos y el bazo están primariamente compuestos de linfocitos B y linfocitos T
con sus receptores (TCR y TCR-low), y representan la mayor población de células T del organismo.
- En el hígado la población de linfocitos es muy variada, es una mezcla compleja de TCR-low, TCR
clásicos Natural Killer y células dendríticas.
- La función que más caracteriza a los linfocitos intrahepàticos es su alta citotoxicidad con respecto
a otras células.
La capacidad de metabolizar xenobiòticos y aumentar su excretabilidad, involucra la conversión
de hidrofobia a hidrofilia de los compuestos tóxicos. La transformación de esas sustancias la
realizan familias de las isoenzimas transferasas,
diferenciadas inmunológica y fisiológicamente.
DIAGNOSTICO IN VITRO
23
La publicidad nos muestra el “gran desgaste” de
actividades como el estudio o el trabajo, que ocasionan al sistema inmune de niños y adultos la
necesidad de “recargar” ese sistema inmune deteriorado. Viendo la publicidad televisiva, cuesta
entender cómo la Humanidad (y sobre todo, esa
parte de la Humanidad que estudia o trabaja) ha
podido sobrevivir hasta ahora sin estos productos.
La disfunción inmune (CAIDS) en la cirrosis es un
estado multifactorial de disfunción inmunológicsistémica (Fig. 1), que disminuye la capacidad del
aclaramiento circulante de citoquinas, bacterias y
endotoxinas.
El hígado contiene el 90 % de células del retículo
endotelio, las células de Kupffer y las células endoteliales sinusoidales, todas ellas fundamentales
El TNF en fisiopatologías asociadas
para compensación de las bacterias. Si se inyectan bacterias radiomarcadas como el E. coli y la P.
Descripto en el siglo XIX a través de un audaz tra- aeruginosa, 10 minutos después solo sobreviven
tamiento para un doliente de cáncer, el TNF des- del 70 al 96 % de dicha población.
pierta un interés mayor por estar involucrado en
diversas patologías de la clínica médica.
En la hipertensión portal, la sangre circulante cada
vez más se aleja del hígado, y las bacterias y las
Denominado caquexina al principio, el factor de endotoxinas también, lo que establece una notoria
necrosis tumoral (TNF) fue sugerido por William disminución del contacto con el retículo endotelio.
Coley en 1893, quien retomando los primeros Además de la disfunción del sistema retículo-entrabajos del Dr. Friedrich Fehleisen de la univer- dotelial, los pacientes con cirrosis tienen dismisidad de Wurzburg en Alemania, observó que en nuida la movilización y la actividad fagocítica de
los pacientes con cáncer que desarrollaban una los neutrófilos, un fenómeno que se correlaciona
infección bacteriana (absceso) se inducía una ne- con la severidad de la enfermedad hepática. Esta
crosis tumoral. Su hija la Dra. Helen inyectaba el disminución se ha atribuido a la reducción de la
contenido de un absceso en el tumor del paciente actividad de tuftsina, y fosfolipasa C.
con cáncer y observaba una disminución notoria
del tumor. Como era acompañado de síntomas Se ha sugerido que la hiperamonemia en sinergia
como inapetencia, decaimiento, adelgazamiento y con la hiponatremia afecta el volumen celular de
debilidad le denominó inicialmente caquectina. La neutrófilos y pone en peligro la fagocitosis. La neusustancia en cuestión tenía un efecto antitumoral, tropenia como resultado del hiperesplenismo de
por tal motivo fue denominada factor de necrosis la cirrosis, se agrava aún más por el aumento de la
tumoral. Unos años más tarde, se descubrió que apoptosis con disminución de la supervivencia de
el TNF estaba formado por dos productos diferen- neutrófilos. La disminución de la actividad fagocítes, el TNF- que era idéntico a la caquexina (una tica de la respuesta inmune innata es por opsonisustancia que se produce en algunas enfermeda- zación y disminución de la capacidad bactericida.
des como la coagulación intravascular diseminada) y el TNF-β idéntico a la linfotoxina humana. El
TNF pertenece a la superfamilia de mediadores
químicos que llevan su nombre y a la cual pertenecen al menos 15 citoquinas.
DIAGNOSTICO IN VITRO
24
Los pacientes con cirrosis tienen niveles mucho
más bajos de inmunoglobulinas IgM, IgG e IgA en
el líquido ascítico. Además las concentraciones
de complemento C3, C4 y CH50 son significativamente más bajas en el suero y líquido ascítico, lo
que conduce a la disminución de la actividad bactericida.
Los aspectos adicionales de la inmunodeficiencia
son complicados por factores como la desnutrición, los medicamentos inmunosupresores, y la
ingesta de alcohol, pues su consumo crónico y
agudo está asociado a una disminución en las
células T, células B, Natural Killer y monocitos, y
en contrapartida con un aumento de las citoquinas inflamatorias. La exposición crónica de etanol
aumenta la producción de especies reactivas del
oxígeno (ROS), éstas se generan en las diferentes
etapas del metabolismo del etanol y son altamente tóxicas al superar la capacidad antioxidante de
los hepatocitos.
La relación entre la disfunción del sistema inmunitario y la infección en la cirrosis ha sido ampliamente investigada. La translocación bacteriana
parece ser un paso importante, lo que explica el
aumento de los niveles de endotoxinas, citocinas
y NO, los cuales desempeñan un papel fundamental en el desarrollo de una excesiva respuesta inflamatoria y un estado circulatorio hiperdinámico
en la cirrosis. Como la función hepática se deteriora y se avanza la hipertensión portal, la infección manifiesta es más propensa a desarrollarse
y posteriormente puede evolucionar a sepsis, con
las consecuencias del shock séptico, la falla multiorgánica y la muerte.
El descubrimiento de diversos subconjuntos funcionales de las CIT sugiere la presencia de una
versión innata de inmunidad citotóxica, Th1, Th2,
Th17, Th22.
Desde la distancia, los dos lados de la inmunidad
son distintos en detalle, pero común en la función
y el significado (Fig. 1). Es posible que se deba repensar qué tanto control inmunológico se produce
en el nivel innato y las nuevas oportunidades que
esto ofrece para la manipulación terapéutica de la
infección y la enfermedad inflamatoria. Su reconocimiento nos muestra un mundo de adaptación
paralelo, y a los linfocitos innatos como competentes en cada uno de los modelos inmunes de
la defensa microbiana y la regulación inflamatoria.
Estos dos mundos comparten la activación de los
mismos mecanismos y respuestas de las citoquinas y las quimioquinas.
Nos encontramos confrontados con algo no esperado. Cuanto de nuestro conocimiento de la inmunidad adaptativa opera en un nivel innato? Es
posible que no necesitemos de otro mundo, pero
ahora que tenemos uno nuevo, debemos abrazar
el asombro y la oportunidad.
La capacidad de metabolizar xenobióticos y aumentar su excretabilidad, involucra la conversión
de hidrofobia a hidrofilia en compuestos tóxicos.
La transformación de esas sustancias la realizan
familias de isoenzimas transferasas, diferenciadas inmunológica y fisiológicamente. El almacenamiento en polímeros permite su utilización en
medicina, y una de las mayores fuentes de obtención es el hígado.
En el mundo cada vez más raro de la inmunidad,
una nueva categoría de linfocitos ha aparecido, las Bajos niveles de adiponectina son predictores
células linfoides innatas (CIT).
de esteatosis hepática, por lo tanto su ausencia
como marcador biológico en el hígado tiene un rol
Destacadas en la mucosa intestinal, tienen la sen- fundamental en la hepatoprotección del mismo.
sación de pertenecer al medio ambiente más que
a núcleos antigénicos y ofrecen una gama total
de funciones inflamatorias de una magnitud más
rápida que la adaptación de células B, CD4 +, o
células T CD8 +.
Lecturas aconsejadas
•
Wajahat Z et al.Immunology of the healthy liver: old questions and new insights. Gastroenterology 2001;
120:250-260.
•
Bonnel AR, Bunchorntavakul Ch, Reddy Rajender K. Disfunción Inmune y las infecciones en pacientes con
cirrosis. Clin Gastr & Hepat. 2011; 9: 727-738.
•
Tilg H, Moschen AR & Kaneider NC. Pathways of liver injury in alcoholic liver disease. Journal of Hepatology
2011; 55(5): 1159-1161.
•
Mehal WZ et al. Immunology of the healthy liver: old questios and new insights. Gastroenterology 2001;
120: 250-260.
•
William B Coley. Contribution to the knowledge of sarcoma. Annals of Surgery. New York. 1891.
•
Fehleisen F, Fischer Theodor. Die Etiologie Des Erysipels. Berlin 1883.
•
Czaja AJ & Homburger HA. Autoantibodies in liver disease.. Gastroenterology 2001; 120: 239-249.
•
Schroder T. Cirrosis biliar primaria e inmunidad innata. Actualizaciones en hepatología2012; 4(13):38-48.
•
Lin L & Braun J. Another Earth: Innate Lymphoid Cells and Intestinal Inflammation. Gastroenterology
2011;141(5): 1542-1544.
JÓVENES INVESTIGADORES / IFCC
Entrevista realizada por:
DIAGNOSTICO IN VITRO
Pablo Biaggioni
Editor Invitado WG-IANT
E-mail: [email protected]
25
Entrevistados:
Un espacio para los “Residentes
Bioquímicos” en Argentina
La Comisión de Residentes Bioquímicos
(CoReBio) es una asociación civil sin fines de lucro
fundada en Argentina el año 1986. Desde sus orígenes, CoReBio nuclea a todos los residentes bioquímicos, provenientes de hospitales municipales,
provinciales, nacionales, universitarios; públicos y
privados; de la República Argentina”.
Sofía Aguirre
Vice Presidente de CoReBio
Santiago Fares Taie
Presidente de CoReBio
gan un ateneo una vez al año. Actualmente participan 40 hospitales de todo el país.
• Cada dos años organizamos el Congreso Nacional de Residentes Bioquímicos. A este evento
asisten disertantes de reconocida trayectoria y
bioquímicos de todo el país. En este contexto los
residentes tenemos la oportunidad de presentar
trabajos de investigación desarrollados durante
nuestro período de residencia. En el 2016 se llevará a cabo el VIII Congreso nacional de Residentes
Bioquímicos.
Realizamos una serie de preguntas a dos miembros del comité directivo: Santiago Fares Taie, Presidente de CoReBio y Residente de 4°año del Centro de Educación Médica e Investigaciones Clínica
“Norberto Quirno”; y Sofía Aguirre, Vicepresidente
de CoReBio y Residente de 3° año del Hospital de • La organización de cursos presenciales y online
Clínicas “José de San Martín”.
a través de nuestro campus virtual. Recientemente comenzó el curso online “Calidad Analítica en el
P. Biaggioni: ¿Cuáles son los objetivos principales Laboratorio Clínico - Verificación de procedimiende la institución?
tos de medida” dictado por el Dr. Gabriel Alejandro
S. Fares Taie: Uno de los objetivos de CoReBio es Migliarino.
crear un ámbito propio del residente que le permita tomar contacto no sólo con residentes de otros • Jornadas de actualización con sociedades de esámbitos u hospitales, sino también vincularse con pecialistas y charlas con expertos.
otras asociaciones y entidades bioquímicas. En
otras palabras, mejorar la comunicación entre los Por otra parte, CoReBio también ofrece a través
colegas bioquímicos.
de página web información acerca de las distintas
residencias disponibles. De ésta forma, los estuOtro objetivo de jerarquía es generar un espacio diantes que deseen acceder a una residencia puedestinado a la realización de distintas actividades den evaluar las distintas opciones sin la necesidad
académicas cuyo fin es la capacitación y forma- de concurrir a cada uno de los hospitales.
ción continua de sus socios. Entre estas actividades podemos mencionar las siguientes activida- En la página web contamos con un espacio dondes:
de se publican ofertas laborales. Este espacio es
de gran importancia, en especial para aquellos
• La organización de ateneos mensuales interhos- bioquímicos que estén terminando la residencia y
pitalarios en el aula magna del Hospital Prof. Dr. necesitan un puesto de trabajo.
Juan P. Garrahan. En ésta instancia se le pide a los
residentes de los distintos hospitales que expon-
DIAGNOSTICO IN VITRO
P. Biaggioni: ¿Qué es un Bioquímico Residente y
cuáles son sus funciones?
S. Fares Taie: El ministerio de salud de la nación
Argentina define la residencia como:
26
La residencia es un sistema de formación de posgrado inmediato para profesionales del área de la
salud, que se caracteriza por ofrecer oportunidades de práctica intensiva y supervisada en ámbitos asistenciales, y por la asignación de una renta mensual. La formación contempla contenidos
prácticos y teóricos entre los que se distinguen
aspectos comunes a los distintos campos profesionales y otros propios de cada especialidad.
El aprendizaje se organiza según principios de autonomía y responsabilidad creciente, y se orienta
hacia la adquisición de las capacidades y conocimientos necesarios para el ejercicio autónomo de
la práctica profesional.
P. Biaggioni: ¿Quienes son responsables la formación?
S. Fares Taie: Los responsables de la formación
de los residentes son los encargados del área de
docencia de cada hospital. Estos son: el Jefe de residentes, el Instructor de residentes y Coordinador
de residentes. Paralelamente, el residente también
es responsable y un actor fundamental en su formación al demostrar entusiasmo y compromiso
con su aprendizaje.
P. Biaggioni: ¿Por qué se considera una formación
de excelencia?
S. Aguirre: La residencia es considerada una formación de excelencia porque el bioquímico residente desarrolla sus habilidades como bioquímico
en un marco académico, realizando cursos, asistiendo a ateneos y participando de reuniones interdisciplinarias del equipo de salud que completarán
su formación como profesional.
Para describir al residente bioquímico primero hay
que decir qué tareas realiza el bioquímico.
El bioquímico residente no está detrás de una
mesada del laboratorio solamente, desarrollando
En Argentina, el ejercicio de la profesión bioquími- habilidades técnicas o validando resultados, es un
ca tiene distintas competencias, algunas de ellas actor clave en la dinámica del laboratorio por ser
son:
un estímulo para los demás profesionales para
enseñarle y transmitirle sus conocimientos al re• Realización e interpretación de análisis de labo- sidente.
ratorio y otros que contribuyan a la prevención,
diagnóstico y tratamiento de las enfermedades de El residente aprende a trabajar en equipo no solo
los seres humanos y a la preservación de su salud; con sus compañeros residentes sino también con
• Realización e interpretación de análisis bromato- los distintos profesionales de los diferentes laboralógicos, toxicológicos, de química legal y forense y torios donde realiza las rotaciones. Cambiar de un
los referentes a la detección de la contaminación y área del laboratorio a otra resulta ser una ventaja
control ambiental;
para el residente porque no solo pasa por distintas
• Actividades analíticas y de investigación realiza- áreas y así puede realmente ver cuál es el área que
das en Bancos de Sangre;
más le interesa para realizar el ejercicio profesional, sino también porque aprende a adaptarse a
En una residencia bioquímica se realizan algunas distintos grupos de trabajo y dinámicas de trabajo.
de estas actividades, existiendo residencias espe- En definitiva, la residencia es una etapa clave en
cíficas dedicadas a la toxicología, a la citogenética, la vida de un bioquímico porque adquiere expea la inmunología y/o la microbiología.
riencias de vida únicas, no solo profesionales sino
también personales.
P.Biaggioni: ¿Cómo es el proceso de acceso al cargo?
P. Biaggioni: Me interesa conocer el tipo de actividades que realiza CoReBio para favorecer la forS. Fares Taie: Para acceder al cargo los aspirantes mación de los residentes bioquímicos.
deben realizar un examen de opciones múltiples S. Aguirre: CoReBio organiza ateneos mensuales
de 100 preguntas. El examen se rinde una vez por donde una vez por año cada hospital selecciona
año; generalmente en el mes de abril; y de acuerdo residentes para presentar un tema que puede ser
al puntaje obtenido y el promedio de sus estudios la descripción de una patología con el diagnóstico
universitarios se realiza un orden de mérito. Luego bioquímico como pilar fundamental de la misma,
los aspirantes deben adjudicar las vacantes, eli- o un caso clínico donde el laboratorio haya cumpligiendo el hospital por orden de mérito.
do en rol importante. En definitiva, es profundizar
algún tema específico y como tal CoReBio le pide
Es importante destacar que no hay un único exa- a sus disertantes que los temas no se repitan en
men. Los hospitales de Ciudad de Buenos Aires y dos años consecutivos.
de la Universidad de Buenos Aires responden a un
examen, mientras que los hospitales dependien- Además de los ateneos mensuales, la Comisión
tes de la nación o la provincia de Buenos Aires organiza cursos, generalmente con modalidad virresponden a otro, y por lo general los hospitales tual, para fomentar el desarrollo académico de los
privados tienen un examen propio.
residentes. Y de esta manera, pueden participar de
los mismos residentes de todo el país.
DIAGNOSTICO IN VITRO
27
P. Biaggioni: ¿Que actividades tiene la CoReBio
pensadas para el futuro?
S. Aguirre: En el mes de agosto la CoReBio participará del 71° Congreso Argentino de Bioquímica organizado por la Asociación Bioquímica Argentina
y en el primer semestre del año 2016 se llevará a
cabo el VIII Congreso Nacional de Residentes Bioquímicos en la Ciudad de Buenos Aires.
no hemos generado vínculos.
P.Biaggioni: ¿Cómo puede el público en general o
los representantes de otras instituciones ponerse
en contacto?
S. Aguirre: Todo aquel interesado en ponerse en
contacto con la comisión puede hacerlo a través
de la página web www.corebio.org.ar en la sección
“Contacto”, a través de un correo electrónico a la
P.Biaggioni: ¿Conocen entidades similares en el dirección [email protected] o por Facebook
resto del mundo?
en la página de CoReBio.
S. Fares Taie: A través de la radio El Microscopio
nos hemos enterado que existen grupos similares
en Colombia, Perú, Paraguay y Ecuador, pero aún
ENTREVISTA
DIAGNOSTICO IN VITRO
Entrevista realizada por:
28
Radio El Microscopio
Entrevistado:
El gluten, ¿está relacionado con el
Autismo y la Esquizofrenia? PARTE 1
La enfermedad celíaca (EC), se
caracteriza por una combinación variable
de síntomas y signos inducidos por el
gluten, la presencia de los anticuerpos
específicos, un antígeno mayor de
histocompatibilidad específico (HLA DQ2
o DQ8) y enteropatía. Esta nueva definición,
que ha sido muy recientemente realizada
por un grupo de trabajo de la Sociedad
Europea de Gastroenterología Pediátrica,
Hepatología y Nutrición (ESPGHAN), se
aleja de la anterior, en la que la enteropatía
(atrofia vellositaria) tenía el papel
central. La EC constituye un modelo de
enfermedad autoinmune multisistémica
con disparador conocido (gluten), y
una respuesta humoral específica: los
anticuerpos antitransglutaminasa tisular
o transglutaminasa 2.
El Dr. Alessio Fasano es Director del
Centro de Investigación en Enfermedad
Celiaca y del Centro de Investigación de
Biología de las Mucosas. Es Profesor
de Pediatría, Medicina y Fisiología en
la Universidad de Maryland, Facultad
de Medicina, en la ciudad de Baltimore,
estado de Maryland, Estados Unidos. En
esta entrevista describe sus líneas de
investigación y las posibles conexiones
entre gluten, Autismo y Esquizofrenia.
Dr. Alessio Fasano
Director del Centro de Investigación en
Enfermedad Celiaca
Radio El Microscopio: ¿Por qué se realizó
una Conferencia de Consenso en Trastornos Relacionados con el Gluten en el 2011?
Alessio Fasano: Se mantenían supuestos en el
mundo y parecía que la única reacción clínica al
gluten era la Enfermedad Celíaca. Y por muchos
años, se siguieron las reglas que decían que si el
paciente tenía algún problema al consumir gluten,
era por la Enfermedad Celíaca, siendo ésta la causante de los síntomas. Y si la enfermedad no era
confirmada, era porque no existía problema alguno con el gluten y el paciente podía consumirlo sin
ningún problema.
Luego, con el tiempo, descubrimos que había muchos pacientes que no cumplían con los criterios
de la Enfermedad Celíaca y aseguraban que si dejaban de consumir gluten, los síntomas desaparecían. Fue aumentando mucho el número de este
tipo de pacientes y, es por eso, que pensamos en
reunir a un panel de expertos en Londres en el año
2011, de diferentes partes del mundo, incluso de
Argentina, para tratar dos temas principales. Uno
los temas fue presentar este fenómeno y ver si los
expertos se habían encontrado con este último
grupo de pacientes que acabamos de describir. Y
la respuesta fue “sí”. Y el segundo tema fue ordenar la nomenclatura de los Trastornos Relacionados con el Gluten, porque se estaban llamando a
las mismas cosas con diferentes nombres en diferentes partes del mundo y nos pareció más efectivo armonizar el modo en el que tratamos estos
trastornos.
DIAGNOSTICO IN VITRO
29
REM: ¿Cuál es la diferencia entre Enfermedad determinados por el paciente. Según las reglas
Celíaca, Sensibilidad al Gluten y Alergia al Trigo?
que establecemos, si no es Enfermedad Celíaca,
el problema del paciente con el gluten desaparece.
AF: Durante la Conferencia de Consenso de 2011 Sin embargo, tienen que saber que existen estas
también dedujimos las condiciones posibles rela- diferentes formas de reacciones al gluten. La secionadas con la exposición al gluten en estas tres gunda sugerencia es que le digan al paciente que
categorías.
no tiene que comenzar una dieta libre de gluten
antes de saber en qué parte del espectro están.
La Alergia al Trigo es una reacción alérgica al glu- Porque, si siguen una dieta libre de gluten antes
ten. En otras palabras, se puede manifestar una del diagnóstico, no contamos con las herramienreacción alérgica al trigo como también se pue- tas que nos indican en qué parte del espectro se
de manifestar con cualquier otro alimento, como encuentra el paciente y no podemos hacer ningufrutillas, mariscos o maníes. El mecanismo es el na distinción. El tercer consejo es que estas son
mismo. Está comprometido parte del sistema in- condiciones complejas y el manejo necesita de un
mune, que produce anticuerpos llamados Inmu- nutricionista con conocimientos en el tema para
noglobulina E (IgE), y esos son los anticuerpos que que indique cómo implementar una dieta libre de
pueden desencadenar reacciones alérgicas. Estas gluten, porque existe una diferencia entre la Enferpersonas pueden presentar síntomas tales como medad Celíaca, la Sensibilidad al Gluten o Alergia
sarpullidos en la piel, asma, problemas gastroin- al Trigo.
testinales e incluso alguna manifestación masiva
a la reacción.
REM: Existe un 6% aproximadamente de personas
con Sensibilidad al Gluten, este porcentaje es muy
La Enfermedad Celíaca es la forma autoinmune alto. ¿Es esto una enfermedad o son solo síntode las reacciones al gluten. Es como la Diabetes, mas o daños?
la Esclerosis Múltiple y la Artritis Reumatoidea y
esto es una receta con dos ingredientes: muchos AF: Creo que es una enfermedad. Ya hemos degenes, genes con los que nacemos, que nos po- mostrado que una vez que se activa el sistema
nen en riesgo de desarrollar enfermedades autoin- inmune hay una respuesta específica al gluten. La
munes y factores medioambientales, algo a lo que diferencia con la Enfermedad Celíaca es que no
estamos expuestos y que el sistema inmune ve hay daño en el intestino, en otras palabras, no hay
como posible enemigo y, en lugar de eliminarlo, esa respuesta autoinmune típica de la Enfermecomo típicamente debería hacer el sistema inmu- dad Celíaca. Sin embargo, hay otro tipo de inflane, empieza a atacar el cuerpo y, en la Enfermedad mación que puede indicar que existe un problema.
Celíaca, la barrera es el intestino. Esa es la segun- Entonces, a pesar de que no haya un daño, no sigda forma de la reacción.
nifica que no pueda existir una enfermedad. Todo
depende de cómo se defina una enfermedad. Para
La tercera, la más reciente, de la que poco sabe- mi, la constipación es una enfermedad, o el Síndromos todavía, es la Sensibilidad al Gluten. Es una me de Colon Irritable es una enfermedad, el reflujo
reacción al gluten, pero no es una reacción alérgi- gastro-esofágico es una enfermedad, esto es sólo
ca como la Alergia al Trigo, y no es una reacción para dar datos generales. Pero, si se realiza una
autoinmune como la Enfermedad Celíaca, pero es biopsia a una persona con constipación o Síndrootra forma de reacción que crea las condiciones me de Colon Irritable, o, incluso, con reflujo, no se
que puede llevar a los síntomas. Estas tres condi- encuentran daños. Sin embargo, las personas esciones son las que se manifiestan en las personas, tán enfermas y necesitan tratamiento. Entonces,
en diferente frecuencia. Por ejemplo, sabemos que considerando esto, la Sensibilidad al Gluten es una
la Enfermedad Celíaca afecta aproximadamente condición clínica en la que sabemos qué parte del
al 1% de la población mundial, la Alergia al Trigo sistema inmune está involucrado, sabemos qué
es menos frecuente, afecta a un 0,1 - 0,3% de la mecanismos, qué regulaciones de determinados
población. Pero como aún no tenemos la manera genes hay, qué parte del sistema inmune está inde hacer un diagnóstico directo para la Sensibi- volucrado, pero la rama de adaptación no está.
lidad al Gluten, es decir, no tenemos pruebas de El sistema inmune de adaptativo es fundamental
sangre. Solo tenemos estimaciones que parecen para el comienzo de la Enfermedad Celíaca y muindicar que podría afectar al 6% de la población; chas otras enfermedades autoinmunes.
entonces, de las tres reacciones, esta última es la
más común.
REM: ¿Qué le recomendaría o aconsejaría a los
profesionales de la salud?
AF: Sugeriría que se informen y que flexibilicen la
manera de pensar, ya que muchas veces se ven
DIAGNOSTICO IN VITRO
30
REM: ¿El gluten está relacionado con el Autismo y a su vez, es poco probable que ninguna de esas
la Esquizofrenia?
personas haya sufrido algún cambio de conducta.
Como es de esperar, las enfermedades complejas
AF: Estos son dos temas muy controversiales, pueden tener finales distintos. Uno las diagnostiacerca de los Trastornos Relacionados con el Glu- ca, pero varían de un individuo a otro. Y creo que
ten, específicamente, la Sensibilidad al Gluten y la hay que considerar que estas personas pueden
enfermedad en sí.
llegar a estos estadios a través de la sensibilidad
al gluten.
Desde hace mucho tiempo, se sabe que el gluten
puede crear problemas en los niños y causar es- Hemos realizado estudios sobre este tema en paquizofrenia o autismo. Se han realizado observa- cientes con Esquizofrenia, y estimamos que un
ciones clínicas de esto. Por ejemplo, se observó 20% puede haber desarrollado Esquizofrenia debique la Esquizofrenia disminuyó durante la Segun- do al problema con el gluten. Y un número similar,
da Guerra Mundial, cuando no había granos dispo- un 15%, según nuestros estudios, son personas
nibles en Europa, pero, a su vez, al mismo tiempo, que pueden haber desarrollado autismo debido a
en los Estados Unidos el gluten fue dejado de lado, la sensibilidad al gluten. Estamos en el comienzo
durante ese mismo período, y la Esquizofrenia au- de la historia y hemos publicado tres o cuatros armentó.
tículos de investigación sobre Esquizofrenia. Estamos haciendo lo mismo con el Autismo para darle
También, se han realizado observaciones cuando solidez al concepto de los subgrupos. Los subgruse les ha dado a niños con Autismo dietas libres pos de individuos con este tipo de problemas puede gluten y se observó una mejora en la conducta. den manifestar sensibilidad al gluten. La cuestión
Pero, no hay estudios de control y, por tanto, hay sería, ¿Podremos tener biomarcadores para idenmucha controversia en dos frentes principales: tificar estos subgrupos para que podamos identilos que creen y los que no creen. Los que creen, ficar el tratamiento para ellos?
sostienen que todos los casos de esquizofrenia y
autismo pueden ser tratados con una dieta libre Lea la segunda parte de la nota al Dr. Alessio Fasade gluten y, los que no creen, sostienen que eso no no en www.infobioquimica.org.
tiene ningún sustento en la evidencia. Mi opinión
personal es que se puede estar en el medio de
ambas creencias. Es imposible de sostener que
todos los casos de Esquizofrenia y Autismo estén
relacionados con la Sensibilidad al Gluten, pero,
La entrevista con el Dr. Alessio Fasano (Estados Unidos), Director del Centro de Investigación en Enfermedad
Celíaca, fue emitida el Miércoles 22 de Agosto de 2012, en la Emisión 2 de la Radio El Microscopio a través del
portal www.infobioquimica.org.
El Microscopio es un programa de radio que se transmite a través de Internet, organizado por el Grupo de Trabajo
de Traducciones y Nomenclatura Iberoamericana y el Comité de Medicina de Laboratorio Basada en la Evidencia
de la IFCC. Se difunden temas de interés científicos, estratégicos y de actualidad, y así disponer de un espacio
para informarnos y conocernos, debatir nuestros problemas y encontrar soluciones. El programa, de una hora de
duración, se emite todos los miércoles a partir de las 13:00 hs., hora de Argentina (GMT - 03). Puede ser escuchado
en cualquier momento.
Editorial:
División de Publicaciones de la IFCC y
Comunicaciones (IFCC -CPD )
Copyright © 2015 IFCC.
Reservados todos los derechos.

Documentos relacionados